ID: 1163460784

View in Genome Browser
Species Human (GRCh38)
Location 19:17436272-17436294
Sequence CAGAATGAGGAGGTGAAGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 702
Summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 647}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163460774_1163460784 17 Left 1163460774 19:17436232-17436254 CCAGGAGACACCTAGCCAGCGCT 0: 1
1: 0
2: 0
3: 13
4: 87
Right 1163460784 19:17436272-17436294 CAGAATGAGGAGGTGAAGGCTGG 0: 1
1: 0
2: 5
3: 49
4: 647
1163460776_1163460784 7 Left 1163460776 19:17436242-17436264 CCTAGCCAGCGCTGGCCTCTGAC 0: 1
1: 0
2: 1
3: 24
4: 244
Right 1163460784 19:17436272-17436294 CAGAATGAGGAGGTGAAGGCTGG 0: 1
1: 0
2: 5
3: 49
4: 647
1163460777_1163460784 2 Left 1163460777 19:17436247-17436269 CCAGCGCTGGCCTCTGACTTTCC 0: 1
1: 0
2: 10
3: 59
4: 426
Right 1163460784 19:17436272-17436294 CAGAATGAGGAGGTGAAGGCTGG 0: 1
1: 0
2: 5
3: 49
4: 647
1163460773_1163460784 30 Left 1163460773 19:17436219-17436241 CCTGGGAAGACTTCCAGGAGACA 0: 1
1: 0
2: 6
3: 29
4: 319
Right 1163460784 19:17436272-17436294 CAGAATGAGGAGGTGAAGGCTGG 0: 1
1: 0
2: 5
3: 49
4: 647
1163460778_1163460784 -8 Left 1163460778 19:17436257-17436279 CCTCTGACTTTCCCTCAGAATGA 0: 1
1: 0
2: 1
3: 24
4: 215
Right 1163460784 19:17436272-17436294 CAGAATGAGGAGGTGAAGGCTGG 0: 1
1: 0
2: 5
3: 49
4: 647

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163460784 Original CRISPR CAGAATGAGGAGGTGAAGGC TGG Exonic
900943811 1:5818075-5818097 CACACTGAGGCGGTGGAGGCTGG + Intergenic
901763809 1:11487622-11487644 CAGCTGGAGGAGGTGAAGCCTGG - Intronic
902202494 1:14844419-14844441 CATAATGAGGAGGGTAAGGAAGG - Intronic
903449788 1:23445133-23445155 CAGAGAGGGGAGGTGATGGCTGG + Intronic
903493810 1:23750912-23750934 CAGAAGGAGGAGGAGATGGAGGG + Exonic
903864761 1:26389918-26389940 CAGAATGAGGAGGAAGGGGCAGG + Intergenic
903900376 1:26640453-26640475 CAGGATCAGGAGGTGATGGGCGG - Intergenic
903901294 1:26647585-26647607 CAGGATCAGGAGGTGATGGGCGG + Intergenic
904362990 1:29990568-29990590 CAGATTAAGGAGGTGGAGACAGG - Intergenic
904409391 1:30315921-30315943 CAGAAGGGGGAGGAGAAGGGAGG - Intergenic
904424338 1:30413915-30413937 AAGAGTGTGGAGGTGAAGCCAGG - Intergenic
904491230 1:30860622-30860644 CAGAATGAGGATTTGAATCCAGG - Intergenic
904521995 1:31102785-31102807 CAGTATGGGGAGGTGGAGTCAGG - Intergenic
905741045 1:40372201-40372223 CAGAGTGAGGAGATGAAGATGGG + Intronic
905845186 1:41224099-41224121 TAGACTGAGGAGGTGAAAGAGGG - Intronic
906180853 1:43817622-43817644 GAGAAGGAGGAGGAGAAGGGAGG - Intronic
906672725 1:47668464-47668486 GAGAAGGAGGAGGTGGAGGGAGG + Intergenic
907124322 1:52035763-52035785 CATAAGGAGGAGGAAAAGGCAGG - Intronic
909130196 1:71725741-71725763 CAGAAAGAGGAGGAAAAGGATGG - Intronic
909334487 1:74455762-74455784 CAGAATGAGGAGGCAGAGGAAGG - Intronic
910149401 1:84124577-84124599 CAGCATAAAGAGGTGAAGGTAGG - Intronic
910230860 1:84985135-84985157 CAGCTTGAGGAGGTAAATGCTGG - Intronic
910594576 1:88965737-88965759 CAAAATGAGGAGGTAGATGCTGG - Intronic
910777291 1:90889733-90889755 CACACTTAGGAGGTCAAGGCGGG - Intergenic
911257294 1:95647069-95647091 CAGACTGGGGAAGAGAAGGCAGG + Intergenic
912091232 1:106079293-106079315 CAGAGTCAGGATGTGAATGCGGG - Intergenic
912799786 1:112713744-112713766 CAGAGGGAGGAGGAGAAGGGAGG + Intronic
913283023 1:117203333-117203355 CACAATGAGGAGGTGAGGCAGGG + Intronic
914766390 1:150641235-150641257 CGAATTGAGGAGGGGAAGGCTGG - Intergenic
914860727 1:151383721-151383743 CAGAAAGAGGAGGTCCATGCTGG - Intergenic
914993103 1:152515480-152515502 CAGCAGGAGGAGGAGGAGGCGGG - Exonic
915980050 1:160414886-160414908 CAGAATCAGAAGGTGAAGTATGG + Intronic
916058143 1:161082031-161082053 TAGAATGAGGAGGAACAGGCTGG + Intronic
916321179 1:163505987-163506009 GAGAAAGAGAAAGTGAAGGCTGG - Intergenic
916923980 1:169498341-169498363 AAGAATGAGGAGCAGAAGGCTGG + Intergenic
917820795 1:178761805-178761827 TAAAAACAGGAGGTGAAGGCGGG - Intronic
918069511 1:181124592-181124614 CAGAAGGAGGAGGAGGAGGGAGG - Intergenic
918149323 1:181784586-181784608 CTGAGGGAGGAGGTGAAGGTAGG - Intronic
919270972 1:195344446-195344468 AAGGATGAGGAGGTAAATGCTGG - Intergenic
919495484 1:198261300-198261322 CAGAATCAGGACTTGAAGCCAGG - Intronic
921167761 1:212519153-212519175 AAGTATGTGTAGGTGAAGGCAGG + Intergenic
921179523 1:212620835-212620857 CATAATGGGGAGGGAAAGGCAGG - Intergenic
921338916 1:214114861-214114883 CAGAATGACCAGTTGAAAGCTGG + Intergenic
921878786 1:220230078-220230100 AAGAATGAGGAGGGGAGGGAAGG - Intronic
921937466 1:220808271-220808293 CAGAGTGAGGGTGGGAAGGCGGG + Intronic
923103065 1:230832658-230832680 CAAAATGAGGGGGTGGAGGGAGG + Intergenic
923109515 1:230879771-230879793 CTGATTGAGGAGGGGGAGGCTGG - Intergenic
923109528 1:230879808-230879830 CTGATTGAGGAGGGGGAGGCCGG - Intergenic
923126220 1:231036781-231036803 CAGAATGTGGAGCTGGAAGCTGG - Intronic
923506025 1:234607797-234607819 CAGAACCAGAAGGTGAAGTCGGG - Exonic
924837816 1:247672152-247672174 CAGAATAGGGAGATGCAGGCAGG - Exonic
1063022120 10:2139673-2139695 CAGAGTAAGAGGGTGAAGGCCGG + Intergenic
1063108131 10:3011776-3011798 AAGAATGAGGAGTTCGAGGCCGG - Intergenic
1063893045 10:10649984-10650006 CAGAATGAGCAGATTACGGCGGG - Intergenic
1064018912 10:11793904-11793926 CAGGATGAGAAGAGGAAGGCAGG + Intergenic
1064305130 10:14158642-14158664 GAGAAGGAGGAGGAGAAGGGGGG + Intronic
1064387383 10:14908834-14908856 CAGAACAAGGAAGTCAAGGCTGG - Exonic
1065435287 10:25699168-25699190 CAGAAGTAGGAGATGAAGTCAGG + Intergenic
1066406945 10:35127246-35127268 CAGGAGGTGGAGGTGGAGGCAGG + Intronic
1067343528 10:45422277-45422299 CAGAATGAGAGGATGGAGGCTGG - Intronic
1067472844 10:46548841-46548863 CAGGATGAAGAGGTGAAGACAGG + Intergenic
1067508880 10:46878504-46878526 AAGAATGAGGAGGGGAAGTGAGG + Intergenic
1067793478 10:49304647-49304669 CAGAGAGAGGAGGTTCAGGCAGG - Intronic
1067909641 10:50332870-50332892 AAGACAGAGGAGGTGGAGGCAGG - Intronic
1068675342 10:59764210-59764232 CAGAAGGAGGAGGTGATGCTGGG + Intergenic
1068698983 10:60000155-60000177 CAAAATAAGGATGTGAAGGGAGG + Intergenic
1069058078 10:63865459-63865481 CAGGAGGTGAAGGTGAAGGCAGG + Intergenic
1069601233 10:69709517-69709539 CAGAATCAGCAGGTGCAGCCTGG + Intergenic
1069683181 10:70299753-70299775 CAGGATGAGGAGGTCAAGACAGG - Exonic
1069718533 10:70535651-70535673 GAGAAGGAGGAGGAGAAGGAAGG - Intronic
