ID: 1163461668

View in Genome Browser
Species Human (GRCh38)
Location 19:17441707-17441729
Sequence ACATGGGGGACTTTTTTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 1, 2: 4, 3: 26, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163461657_1163461668 18 Left 1163461657 19:17441666-17441688 CCTGCAGCGTCTAGGGTATTGGT 0: 1
1: 0
2: 0
3: 7
4: 30
Right 1163461668 19:17441707-17441729 ACATGGGGGACTTTTTTTTTTGG 0: 1
1: 1
2: 4
3: 26
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163461668 Original CRISPR ACATGGGGGACTTTTTTTTT TGG Intronic
903256967 1:22108943-22108965 ACAGTGTGGACTTGTTTTTTTGG - Intergenic
904821152 1:33245387-33245409 ATACGAGGGATTTTTTTTTTTGG + Intergenic
904955256 1:34278300-34278322 ACATGGAAGAATTTTTTTTATGG - Intergenic
905209547 1:36364284-36364306 ACAAGGGGGACATGTTTTTAAGG + Intronic
906020536 1:42625024-42625046 TACTGGGGGACTTTTTTTTATGG + Intronic
907421720 1:54352173-54352195 ACTGAGGGGACTGTTTTTTTTGG - Intronic
908038739 1:60084540-60084562 ATATGAGGGATTTTTTTTTCTGG + Intergenic
908347148 1:63245674-63245696 ACATTGTGAACTTTTTTTTTTGG - Intergenic
909407155 1:75304073-75304095 ACAAAGCAGACTTTTTTTTTTGG - Intronic
909771275 1:79425063-79425085 ACATGGGTGACAATTTTTGTGGG + Intergenic
910790961 1:91049925-91049947 TGTTGGAGGACTTTTTTTTTTGG - Intergenic
912169203 1:107077469-107077491 ATAATTGGGACTTTTTTTTTTGG + Intergenic
914309195 1:146450447-146450469 ACATGGTGGGGTTTTTTGTTTGG + Intergenic
916587849 1:166164456-166164478 AAATGGGGGATATTTTATTTGGG - Intronic
918473764 1:184902018-184902040 ACATTGGGTACTTATTTATTTGG - Intronic
918901379 1:190424020-190424042 ACACATGGGACTTTTTTTGTTGG + Intronic
919039093 1:192359259-192359281 ACATGTGGCACTGTTTTTTTTGG + Intronic
919084125 1:192900543-192900565 ACATAGGGTTTTTTTTTTTTTGG - Intergenic
921438968 1:215161374-215161396 ACTTGGGAAACTTTTTTTATGGG + Intronic
924151992 1:241139078-241139100 ACTTGGCAGATTTTTTTTTTAGG + Intronic
1062949642 10:1488643-1488665 AAAGGGAGGACTTTTCTTTTTGG + Intronic
1065577565 10:27138040-27138062 ATATTTGGAACTTTTTTTTTTGG + Intronic
1065630051 10:27670601-27670623 ACATGGGGATCTATTATTTTTGG - Intergenic
1065643200 10:27805853-27805875 ACATATGTGATTTTTTTTTTTGG + Intergenic
1065728618 10:28690889-28690911 ACATTGGCCATTTTTTTTTTTGG + Intergenic
1066318081 10:34269233-34269255 AGATGGATCACTTTTTTTTTAGG - Intronic
1067749171 10:48958594-48958616 ATATAGGGACCTTTTTTTTTAGG + Intronic
1067866284 10:49910883-49910905 GCATGGGGGACGTATTTTTAAGG - Intronic
1068331873 10:55581832-55581854 ACATGTGGGCAATTTTTTTTTGG + Intronic
1068781813 10:60927544-60927566 AAATGTGGGAATTTTTTTCTGGG - Intronic
1070235147 10:74616537-74616559 ATATGGGTGAGTCTTTTTTTAGG + Intronic