1070144880 10:73766550-73766572 CAGATTGTGGAGGTAAAGGTTGG + Intronic
1070282464 10:75059671-75059693 CAGTGTGAGGAGGGGCAGGCCGG + Intergenic
1070548341 10:77470314-77470336 CAAACTGAGGAGGTGAGGCCCGG + Intronic
1070802344 10:79251057-79251079 GAGATCGAGGAGGTGAAGACTGG + Intronic
1070949518 10:80419602-80419624 CAGAAAGAGGAGGTCCTGGCAGG - Intronic
1071137249 10:82466829-82466851 CACGATGAGGAGGTGAGGACAGG + Intronic
1071199885 10:83209427-83209449 CATAATGAGGGGGTGGAGGAGGG - Intergenic
1072209224 10:93231388-93231410 CAGGCTGGGGAGGAGAAGGCAGG + Intergenic
1072519521 10:96218775-96218797 CAGAAAGAGGAGGGGGAGGATGG - Intronic
1072887199 10:99288484-99288506 GAGAAGGAGGAGGAGAAGGATGG + Intergenic
1073020198 10:100437080-100437102 GAAAAATAGGAGGTGAAGGCCGG + Intergenic
1074098968 10:110338526-110338548 CAGAATGATAAGGCGATGGCAGG - Intergenic
1074369009 10:112883787-112883809 CAGAATGAAAAGTTTAAGGCTGG - Intergenic
1075154868 10:119966832-119966854 CAATGTGAGGAAGTGAAGGCAGG - Intergenic
1075408116 10:122207998-122208020 CAGGAAGAGGAGGTCACGGCTGG + Intronic
1075538816 10:123295162-123295184 CAAAATGAGGAGGTCAAAGTAGG - Intergenic
1076067266 10:127458698-127458720 CAGAAGCAGGAGGTGAAGGAGGG + Intergenic
1076188156 10:128464624-128464646 CCTAATGAGGAGGGGAAGGCAGG - Intergenic
1076240000 10:128897715-128897737 CAGAATCAGGTGGGGAAGGAAGG - Intergenic
1076245972 10:128948171-128948193 TACAATGTGGAGGTGATGGCAGG - Intergenic
1076342366 10:129758527-129758549 AGGAATGAGGAGGTGACTGCAGG - Intronic
1077256160 11:1584347-1584369 CAGGAAAAGGAGGTAAAGGCTGG + Exonic
1077521735 11:3040061-3040083 TAGACTGAGGAGGAGAAGGGGGG - Intronic
1077772334 11:5233698-5233720 CAGAATTAGCAGGTGAGAGCTGG + Intronic
1078181568 11:9015997-9016019 GAGAATGAGGAGGTGGTGGGAGG - Intergenic
1078797522 11:14607634-14607656 CAGGGGGAGCAGGTGAAGGCAGG + Intronic
1079092966 11:17493615-17493637 CAGAAAGCAGAGCTGAAGGCAGG - Intergenic
1079137967 11:17787036-17787058 CAGAATGAGTCTGTGAGGGCTGG - Intergenic
1079410485 11:20182853-20182875 CAGACAGAAGAGGAGAAGGCTGG - Intergenic
1079475205 11:20822763-20822785 CAGGATGGGGAGGTAAAGGTTGG + Intronic
1079505055 11:21143955-21143977 CAGTAACAGGAGGTGAAGGAAGG + Intronic
1079968118 11:27003707-27003729 CAGGAAGAGGAGGTCAAGGCTGG - Intergenic
1080704708 11:34679517-34679539 TAGAATAAGGAGGTGATGCCTGG + Intergenic
1080786883 11:35483527-35483549 GAGAAGGAGGAGGAGAAGACAGG - Intronic
1080857501 11:36124936-36124958 GGAAATGAGGAGGTCAAGGCAGG - Intronic
1081057075 11:38423118-38423140 CAGAAAGAAGAGCTGAACGCAGG - Intergenic
1081568745 11:44276527-44276549 AAGAAAGAAGAGGTGGAGGCTGG + Intronic
1082193759 11:49277384-49277406 CAAAATTTGGAGGTGAAAGCAGG + Intergenic
1082802122 11:57422752-57422774 CTGAATGTGGAGGTGGTGGCTGG - Intronic
1083163308 11:60868713-60868735 CAGAATGAGGATTTGAATCCTGG - Intronic
1083205172 11:61144452-61144474 CAGAAGCAGGAGGAGAACGCAGG + Intronic
1083835823 11:65266608-65266630 CAGAATGAGGAGGGAATGGTAGG + Exonic
1083842419 11:65312149-65312171 CAAGGTGAGGAGGTGAGGGCAGG + Intergenic
1084421196 11:69061529-69061551 CAGAGAGAGGAGGTGGGGGCAGG + Intronic
1085235672 11:75013418-75013440 CAGAAAGAGGGGAGGAAGGCAGG + Intronic
1085639927 11:78187256-78187278 CAGGAAGAGGAGGTGAAGAAAGG - Intronic
1085657853 11:78333038-78333060 CAGAAGGAGGAGGATAATGCTGG + Intronic
1085775997 11:79367072-79367094 AAGAATGAGGATGTGAATCCTGG - Intronic
1086438734 11:86807216-86807238 GAGAAGGAGGAGGGAAAGGCGGG + Intronic
1086470950 11:87109514-87109536 CAGCATGAGGAGATGAAGTGAGG + Intronic
1086672381 11:89563673-89563695 CAAAATTTGGAGGTGAAAGCAGG - Intergenic
1086781319 11:90909949-90909971 CAGAATGTGAAGGGGGAGGCAGG + Intergenic
1087304518 11:96472940-96472962 GACACTGAGGAGGTGAAGCCAGG - Intronic
1088059674 11:105631894-105631916 ATGAATGAGGAGGTCAAGGAGGG + Intronic
1088358303 11:108966079-108966101 CAGAGAGAGGAGGTGAAGAACGG + Intergenic
1088826208 11:113496407-113496429 AAGAGTGAGGAGCAGAAGGCAGG + Intergenic
1088920260 11:114255468-114255490 CAGAGGGAGGAGGGGAGGGCGGG - Intergenic
1089100089 11:115955711-115955733 GAGAAGGAGGAGGGGAAGGGTGG - Intergenic
1089123722 11:116161462-116161484 GAGAGTGAGGAGGCTAAGGCAGG + Intergenic
1089541134 11:119189545-119189567 CAGCCTGAGGTGGTGAAGGCAGG + Exonic
1089571542 11:119414504-119414526 TGGAATGTGGAGGTGATGGCTGG - Intergenic
1090086573 11:123655113-123655135 CTGAGTGATGAGGTGAAGACAGG - Intronic
1090204819 11:124878368-124878390 AAGAAGGAGGAGGTGGGGGCAGG - Exonic
1090407825 11:126487957-126487979 CAGAAGGCGGAGGTGGAGGGAGG + Intronic
1090535272 11:127634304-127634326 CAAAATGAGTGGGTGAAGGAAGG + Intergenic
1090703557 11:129316579-129316601 GAGAGGGAGGAGGTGAAGGGTGG - Intergenic
1090774459 11:129950921-129950943 CAGCATGGGGAAGTGAAGGCCGG - Intronic
1090974978 11:131672760-131672782 CAGAAAGAAGAGGCCAAGGCTGG - Intronic
1091295851 11:134473642-134473664 CAGAAGCAGAAGGTGAGGGCGGG - Intergenic
1091962918 12:4714021-4714043 CAGAACGTGGAGGCGGAGGCGGG - Intronic
1092230343 12:6772608-6772630 CAGCCTGAGGAGGTGGGGGCGGG - Exonic
1092282227 12:7106915-7106937 CAGAATGAGGAGGGGAAATGTGG + Intronic
1092910834 12:13143700-13143722 TAGAATGTGGATGTGATGGCTGG - Intergenic
1093098126 12:14995195-14995217 CAAAGAGAGGAGGTGAAGGTGGG - Intergenic
1093523381 12:20076382-20076404 TAGAAGGAAGAGGTGAAGCCAGG + Intergenic
1094167801 12:27460573-27460595 TAGACTGAGGAGGAGAAGCCGGG + Intergenic
1094628249 12:32146842-32146864 GAGAAGGAGGAGGAGAAGGAAGG - Intronic
1094743145 12:33312645-33312667 CAGAAGGAGGAGTTGAACACAGG - Intergenic
1094763737 12:33566337-33566359 CAGGATGTGGAGGTGAAAGACGG - Intergenic
1095516183 12:43007926-43007948 CAGCATGAAGAGGAAAAGGCAGG + Intergenic
1096072308 12:48782239-48782261 CAGAATGTGGGGCTGGAGGCAGG - Intronic
1096176126 12:49520424-49520446 AAGGATGAGGAGGTCAAGGGTGG - Intronic
1096181887 12:49555749-49555771 GAGGATGAGGAGGTGCAGCCAGG - Exonic
1096377384 12:51124553-51124575 CAGCCTGCGGAGGTGCAGGCAGG + Intronic
1096801635 12:54114299-54114321 CAGGATGGTGAGGAGAAGGCAGG + Intergenic
1099010235 12:77283210-77283232 CAGAAAGAAGAGGTGGAGGTGGG + Intergenic
1099064911 12:77963917-77963939 CAGAAGGAGGAGAAGAAGGAAGG - Intronic
1099436978 12:82657290-82657312 CAGAATAAGGAGGACAGGGCTGG - Intergenic
1100207925 12:92371254-92371276 CTGAGTGAGGTGGGGAAGGCAGG - Intergenic
1100718295 12:97328689-97328711 GAGAATTAGGAGGTGCGGGCAGG + Intergenic
1100906103 12:99301153-99301175 TAGAATGAAAAGGTGAAGGAAGG - Intronic
1101946746 12:109143163-109143185 TAGAATGAGGAGGCTGAGGCTGG + Intronic
1102547644 12:113668123-113668145 CTGGAGGAGGAGGTGAAGGAGGG - Intergenic
1102699395 12:114826003-114826025 CAGAAGGATGAGGTGACAGCTGG - Intergenic
1102909289 12:116700174-116700196 AAGAATGAGTTGGTGAAGGCAGG + Intergenic
1102919775 12:116783198-116783220 CAGAATGAGGATTTGAACTCAGG + Intronic
1102972022 12:117176355-117176377 ATGAATGAGGAAGTGAAGCCAGG + Intronic
1104506751 12:129339324-129339346 AAGAAAGAGGAGGGGAAGGAGGG + Intronic
1104575585 12:129963308-129963330 CAGAAGCAGGAGGGGAAGCCAGG - Intergenic
1104875329 12:132029779-132029801 CAGAATGAGGATCTTGAGGCAGG + Exonic
1104879762 12:132062401-132062423 GAGAATGAGGATCTGAAGGTGGG + Intronic
1104959942 12:132483877-132483899 CAGACTGAGGAGGCAGAGGCGGG - Intergenic
1105778123 13:23681476-23681498 GAGAATGAGGCTGTGAAGCCAGG - Intergenic
1105974155 13:25458634-25458656 CAGAAGGTGGAGTGGAAGGCAGG + Intronic
1106459592 13:29957275-29957297 CAGTATGAAGAGGGGATGGCGGG - Intergenic
1106731426 13:32545093-32545115 GCTACTGAGGAGGTGAAGGCAGG + Intergenic
1107768282 13:43761120-43761142 GAGAATGAGGACAGGAAGGCAGG - Intronic
1108249791 13:48552498-48552520 CAGAATGTGGATGTGATGGCTGG + Intergenic
1108507354 13:51124432-51124454 CATAATGAGGAGGTAAATGTAGG + Intergenic
1109371447 13:61425231-61425253 CAGAATGGGGACTTGAAGCCAGG - Intronic
1110261007 13:73485186-73485208 TGCAATGAAGAGGTGAAGGCAGG - Intergenic
1112072919 13:95874682-95874704 AAGAAGGAGGAGGAGAAGGAAGG - Intronic
1112362375 13:98729792-98729814 CAGGAAGAGGTGGTGAAGCCTGG - Intronic
1112446775 13:99471660-99471682 AAGAAGGAGGAAGTGAAGGAAGG + Intergenic
1113028068 13:105963069-105963091 CAGAATTAGGAGTGGAAGCCAGG + Intergenic
1113312914 13:109149714-109149736 GAAAAAGAGGAGGAGAAGGCAGG - Intronic
1113600191 13:111563187-111563209 CGGAAAGAGGAGGTGAGGGGAGG - Intergenic
1114470772 14:22959610-22959632 GGGAATGAGGGGGTGAAGGATGG + Intronic
1115771294 14:36666084-36666106 AAGAATGAGGAGGTGGAGAACGG + Intronic
1116211091 14:41945709-41945731 CAGAAGGAAGAGGAGAAGGAAGG - Intergenic
1117247148 14:53897442-53897464 CAAAATGAGGAGGAGAAGGGAGG + Intergenic
1118041070 14:61917563-61917585 CAGAGTCAGGAGGTCAAGGAGGG + Intergenic
1118128578 14:62937006-62937028 AAGAAAGAGGAGGAGAAGGAAGG + Intronic
1119420629 14:74505908-74505930 CAGCATAGGGAGGTGCAGGCGGG - Intronic
1119535937 14:75402287-75402309 CAGAACCCGGAGGTGCAGGCTGG + Intergenic
1119583139 14:75805824-75805846 TAGAATGAGGAAGTGAAGAGAGG - Intronic
1119683568 14:76611857-76611879 CAGAATGGAGAGGTGAAGTCAGG + Intergenic
1120015629 14:79470216-79470238 CACAAGGGGGAGATGAAGGCAGG + Intronic
1120398787 14:84002175-84002197 GAGAATGAGGAAGAGAAGACTGG - Intergenic
1121475705 14:94199960-94199982 CAGAATTTGGACGTGAAGGCAGG + Intronic
1121855640 14:97267012-97267034 TAGCATGAGGAGGTGAAGGTTGG + Intergenic
1122960573 14:105092092-105092114 CAGACTGGGGAGGTGAGGGAAGG - Intergenic
1123787638 15:23688747-23688769 GAGAAGGAGGAGGTGGAGGAGGG - Intergenic
1124244740 15:28059184-28059206 AAGACTGAGAAGGTGAAGGCTGG + Intronic
1125486826 15:40116921-40116943 CAGAGAGAGGTGGTGAATGCAGG - Intergenic
1125520734 15:40346582-40346604 CAGTAATAGGAGGTGAACGCTGG + Intergenic
1125929448 15:43589983-43590005 GAGAGTGAGGCGGCGAAGGCGGG - Intronic
1125942615 15:43689815-43689837 GAGAGTGAGGCGGCGAAGGCGGG - Intergenic
1126871823 15:52997258-52997280 AAGAATGAGGAGTTGAGGGAGGG + Intergenic
1126949781 15:53868442-53868464 CTGGATGTGGAGGTGAATGCTGG + Intergenic
1127656395 15:61060330-61060352 CAGAATGAGTAGTGGAAGGAAGG - Intronic
1127982919 15:64047165-64047187 GAGAGTGAGGGGGTGAAGGGAGG + Intronic
1128026825 15:64444911-64444933 CAGAATGTTGAGGTGAAATCTGG + Intronic
1128230429 15:66030981-66031003 CAGAATGGGCAAGTGCAGGCAGG - Intronic
1128510689 15:68312335-68312357 TGGAATGAGAAGGTGATGGCTGG + Intronic
1128609596 15:69063227-69063249 TAAAATGAGGAGGTGGGGGCCGG + Intergenic
1129867738 15:78922211-78922233 CAGAAAGAGGAGCTGAGGCCCGG + Intronic
1129922915 15:79335760-79335782 GAGAATTAGGAGGTGAGGGAAGG + Intronic
1130229362 15:82085030-82085052 AAGAAGGAGGAGGCGAAGGAGGG + Intergenic
1130337127 15:82965987-82966009 GGGGATGAGGAGGTTAAGGCAGG + Intronic
1130894957 15:88162830-88162852 GAGAATGAGGAGGGAAAGGCTGG - Intronic
1131206160 15:90449580-90449602 CAGAAGGAGGAGCTGCAGTCTGG + Exonic
1131821740 15:96280887-96280909 AAGAAGGAGGAGGAGGAGGCAGG + Intergenic
1132314630 15:100880565-100880587 CAGAACGAGGAGGAGTAGGAAGG + Intronic
1132727851 16:1346499-1346521 CAGAACGATGAGGTGAGTGCCGG + Exonic
1132906749 16:2286425-2286447 TAGATTTAGGAGGAGAAGGCAGG + Intronic
1133019467 16:2960827-2960849 CAGAGTGTGGAGGTGAGGCCTGG + Intergenic
1133076500 16:3284454-3284476 CAGATTGAGGATTTGAACGCTGG - Intronic
1133449314 16:5890400-5890422 CAGAACTAAGAAGTGAAGGCTGG + Intergenic
1134171916 16:11976106-11976128 GAGATTGAGGAGGTGGAGGGAGG - Intronic
1134319333 16:13148652-13148674 GAGAATGAGGATGTGAAGAGTGG - Intronic
1134638170 16:15808467-15808489 TAGAGTGGGGAGATGAAGGCTGG - Intronic
1134842746 16:17414751-17414773 CACAGTGAGGAGGTGGTGGCAGG - Intronic
1135179439 16:20260097-20260119 AAGAATGATGAGAAGAAGGCCGG + Intergenic
1135275717 16:21110757-21110779 CAGACTTAGGAGGTTGAGGCAGG + Intronic
1135924046 16:26676637-26676659 CAAAATCAGGATTTGAAGGCAGG + Intergenic
1136242279 16:28951573-28951595 CAGACTGGGGTGGTGAAGGAGGG + Intronic
1136294725 16:29295072-29295094 CATGAGGAGCAGGTGAAGGCGGG + Intergenic
1136403766 16:30031618-30031640 CAGAAGGAAGAGCTGAAGGAGGG + Intronic
1137607511 16:49796449-49796471 CAGAAAGGGAAGGTGAAAGCTGG + Intronic
1139144780 16:64310096-64310118 AAAAGTGAGGAGGGGAAGGCAGG + Intergenic
1139165573 16:64561410-64561432 AAGAAGGAGGAGGAGAAGGAAGG + Intergenic
1139168352 16:64598534-64598556 CAGAGTCAGAACGTGAAGGCAGG - Intergenic
1139247764 16:65463165-65463187 CAGAATTGAGAGGTGAAGGGTGG + Intergenic
1139284262 16:65796900-65796922 CAGGAGGAGGAGGTGAGGGAGGG - Intergenic
1139403467 16:66699825-66699847 TAGAGTTAGGGGGTGAAGGCAGG + Intergenic
1139674650 16:68515005-68515027 CAGAAAGAGAGAGTGAAGGCCGG + Intergenic
1139959329 16:70708765-70708787 CAGTGTGAGGAGGGCAAGGCCGG + Intronic
1140342487 16:74178312-74178334 CAGAATGAGAAGGAGAAAGAAGG + Intergenic
1141007164 16:80363233-80363255 GAGAAGGAGGAGGAGAAGGAGGG + Intergenic
1141359314 16:83380681-83380703 TAGAATATGGAGGTGAAGGCTGG - Intronic
1141779669 16:86151199-86151221 CAGCAGGAGGAGGTGGAGGCTGG - Intergenic
1142106756 16:88308511-88308533 CAGAGTGTGGAGGGGCAGGCTGG - Intergenic
1142296304 16:89224760-89224782 CAGGAAGAGGAGTTGAGGGCAGG + Intronic
1142505095 17:358095-358117 CAGAAGGATGAGGTGGAGGGAGG - Intronic
1142554278 17:762625-762647 CACACTGAGTAGGTGCAGGCAGG - Intronic
1143006618 17:3840023-3840045 CAGAAGCATGAGGTGATGGCAGG + Intronic
1143035221 17:3991298-3991320 GAGAAAGAGGAGGAGGAGGCCGG - Intergenic
1143152178 17:4814555-4814577 CAGCATTAGGAGGAGAAGGGGGG + Intronic
1143223631 17:5282286-5282308 CAGGATGAGGAGGCGGAGGTCGG + Exonic
1143595043 17:7909111-7909133 CAGAGTTGGGAGGTGAAGGTAGG - Intronic
1143951391 17:10635478-10635500 CAGTATGAGGAGGAGCAGGAAGG - Exonic
1144825206 17:18101896-18101918 GAGATTGAGAAGGTGGAGGCCGG - Intronic
1146675846 17:34773360-34773382 CAGGATGAGGAGCTGAGGGTGGG + Intergenic
1147370475 17:39989216-39989238 GAGCAGGAGGAGGTGAAGTCTGG - Intronic
1147588974 17:41669079-41669101 CAAAATAGGGAGGTCAAGGCTGG + Intergenic
1147881431 17:43656624-43656646 CAGAGTGAGGACGTGAGAGCAGG + Intronic
1148025606 17:44585542-44585564 CAGAAAGAGGAGGTGGCAGCAGG - Intergenic
1148459621 17:47831653-47831675 CCGAGTGGGGAGGTAAAGGCGGG - Exonic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148775546 17:50093480-50093502 AAGAATGGGCAGGTGAAGGTGGG + Intergenic
1148846857 17:50534524-50534546 CGGGTTGGGGAGGTGAAGGCAGG + Intronic
1149200338 17:54178303-54178325 CAGAATATGGATGTGAAGACTGG - Intergenic
1151552946 17:74832355-74832377 CACCATGAGGATATGAAGGCGGG - Intronic
1151894234 17:76969372-76969394 CCGACTTAGGAGGAGAAGGCAGG - Intergenic
1152106215 17:78330680-78330702 CAGCATGAAGTGGTGAAGTCGGG + Intergenic
1152119975 17:78412624-78412646 CAGAATCTGGTGGGGAAGGCTGG - Intronic
1152621744 17:81368372-81368394 CAGAACGAGGTGGTGCAGGAAGG + Intergenic
1152861917 17:82701332-82701354 CAGAAGGTGGAGGTGAGGCCGGG + Intergenic
1153017587 18:597378-597400 CAGGAGGAGGAGGTAGAGGCGGG + Intronic
1153210538 18:2758704-2758726 CAGAATGAGATAGTGAAGGATGG - Intronic
1153583767 18:6600820-6600842 CAGAATTCAGAGGTGAAGTCTGG + Intergenic
1153632638 18:7086682-7086704 AAGAATGAGTAAGTGAAGGAAGG + Intronic
1153710375 18:7793234-7793256 CGTAGTGAGGAGGTGAAGTCAGG - Intronic
1153723018 18:7926594-7926616 CAGAATGTGGAAGTTAATGCTGG + Exonic
1153928908 18:9860886-9860908 CAGTGTTAGGATGTGAAGGCTGG + Exonic
1154041992 18:10865156-10865178 CAGGGTGAGGACATGAAGGCAGG + Intronic
1155197222 18:23486443-23486465 CAAAATCAGGAGGAGAAGGCTGG + Intronic
1155348809 18:24885803-24885825 TAGAGTGATGAGATGAAGGCAGG + Intergenic
1155444075 18:25892464-25892486 GGGAAAGAGGAGGTGAAGCCTGG + Intergenic
1155668077 18:28335732-28335754 GAGAATGAGGTGGAGAAGGGTGG - Intergenic
1155940792 18:31800183-31800205 CAGACTGGGGAAGAGAAGGCAGG - Intergenic
1156016624 18:32553837-32553859 CAGGATTAGGAGGTCAAGGAGGG - Intergenic
1157283399 18:46360708-46360730 AGGAAGGAGGTGGTGAAGGCAGG - Intronic
1157306881 18:46524140-46524162 CATGATGTGGTGGTGAAGGCAGG - Intronic
1157439181 18:47697061-47697083 CAGAATGCAGAGGAGAGGGCAGG - Intergenic
1158209537 18:55031879-55031901 CAGAAGGAGGAGGAGAAGGAAGG - Intergenic
1158525529 18:58209414-58209436 GAGAAGGAGGAGGTAAAGGAGGG - Intronic
1158571990 18:58604019-58604041 CAGCATGAGGAGGAGAATGCAGG + Intronic
1158887080 18:61838757-61838779 CTGAACGTGGAGGTGAAAGCTGG - Intronic
1159015565 18:63099417-63099439 GAAAAAGAGGAGGTGAAGGAGGG + Intergenic
1159018936 18:63127337-63127359 CAGAAGGACATGGTGAAGGCTGG - Exonic
1159559072 18:69975098-69975120 CAGGATGGGGAAGAGAAGGCAGG + Intergenic
1159754326 18:72345186-72345208 CAGAATGAGGAAGGAAAGGGAGG + Intergenic
1159807541 18:72974343-72974365 CAGAATGAGCAGGGGAAAGCCGG - Intergenic
1159903432 18:74069040-74069062 GAGCAGGAGGACGTGAAGGCAGG - Intergenic
1160022220 18:75189834-75189856 CACCATGAGGGGCTGAAGGCAGG + Intergenic
1160418568 18:78728552-78728574 CAGGAAGAGGAGGTGTAGGGTGG - Intergenic
1160699542 19:499137-499159 CAGAATGAGGAGGGGGAGAAAGG - Intronic
1160859837 19:1233123-1233145 CAGGATGAGGTGGTAAAGGAGGG - Intronic
1161300023 19:3538025-3538047 CAGAGTGAGGAGAGGAGGGCAGG + Intronic
1161332889 19:3696724-3696746 CAGAGTGCGGAGGGGAGGGCAGG + Intronic
1161345453 19:3766885-3766907 GAGAGGGAGGAGGTGAGGGCAGG + Intronic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161393794 19:4034310-4034332 CGGACTGTGCAGGTGAAGGCAGG + Intronic
1161416792 19:4151752-4151774 CAGAGTGAGGAGAGGAAGACAGG - Intergenic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161719750 19:5896227-5896249 CAGAGTGAGGAGGGGAGGGTGGG + Intronic
1161740488 19:6018264-6018286 CATAAAAAGGAGATGAAGGCCGG - Intronic
1161756428 19:6137456-6137478 CAGAGTGAGGAGGGGGAGGGAGG + Intronic
1162012820 19:7828652-7828674 CAGAATGGGGAAGGGAAGGCTGG - Intergenic
1162429924 19:10622241-10622263 GAGAGGGAGGAGGTGAGGGCAGG + Intronic
1162462846 19:10823650-10823672 CAGCATGACCAGGTGAAGCCTGG + Intronic
1163197694 19:15735216-15735238 CAGAAGGAGAAGGAGAAGGAGGG - Intergenic
1163447163 19:17353478-17353500 CGGGAGGAGGAGGTGAGGGCAGG - Intronic
1163460784 19:17436272-17436294 CAGAATGAGGAGGTGAAGGCTGG + Exonic
1163712023 19:18852637-18852659 CAGAAAGAGGAGGGGAGGGAGGG - Intronic
1163712031 19:18852661-18852683 CAGAAAGAGGAGGGGAGGGAGGG - Intronic
1164156958 19:22602875-22602897 GACAAGGAGGAGATGAAGGCAGG + Intergenic
1164157739 19:22606727-22606749 TACAATGAGGTGGTGAAGACAGG + Intergenic
1164521282 19:28982147-28982169 GGGAAGGAGGAGGTGAAGGAAGG + Intergenic
1165119597 19:33550672-33550694 CAAAAAGAGGAGGTGCAGGCTGG + Intergenic
1165614004 19:37182729-37182751 CAGTATGGGGAGGTGAAGATGGG - Exonic
1166654230 19:44598573-44598595 CAGAATGTGGATATGATGGCTGG - Intergenic
1166712066 19:44944134-44944156 CAAAATCAGGTGGTGAAGGGAGG + Intronic
1167806214 19:51787698-51787720 CAGAATGAAGACGAGAAGGATGG + Intronic
1168097120 19:54122228-54122250 GGGAATGCGGAGGTGATGGCTGG - Intronic
1168115540 19:54219926-54219948 CAGGACAGGGAGGTGAAGGCTGG + Intronic
1168121341 19:54254075-54254097 CAGGACGGGGAGGTGAGGGCTGG + Intronic
1168124853 19:54277607-54277629 CAGGACGGGGAGGTGAGGGCTGG + Intronic
1168132883 19:54332234-54332256 CAGGATGGGGAGGTGAGGGCTGG + Intergenic
1168177133 19:54633942-54633964 CAGGACGGGGAGGTGAGGGCTGG - Intronic
1168431306 19:56283166-56283188 CAGAAAGAGGTGGTAAAGTCTGG - Intronic
925114358 2:1365954-1365976 CAGAATGAGGGGGTGGAGAATGG - Intronic
925401571 2:3576796-3576818 CAGCACGGGGAGGTGGAGGCGGG + Intronic
926109299 2:10171896-10171918 CAGGATGAAGAGGAGAAGACAGG + Intronic
926111277 2:10185756-10185778 CAGAGAGGGGAGGTGAAGGGTGG - Intronic
926439755 2:12875459-12875481 GAGAATGAGGAGGTGGAGGCTGG + Intergenic
926671901 2:15584500-15584522 TGGAATGAGGATGTGATGGCTGG - Intergenic
927284728 2:21345015-21345037 GGGAATGAGGGGGTGAAGGGGGG - Intergenic
927791561 2:26014076-26014098 TAAAATGAGGAGGTGAGGCCGGG + Intergenic
928083103 2:28327237-28327259 GAGAAGGAGGAGGAGAAGGGAGG - Intronic
928673952 2:33632053-33632075 GAGAAGGAGAAGGTGAAGGAGGG - Intergenic
928775655 2:34759925-34759947 CAGAATGAAGAGTAGAAGCCAGG - Intergenic
928867854 2:35939193-35939215 CAGAATTAGGATTTGAAGCCAGG + Intergenic
928992806 2:37253009-37253031 CATAATGAGTAGGTACAGGCGGG - Exonic
929379969 2:41337937-41337959 CAGAATAAGGAAGGGAAGGAAGG + Intergenic
929787407 2:45002443-45002465 CAGGGTGAGGGGGTGAAGGGTGG + Intergenic
930714084 2:54576348-54576370 CAGAAAGAAGAGCTGAAGGCCGG - Intronic
931084479 2:58814240-58814262 GAGGATGAGGAGGTTGAGGCAGG - Intergenic
931238627 2:60433073-60433095 CTGAATTCGGAGGGGAAGGCAGG + Intergenic
931490946 2:62746348-62746370 CTGAGTGAGGAGTTTAAGGCTGG + Intronic
933412006 2:81938245-81938267 CACAATGAGTTTGTGAAGGCTGG - Intergenic
933703911 2:85275670-85275692 CAGAATTGGGAGGTGAAGGCGGG + Intronic
933721082 2:85398206-85398228 CAGCCTGAGGAGGGGGAGGCTGG + Intronic
934652317 2:96099737-96099759 GAGAAGGAGGAGGTGGAGGAAGG + Intergenic
936109066 2:109650351-109650373 CAAAAAGTGGAGGTGAAGCCAGG + Intergenic
936380172 2:111978048-111978070 CAGAAGGCGAAGGTGAAGGTGGG - Intronic
936485216 2:112919481-112919503 CAGAGTGAGGGGGTGGAGACAGG + Intergenic
936537061 2:113320703-113320725 CGGAAGGAGGAAGTGAAGGGAGG - Intergenic
937204196 2:120225204-120225226 CTGAATGAGGAGCTCAAGGTGGG - Intergenic
937239183 2:120449383-120449405 CAGTGGGAGGAAGTGAAGGCAGG + Intergenic
937276457 2:120687400-120687422 TAGAATGTGGATGTGATGGCTGG - Intergenic
937327138 2:120996792-120996814 GAGAAGGAGGAGGGGAAGGAGGG - Intergenic
937463603 2:122110399-122110421 GAGGAGGAGGATGTGAAGGCAGG + Intergenic
937785173 2:125887460-125887482 CAGATTGGGGAAGAGAAGGCAGG + Intergenic
938188476 2:129254247-129254269 CATAATGAGGGGCTGAAGGAAGG - Intergenic
938417485 2:131115993-131116015 CAGAATGAGGAGAGGTAGACAGG + Intronic
938600184 2:132829720-132829742 CTGAATCAGGAGGTGTAGGGTGG + Intronic
938673890 2:133611271-133611293 CAGATGGAGGAGGTGGTGGCGGG - Intergenic
939683311 2:145166498-145166520 TAGAAAGAGGAGGTGGAGGGGGG - Intergenic
940433735 2:153625810-153625832 CAGAATGAGGAGATGTTGGAGGG + Intergenic
941293057 2:163700041-163700063 AAGAAGGAGGAGGAGAAGGAAGG + Intronic
941352430 2:164453284-164453306 GAAGATGAGGAGGGGAAGGCAGG - Intergenic
942202295 2:173583396-173583418 CCTAATGAGCAGGTGAATGCTGG + Intergenic
942342097 2:174959484-174959506 CAGAATTAGTTGCTGAAGGCAGG + Intronic
942447452 2:176087598-176087620 CAGAATGTGAAGGCCAAGGCTGG + Intergenic
942626182 2:177903083-177903105 TAAAATGAGGACGTGGAGGCAGG - Intronic
943247488 2:185473865-185473887 CAGACTGTGGAAGTGAAGCCTGG + Intergenic
944581208 2:201134194-201134216 CAGCTACAGGAGGTGAAGGCAGG + Intronic
944861561 2:203819979-203820001 CACAATGGGGTGGAGAAGGCGGG + Intergenic
945367811 2:208977911-208977933 CAGAAAGGGGAGGGGAAGGGAGG - Intergenic
945506732 2:210651015-210651037 CTGAAGGAGAAGGTAAAGGCTGG - Intronic
947394326 2:229672385-229672407 GAGAGAGAGGAGGTGAAGGAGGG + Intronic
947458847 2:230284371-230284393 CAGAATGAGAATGAGAAGGCAGG + Exonic
947942735 2:234072695-234072717 CAGAATGAGGCTGGTAAGGCCGG + Intronic
948917137 2:241040051-241040073 TAGAGTGAGGAGGTGTAGACAGG - Intronic
1168878920 20:1189908-1189930 AAGAAGGAGGAGGAGAAGGAGGG - Intergenic
1169211677 20:3769165-3769187 CAGAAAGAGGCGGAGGAGGCAGG - Intergenic
1169215124 20:3789100-3789122 CAGAAAGAGGTGGGGAAGCCCGG - Intronic
1170306335 20:14942330-14942352 AAGAAGGAGGAGGAGAAGGAGGG - Intronic
1170764354 20:19277161-19277183 CAGAATGAGGATTTGAACCCAGG - Intronic
1170885781 20:20338758-20338780 CTGAGTGGGGATGTGAAGGCCGG - Intronic
1170923602 20:20702359-20702381 GAGAAGGAGCTGGTGAAGGCAGG + Intronic
1170991548 20:21305994-21306016 AAGAATAAGGAGGCCAAGGCAGG - Intronic
1171255943 20:23689109-23689131 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171272356 20:23826800-23826822 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171795065 20:29560167-29560189 CAGGATGGCGAGGAGAAGGCAGG - Intergenic
1171853388 20:30324098-30324120 CAGGATGGTGAGGAGAAGGCAGG + Intergenic
1174657234 20:52181751-52181773 CAGATTCAGGAGGTGGAGCCCGG + Intronic
1174663026 20:52231580-52231602 GAGAAGGAGGAGGAGAAGGGAGG - Intergenic
1174775653 20:53340902-53340924 CAGATTGAGGAGTTGATGTCTGG - Intronic
1174819936 20:53717847-53717869 AAGAGTGAGGAGGTGCTGGCAGG - Intergenic
1175298836 20:57928587-57928609 GAGAAGGAGGAGGAGAAGGGTGG - Intergenic
1175660092 20:60804851-60804873 CAGAAAGAAGAGGTGCAGCCTGG - Intergenic
1176986676 21:15445415-15445437 GACAATGAGCAGGTGCAGGCAGG - Intergenic
1177061416 21:16378854-16378876 AGCAATGAGGAGTTGAAGGCTGG - Intergenic
1177830824 21:26137044-26137066 CAGGAGGCGGAGGTGGAGGCGGG - Intronic
1177891242 21:26806560-26806582 TAGAATGAGAATGTGATGGCTGG - Intergenic
1178190644 21:30276065-30276087 CATAATGAGTAGTTGAAGACAGG + Intergenic
1178376393 21:32071021-32071043 CAGAGGCAGGAGGTGAGGGCAGG - Intergenic
1178426046 21:32479122-32479144 CAGAAACAGAAGGTGCAGGCTGG + Intronic
1179302552 21:40125286-40125308 CAGGTTGAAGAGGTGAGGGCGGG + Intronic
1179303827 21:40136813-40136835 CAGAATGAGGAAGAGGAGCCTGG + Intronic
1179423369 21:41253606-41253628 AAGAAGCAGGAGGAGAAGGCAGG + Intronic
1181112098 22:20608225-20608247 CAGAATGAGGAGCAGATGGAAGG - Intergenic
1181686735 22:24534351-24534373 CTGAATGAAGAGGTGTAGGAAGG - Intergenic
1182500579 22:30743824-30743846 CAGGGTGCGGAGGTGAGGGCGGG + Intronic
1182581650 22:31316728-31316750 AAGAATGAGAAGATGATGGCTGG + Intergenic
1182843246 22:33409288-33409310 CGGAAGGAGGAGGAGGAGGCTGG + Intronic
1182866220 22:33606781-33606803 CTGAATGTGGAGGTGCAGGGTGG - Intronic
1183072691 22:35407371-35407393 CAGACTGAGGGGGTGGAGGGTGG - Intronic
1183414334 22:37673846-37673868 CAGAATGAGAAGGCCAGGGCTGG - Intergenic
1183430778 22:37764378-37764400 CAAAATGAGGTGGTGAAAGTTGG - Intronic
1183543520 22:38443470-38443492 CAGACTGAGATGGGGAAGGCAGG - Intronic
1183775000 22:39958205-39958227 GAGACTGAGGAGGAGAAGCCAGG - Intronic
1184793681 22:46718392-46718414 CAAACAGAGGAGGGGAAGGCGGG + Intronic
1184893683 22:47394611-47394633 CAGACAGAGGAGGAGAAGACAGG + Intergenic
1184980975 22:48096093-48096115 CGGGATGGGGAGGTGCAGGCGGG + Intergenic
1184981029 22:48096245-48096267 CAGGGTGGGGAGGTGCAGGCGGG + Intergenic
1185230068 22:49674922-49674944 CAGAAAGAGGAGAGGAAGCCAGG + Intergenic
1185261349 22:49865956-49865978 CAGCATCGGGAGGTGGAGGCGGG - Intronic
949571041 3:5293568-5293590 TAGATTGAGGAGGTGAAGGCAGG + Intergenic
949861139 3:8505808-8505830 CAGGAAGTGGAGGTGAAAGCAGG - Intronic
950044525 3:9941072-9941094 CAGCATGAGGATGGGCAGGCAGG - Intronic
950114884 3:10444362-10444384 CAGCAGGAGGATGTGGAGGCAGG - Intronic
950214532 3:11149990-11150012 AGGAATGGGGAGGTGAATGCTGG - Intronic
950484620 3:13265691-13265713 TGGAATGAGGATGTGATGGCTGG - Intergenic
950672727 3:14536888-14536910 GAGCATCAGGAGGTGAAGTCAGG - Intronic
950723778 3:14902655-14902677 CAAAATGAGGAGGGGCAGGGAGG - Intronic
951817272 3:26768209-26768231 CAGAGTGAGGAGATGTTGGCTGG + Intergenic
952788171 3:37176316-37176338 CCGACTGAGGAGGCGAAGGATGG + Intronic
952991269 3:38832998-38833020 CAGAAGCAGGAGCTGCAGGCAGG + Intergenic
953253276 3:41265416-41265438 CAGAAGTATGAGGTGAAGTCTGG - Intronic
953329601 3:42041904-42041926 CAGACTCAGGAGGCTAAGGCAGG - Intronic
953419271 3:42742031-42742053 CAGCATGAAGAGGTGCAGGCAGG - Intronic
954434098 3:50486866-50486888 CAGAGTGAGGTGGTCAGGGCAGG - Intronic
954440297 3:50518100-50518122 CAGAATGAGGAGGTGGGGTGTGG + Intergenic
954751549 3:52817019-52817041 CAGTATGAGAGGGAGAAGGCTGG - Exonic
954925569 3:54231298-54231320 CAGAGTGAGGACCAGAAGGCAGG - Intronic
954933269 3:54302852-54302874 CAGAAAGAGGAGATGAGAGCAGG - Intronic
954999258 3:54911705-54911727 TAAAATGAAGAGGTGAAGGTTGG - Intronic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955216963 3:56992089-56992111 CAGGATGAGGATGAGAAAGCTGG - Intronic
955216970 3:56992167-56992189 CAGGATGAGGATGAGAAAGCTGG - Intronic
955244147 3:57208095-57208117 CAGAAGGTGGGGGTGATGGCAGG + Intronic
955994579 3:64666898-64666920 GAAATTTAGGAGGTGAAGGCAGG + Intronic
956168137 3:66411926-66411948 GAGAATGAGGGGGTGGTGGCGGG + Intronic
956249355 3:67219530-67219552 CTGAAAGAGGAGGTGAACACAGG - Intergenic
956675219 3:71725863-71725885 CAGAAGGATGGAGTGAAGGCTGG + Intronic
957210097 3:77248198-77248220 CAGAAAGGGGAGGTGAAGAGGGG - Intronic
957264170 3:77939911-77939933 CAGAATGATGAGTTGGAGGAAGG + Intergenic
959110384 3:102115842-102115864 CTGAATGAGTAGGTCAAGGCAGG - Intronic
959614490 3:108331843-108331865 TAGAATGGGGAGGGGGAGGCAGG - Intronic
960795613 3:121483872-121483894 CAAAATGAGGAGTTAAAGACAGG + Intronic
960900464 3:122549478-122549500 CTGATTGAGGAGGAGAAGACAGG + Intronic
961348706 3:126284363-126284385 CAGAATGTGGAGGTGGAAGATGG - Intergenic
961491933 3:127262436-127262458 CAGACTGAGGAGGGGAGAGCAGG - Intergenic
961542053 3:127606743-127606765 CAGAACCAGGAGGTGAAACCAGG + Exonic
961860305 3:129911939-129911961 CATAATTAGGATGGGAAGGCAGG - Intergenic
962403871 3:135083651-135083673 CAGGCTGAGGAGGTGCAGGTAGG + Intronic
962922421 3:139963088-139963110 GAGAATGAGGAGGAGGAGGGGGG + Intronic
963474553 3:145788730-145788752 CAGGGTGAGGTGGTGATGGCAGG + Intergenic
963736557 3:149023734-149023756 CAGAATAGGGAGGCCAAGGCAGG + Intronic
964529276 3:157649577-157649599 CAGAATGTGGATGTGAATCCTGG + Intronic
964658414 3:159093578-159093600 CATGATGAGGAGGTAGAGGCTGG + Intronic
965396088 3:168161712-168161734 CAGAAAGAGGTGGTGCAGGGAGG + Intergenic
965591588 3:170365212-170365234 CAGAATCAGGAGTTGAATACAGG + Intronic
965612643 3:170561073-170561095 CAGAAGGAAGAAGTGGAGGCAGG - Intronic
965616554 3:170599414-170599436 CAGAAAAAGAAGTTGAAGGCAGG - Intronic
966416453 3:179694474-179694496 CAGAATCAGGATGTGATGGTTGG - Intronic
966621397 3:181968140-181968162 CAGAGTGAGAAAGTGGAGGCCGG + Intergenic
966883961 3:184364521-184364543 CAAAATAAAGAGGTGTAGGCCGG - Intronic
967268183 3:187710180-187710202 GAGAATCAGGAGTTGAGGGCAGG - Intronic
968914237 4:3490214-3490236 ATGAATGAGGGGGTGAAGACAGG - Intronic
969213847 4:5708170-5708192 AAGAATGAGGAAGGGAGGGCAGG - Intronic
969838267 4:9861008-9861030 CAAAATGAGGAGGAGAATGATGG - Intronic
969907947 4:10414907-10414929 CAGAATGAGGATTTGAACTCAGG - Intergenic
970203980 4:13637733-13637755 AAGGATGAAGAGGTGAAGCCTGG + Intergenic
971319512 4:25594098-25594120 CAGAAAGACAAGTTGAAGGCTGG + Intergenic
971478961 4:27097601-27097623 CATCATGTGAAGGTGAAGGCAGG + Intergenic
972281492 4:37606117-37606139 GAGAAGGAGGAGGAGAAGGAAGG + Intronic
972583126 4:40412722-40412744 CAGAATGATGTGTTGAAGGCAGG - Intergenic
972874456 4:43341276-43341298 CTGAATAAGGAAGTGAAGTCTGG - Intergenic
973255813 4:48112107-48112129 CAGCATCAGGATGTGAAGCCAGG + Intronic
973393300 4:49573877-49573899 TAGGATGAGGAGGAGTAGGCTGG + Intergenic
974532950 4:63134757-63134779 CAGAATTAGGTGGTGATGGTGGG + Intergenic
975648591 4:76569459-76569481 CAGAATGAGGAAGAGAAGTCAGG + Intronic
975767825 4:77687602-77687624 AAGAATGAGGAGAGGAAGGAAGG + Intergenic
976132830 4:81903382-81903404 GAGAGTGAGGAGGAGAGGGCTGG - Intronic
976566308 4:86554060-86554082 CAGAAAGGGGAGGAGAAGGCAGG + Intronic
978165406 4:105601354-105601376 TAGATTGAGGTGGTGAAGGAAGG - Intronic
979108947 4:116725450-116725472 GAGGTTGAGGAGGTGAAGGGAGG + Intergenic
980840594 4:138256154-138256176 CAGAATGGGGAAGTGCATGCTGG - Intergenic
982728977 4:158935248-158935270 AAGAGTGTGGAGGTGGAGGCAGG - Intronic
983021663 4:162684416-162684438 CTGAAAGAGGAGGGGAAGGAAGG + Intergenic
983275006 4:165606140-165606162 CAGAAAGAGGAGGTGGAAGGAGG - Intergenic
983796746 4:171873855-171873877 CTGAATGTGGAGTTGAAGGAGGG + Intronic
984396626 4:179210193-179210215 TAGAATGAGAAGGCCAAGGCAGG + Intergenic
985947765 5:3200257-3200279 CAGCATCTGGAGGTGCAGGCTGG - Intergenic
986415330 5:7522446-7522468 CAGAAACAGGAAGTGAAGGCTGG - Intronic
986485592 5:8232978-8233000 CAGAAGGAAGAGGAGAGGGCAGG + Intergenic
986634675 5:9809641-9809663 CAGAATGAACAGATGAAGACAGG + Intergenic
986667255 5:10114458-10114480 CAGAAGGAGGGAGTGCAGGCCGG - Intergenic
986833336 5:11606644-11606666 CTGAATGAAGAGGTGAGGGCTGG + Intronic
987504414 5:18750104-18750126 CAGGATGGGGAAGAGAAGGCAGG - Intergenic
987578313 5:19758043-19758065 CAGACTGGGGAAGAGAAGGCAGG + Intronic
987627737 5:20424454-20424476 CAAAATGAGGAAGTGAGGCCTGG + Intronic
987885476 5:23806768-23806790 CAGGATGAGGGAGAGAAGGCAGG - Intergenic
988228796 5:28448392-28448414 CAGGCTGAGGAAGAGAAGGCAGG - Intergenic
989627785 5:43448224-43448246 CAAAATGTGGAGGAGAAGGCAGG - Intronic
990362473 5:55034716-55034738 AAGAAAGAGAAGATGAAGGCCGG + Intergenic
992426402 5:76662331-76662353 CAGAGAGAGTTGGTGAAGGCAGG - Intronic
992737855 5:79741889-79741911 CAGTATGAGAAGGAGAAGGTGGG + Intronic
994412198 5:99420624-99420646 CAGAGCTAGGAGGTGAAGGAGGG + Intergenic
994481622 5:100344629-100344651 CAGAGCTAGGAGGTGAAGGAGGG - Intergenic
995256175 5:110049356-110049378 CAAAATGAGGAGCTGAAGTAGGG - Intergenic
996231699 5:121071409-121071431 CTGAGGCAGGAGGTGAAGGCAGG + Intergenic
996392173 5:122973517-122973539 CAGGCTGGGGAGGAGAAGGCTGG + Intronic
997221093 5:132165084-132165106 CAGAATAAGTAGGTGGTGGCGGG - Intergenic
997253420 5:132409171-132409193 GAGCATCAGGAGGTCAAGGCCGG - Intergenic
997348529 5:133211733-133211755 CAGAATGAAGAGGAGAAGCCAGG - Intronic
997455935 5:134017499-134017521 TAGAGTGAGGACGTGAGGGCAGG + Intergenic
997528398 5:134567834-134567856 CAGAAGGAAGAGGTGGAGGTGGG + Intronic
997530122 5:134576848-134576870 AAGAAAGAGAAAGTGAAGGCGGG + Intronic
997621039 5:135295559-135295581 CAGAATGAGGACATGCATGCAGG - Intronic
997743623 5:136279415-136279437 CTGAGTGCGGGGGTGAAGGCAGG + Intronic
998148484 5:139744062-139744084 CAGAGCCAGGAGGAGAAGGCAGG - Intergenic
998200149 5:140113016-140113038 CAGAAGGAGGAGGGGGAGGCGGG + Intronic
998852430 5:146364002-146364024 CAGAAGAAGGAGATGAAGGGTGG + Intergenic
999473254 5:151874925-151874947 GAGCATGAGGAGGGGAAGGAAGG + Intronic
999539035 5:152551463-152551485 CAGAATGTGGGGCTGAAGGCAGG + Intergenic
1000199917 5:158997994-158998016 CAGAATGAGGAGGAGGTAGCAGG - Intronic
1000282869 5:159797316-159797338 CAGAATAAGGAGGAGAATCCTGG + Intergenic
1000401756 5:160836094-160836116 AAGAATGAGGAGGGGAGGGAGGG + Intronic
1000863865 5:166488964-166488986 CAGGATGAGGAGGTAAAGAAGGG - Intergenic
1001520046 5:172385050-172385072 CAGAAACAGGAGGTGAGGGAGGG - Intronic
1002269718 5:178062602-178062624 AAAAATTAGGAGGTCAAGGCAGG + Intergenic
1003113878 6:3270503-3270525 CAGCCTGAGGAGGAGGAGGCCGG - Exonic
1003197310 6:3926248-3926270 CAGCAGGAGGAGGAGAAAGCAGG + Intergenic
1003318508 6:5032901-5032923 CAGCAGGAGGAGGAGAAAGCAGG - Intergenic
1003457076 6:6293024-6293046 CAGAAAGATGAGGAGAAGGATGG - Intronic
1003817616 6:9859900-9859922 AAGAAGGAGGAGGAGAAGGACGG + Intronic
1004637822 6:17485869-17485891 GAGGATGAGGAGGGGAAGGATGG + Intronic
1005135640 6:22567599-22567621 AAGTATGAGGGTGTGAAGGCAGG - Intergenic
1005654429 6:27919534-27919556 CAGTATCAGGAGGAGAAGGAGGG + Intergenic
1006081918 6:31572786-31572808 CAGAAGGAGGAGGTGTAGGGTGG - Exonic
1006339452 6:33438674-33438696 CAGAATCAGGTGTTGGAGGCTGG - Intronic
1006376931 6:33676888-33676910 AAGGGTGAGGAGGTGGAGGCAGG + Exonic
1006582295 6:35083982-35084004 CAAAATGAGAAGATGAAGGGGGG + Intronic
1007024121 6:38552389-38552411 CAGAAAGAGGAAGTAATGGCAGG + Intronic
1007381262 6:41491705-41491727 CAGGGAGAGGAGGTGAAGACAGG + Intergenic
1007510366 6:42370100-42370122 CAGAATTAGGGGGTAAAGGATGG + Intronic
1007969200 6:46033607-46033629 CAGAATGAGGAAGGGCTGGCAGG - Intronic
1008070118 6:47091080-47091102 GGGAATGGTGAGGTGAAGGCCGG - Intergenic
1011723414 6:90183152-90183174 CACACTGAGGAGGTAAAGGTTGG - Intronic
1011837354 6:91450007-91450029 GAGAATAAGGAGTTGAAGACAGG - Intergenic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1014089852 6:117391431-117391453 CAGAGTGAGGAGGAGAAGCTGGG + Intronic
1015754955 6:136597596-136597618 CAGAATCTGGAGGTGCAAGCTGG - Intronic
1016673984 6:146741690-146741712 CAAAATGAGGTGGTGATGGTTGG - Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017521955 6:155210301-155210323 AAGAAAGAGGAGGGGAAGGAAGG - Intronic
1017718849 6:157231008-157231030 CAGAGTGAAGATGTGAAGCCAGG - Intergenic
1018429746 6:163713528-163713550 GAGAATGAGGAGGAGAGGGTTGG - Intergenic
1019032869 6:169027739-169027761 CAGAAGGAGGAAGAGAAGGCGGG + Intergenic
1019046391 6:169151467-169151489 ACAGATGAGGAGGTGAAGGCTGG - Intergenic
1019137342 6:169918545-169918567 CAAAGTGAGGAGGTCAGGGCTGG + Intergenic
1019453508 7:1112385-1112407 CAGAGTGAGCAGGTGGAGGCCGG - Intronic
1019570885 7:1711502-1711524 CAGAAAGAGGAGGAGACAGCCGG + Intronic
1021446293 7:20737044-20737066 CAGCTTCAGGAGGTGGAGGCAGG + Intronic
1021465921 7:20943572-20943594 TAGAAAGAGAAGTTGAAGGCCGG + Intergenic
1021934928 7:25620895-25620917 CAGAATAAGGTGGTGGTGGCTGG - Intergenic
1022044312 7:26611078-26611100 CACAATGAGGAGGAGAAGAGGGG - Intergenic
1022350104 7:29560323-29560345 CAGCATGAGGATGTGACGTCTGG - Intergenic
1022467257 7:30660387-30660409 GAGCATGAGGAAGGGAAGGCCGG + Intronic
1023332972 7:39138894-39138916 AAGCAAGAGGAGGTGAAGGAGGG - Intronic
1024884310 7:54124378-54124400 CAGACTGAGGGAGAGAAGGCAGG + Intergenic
1025246183 7:57319342-57319364 CAGGATGAGGAGGGGATGCCGGG + Intergenic
1026228413 7:68462802-68462824 AAGGAAGAGGAGGTGAAGGAAGG - Intergenic
1026773672 7:73217860-73217882 CAGAAGGAGCAGGTGCCGGCGGG + Intergenic
1027014531 7:74771254-74771276 CAGAAGGAGCAGGTGCCGGCGGG + Intergenic
1027073502 7:75174703-75174725 CAGAAGGAGCAGGTGCCGGCGGG - Intergenic
1027111444 7:75442872-75442894 CAGAAACAGGCGTTGAAGGCAGG - Intronic
1027150451 7:75729967-75729989 CAGAATGCGGCTGTGAGGGCAGG + Intronic
1027283673 7:76627405-76627427 CAGAAACAGGCGTTGAAGGCAGG - Intergenic
1028340566 7:89714845-89714867 CTGAAGGAGGAGGTGAAGAATGG + Intergenic
1029107002 7:98185856-98185878 CAGAAAGCGGAGGTCAAGGCTGG - Intronic
1029698082 7:102227717-102227739 CAGGAGGAGCAGGTGAAGGGCGG + Intronic
1030639402 7:111987282-111987304 CAGAATGAAAAGGGGAAGGAAGG - Intronic
1031857343 7:126938220-126938242 CAGAATGCAGATGTGAAGGAGGG + Intronic
1033045527 7:137958777-137958799 CAGAATGAGGAAGTGTTAGCTGG - Intronic
1033458818 7:141527063-141527085 CAGAAAGAGGAATTGTAGGCTGG - Intergenic
1033657278 7:143382255-143382277 CAGCAAGGGGAGGTGGAGGCAGG - Exonic
1034374517 7:150630501-150630523 AAGAAGGAGGAGGTGGAGGAAGG + Intronic
1034994498 7:155569679-155569701 CAGGGTGTGGAGGGGAAGGCAGG - Intergenic
1035076087 7:156178544-156178566 AGGAGAGAGGAGGTGAAGGCTGG + Intergenic
1035339745 7:158152634-158152656 CAGCATTTGGTGGTGAAGGCAGG - Intronic
1035930668 8:3776627-3776649 AAGAAGGAGGTGGTGATGGCTGG - Intronic
1036126605 8:6068653-6068675 AGGAATGAGGAGGAGAAGGAAGG - Intergenic
1036591530 8:10172975-10172997 CAAAGTGAGGAGGTGAAGCAGGG + Intronic
1036658131 8:10690814-10690836 AGGAATGAGGAGGGGAAGGGCGG - Intronic
1037453381 8:19039437-19039459 CAGGAGGAGGAGATGAAGTCAGG - Intronic
1037571811 8:20164376-20164398 GAGGATGAGGAGCTGAAGGGAGG + Intronic
1037675453 8:21047231-21047253 CAGAATGAGTAGTTGAAAGAAGG - Intergenic
1037881835 8:22577278-22577300 CTGATTGGGGAGGTGAAGGGAGG + Intergenic
1039387096 8:37145819-37145841 CAGGGTGTGGAGCTGAAGGCTGG - Intergenic
1040007410 8:42632083-42632105 CTTAATGAAGATGTGAAGGCAGG - Intergenic
1040392485 8:46961774-46961796 CAGAGTGGGAAGGTGACGGCCGG + Intergenic
1040551267 8:48439270-48439292 AGGAAGGAGAAGGTGAAGGCAGG - Intergenic
1041179295 8:55230945-55230967 CAGACTGAGCAGCTGAAGGCAGG - Intronic
1041313469 8:56539163-56539185 CAGAATGGGGAGGAGGAGGGAGG + Intergenic
1041317519 8:56579780-56579802 AAGAATGAGGAGGAGAAAGAAGG + Intergenic
1041669139 8:60475524-60475546 GAGAAAGAGGAGGAGAAAGCAGG - Intergenic
1041709560 8:60881498-60881520 CAGAAGTCGGAGGAGAAGGCAGG - Intergenic
1042072669 8:64953807-64953829 CAGAATTGGAAGGGGAAGGCTGG + Intergenic
1043683805 8:83064410-83064432 CAGATTGAGTAGGAGAAGGGAGG - Intergenic
1043829408 8:84970000-84970022 CAGAGAGAGGAAGAGAAGGCTGG + Intergenic
1044230127 8:89764987-89765009 TAGAATGAGGAGGTGGATGTGGG + Intronic
1044562735 8:93629146-93629168 CAGTTTGTGGAGGTGAAGGAAGG - Intergenic
1045006294 8:97919526-97919548 CAGAAAGAGGTGGGGACGGCTGG - Intronic
1045557797 8:103231513-103231535 CAGAATGAGGAGGTAATGGCTGG + Intergenic
1046550580 8:115710762-115710784 CACAATGAGGCATTGAAGGCAGG + Intronic
1046624565 8:116562905-116562927 CAGCAAGATGAGGTGAAGGAAGG - Intergenic
1046687492 8:117243815-117243837 AAGAATGAGGGGGTGAAGGAAGG + Intergenic
1047364506 8:124199866-124199888 CAGGATGAGGGGGTGATGGAGGG + Intergenic
1047705653 8:127496958-127496980 GGGAATGAGGAGGTTAAGGATGG - Intergenic
1048051671 8:130823023-130823045 CACAAGGAGGAGCTGAACGCAGG - Intronic
1048139384 8:131778255-131778277 CAGAATCAGGAAGTGAATCCAGG - Intergenic
1048260188 8:132938662-132938684 CAGGACGAGGAGGTAAAGACGGG + Intronic
1048901100 8:139038434-139038456 CAGAAAGAGAAGGGGAAGGAAGG + Intergenic
1049201280 8:141341754-141341776 CAGAATGGGCAGGTGAGGGAAGG + Intergenic
1049611009 8:143555326-143555348 CAGAATGTGGCGGTGAAGGGTGG + Intronic
1050413100 9:5386657-5386679 CAGAAGGAAAAGATGAAGGCTGG - Intronic
1050942177 9:11473203-11473225 TAGAAGGAGGAGGAGAAGGAGGG + Intergenic
1051053922 9:12960821-12960843 CAGAAAGAGGAAATGAAGGAGGG - Intergenic
1051488864 9:17638491-17638513 CCAAATGATGAGGTGAAGACTGG + Intronic
1053791190 9:41687397-41687419 CAGGATGGTGAGGAGAAGGCAGG + Intergenic
1054153963 9:61627375-61627397 CAGGATGATGAGGAGAAGGCAGG - Intergenic
1054179538 9:61899091-61899113 CAGGATGGTGAGGAGAAGGCAGG + Intergenic
1054658000 9:67681730-67681752 CAGGATGGTGAGGAGAAGGCAGG - Intergenic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1056254411 9:84783932-84783954 CAGCATGAGGAGATGGAGGTTGG + Intronic
1057677873 9:97149908-97149930 CAGGGTGGGGAGGAGAAGGCTGG - Intergenic
1057856189 9:98602585-98602607 TAAAATGAGGAGTTGTAGGCTGG - Intronic
1059142142 9:111863836-111863858 CAGAAATAGGAAGAGAAGGCAGG - Intergenic
1059363963 9:113770885-113770907 TAGAGTAAGGAGGTGATGGCAGG + Intergenic
1059679467 9:116572195-116572217 CAGCCTGGGGAGGAGAAGGCAGG - Intronic
1059697654 9:116744097-116744119 CAGAAAAAGGAGGTGAGGGTGGG + Intronic
1059737722 9:117118895-117118917 TAGAGTGAGGAGGTGGAGGAAGG - Intronic
1059788451 9:117612965-117612987 GAGAAAGAGGAGGAGAAGGGAGG + Intergenic
1060135322 9:121147921-121147943 CAGACTGAGAAGGAGAAGGAGGG + Intronic
1060235761 9:121861625-121861647 CAGAAGGAGGAGGGGAAGCTAGG + Intronic
1060406805 9:123376899-123376921 CAGGAGGAGGAGGAGGAGGCAGG - Exonic
1060483144 9:124029822-124029844 CAGATTGGGGTGGAGAAGGCCGG - Intronic
1061045781 9:128164080-128164102 CAGAAGGTGCAGGTGAGGGCAGG + Intergenic
1061731017 9:132614029-132614051 GAGAGTGAGGAAGCGAAGGCTGG - Intronic
1061946312 9:133910132-133910154 TAGAATGAAGAAGTGATGGCTGG + Intronic
1203780235 EBV:96626-96648 CAGGAGCAGGAGGTGGAGGCCGG + Intergenic
1185575492 X:1169034-1169056 GAGAAGGAGGAGGTGGAGGGAGG + Intergenic
1188374287 X:29408544-29408566 CAGAGTGAGGAAGTGAAGAAAGG + Intronic
1189191904 X:39116768-39116790 CAAAATGACGAGGTGAAGGCAGG - Intergenic
1189595687 X:42563228-42563250 TAGAATGAGGACATGAAGGCTGG - Intergenic
1192508836 X:71709715-71709737 CAGAATGTGGTGGTGAATCCTGG - Intergenic
1192517861 X:71771838-71771860 CAGAATGTGGTGGTGAATCCTGG + Intergenic
1192679730 X:73239484-73239506 CAGGTGGAGGAGGTGAAGGAGGG + Intergenic
1193009227 X:76657329-76657351 GGAAATGAGGGGGTGAAGGCAGG + Intergenic
1194102280 X:89720393-89720415 CAGAATGGGGAGGGGATGGGAGG - Intergenic
1194284079 X:91988293-91988315 CAGTATGAGGAGGAGAAGGGAGG - Intronic
1194862460 X:99018066-99018088 TAGAATGAGGTGGGGAGGGCTGG + Intergenic
1195479296 X:105324335-105324357 CAGAAAAAGCAGGGGAAGGCTGG - Intronic
1197326485 X:125100764-125100786 CAAAATCAGGAGGAGAAGGAGGG - Intergenic
1197966027 X:132062689-132062711 AAGAATGAGGAGGTAAATGAGGG - Intergenic
1198052283 X:132960765-132960787 CAGCATGAGGGGGTGGAGGAAGG - Intronic
1198096114 X:133381374-133381396 CAGAAATAGGAGGTGAATGCAGG + Intronic
1199114583 X:143976297-143976319 CTCAGTGAGAAGGTGAAGGCTGG - Intergenic
1199257994 X:145739052-145739074 CAGAAGGTGAAGGAGAAGGCAGG - Intergenic
1199284644 X:146042498-146042520 TAGAAAGAGGAGGTGGGGGCCGG + Intergenic
1199570550 X:149263100-149263122 CAGATTAAGCAGGTGAAGTCAGG - Intergenic
1200454870 Y:3377670-3377692 CAGAATGGGGAGGGGATGGGAGG - Intergenic
1200827590 Y:7660084-7660106 CAGAAGGAGGAGGAAAAGGTTGG + Intergenic
1201739704 Y:17310942-17310964 GAGAAGGAGGAGGAGAAGGGGGG - Intergenic