1071126056 10:82336202-82336224 ACTGGTGTGACTTTTTTTTTTGG - Intronic
1071941473 10:90596036-90596058 ACATGTGGATCTTTATTTTTGGG + Intergenic
1072551957 10:96485883-96485905 ACATCGGACACTTTTTCTTTGGG - Intronic
1073163703 10:101424315-101424337 ACAGGTGGGAGTTTTGTTTTTGG + Intronic
1074168237 10:110905574-110905596 ACACCAGGGATTTTTTTTTTTGG - Intronic
1074237891 10:111604332-111604354 TCATGGTTGAATTTTTTTTTTGG + Intergenic
1074440072 10:113470548-113470570 ACATGGGGTCCTTGTATTTTTGG - Intergenic
1074937662 10:118201891-118201913 ACATTGTGGATTTTCTTTTTAGG + Intergenic
1076753682 10:132556767-132556789 ATTTTGGGGATTTTTTTTTTTGG + Intronic
1078785602 11:14488917-14488939 ACATAGGAGATTTTTCTTTTAGG - Intronic
1081241956 11:40717549-40717571 ACATGGGGTTCTTTTTTTGGGGG + Intronic
1081940057 11:46933628-46933650 ACCTCGGTGATTTTTTTTTTTGG + Intergenic
1084523344 11:69679562-69679584 ACAGGGTGAACTGTTTTTTTTGG - Intergenic
1084621306 11:70271510-70271532 CCATTGTGGATTTTTTTTTTCGG + Intronic
1084876470 11:72137229-72137251 AAATGGTGGAGTTTTTTCTTGGG - Intronic
1085742008 11:79085385-79085407 AAAAGGGGGGTTTTTTTTTTGGG + Intronic
1086876107 11:92097429-92097451 ACATGGTGGCTTCTTTTTTTTGG - Intergenic
1087378515 11:97374702-97374724 ACATGAATGAATTTTTTTTTTGG - Intergenic
1087449989 11:98308595-98308617 ACATGGGGGCCATTTCTTGTGGG + Intergenic
1087663826 11:101019371-101019393 ACATTAGGGATTTTTTTTTAAGG - Intergenic
1088251103 11:107861550-107861572 ACGTGCCGGAGTTTTTTTTTGGG - Intronic
1088835242 11:113572979-113573001 ACATAAGGCACTTTTTTGTTTGG - Intergenic
1089551548 11:119282937-119282959 ACATGTGGCTTTTTTTTTTTTGG - Intronic
1089636476 11:119816883-119816905 ACTTGGTGGACTTTTTGTGTCGG + Intergenic
1090125331 11:124078137-124078159 ACATGGGGGACTTCTGTTGTGGG + Intergenic
1090240976 11:125181636-125181658 ACATGGGGAACTATTTCTATGGG - Intronic
1090674992 11:128983687-128983709 ACATGGTTTTCTTTTTTTTTTGG - Intronic
1090792429 11:130102992-130103014 ACATGGGGCATTAATTTTTTTGG + Intronic
1092394948 12:8117564-8117586 CCAATGGGAACTTTTTTTTTAGG + Intergenic
1093480988 12:19603647-19603669 ACATGGTGGATTTTCATTTTTGG + Intronic
1093481415 12:19607583-19607605 ATATAGGGGACTCTTTTTTAGGG + Intronic
1093486431 12:19657991-19658013 ATTTGGGGAATTTTTTTTTTTGG + Intronic
1094187851 12:27663966-27663988 AGATGGGGGTCTTTCTTTTAAGG + Intronic
1095189048 12:39234834-39234856 ACCTGGAGATCTTTTTTTTTTGG - Intergenic
1096085680 12:48863646-48863668 AGATTGGGGAATTTTTGTTTGGG + Intronic
1096108689 12:49015564-49015586 GCATATGTGACTTTTTTTTTGGG + Intronic
1096139903 12:49234347-49234369 ACAGGGTGGACTTGATTTTTAGG - Intronic
1096734283 12:53640508-53640530 TCATGTGGAAATTTTTTTTTTGG + Intronic
1098205836 12:68108995-68109017 ACATGTGGGACTTTGGATTTTGG - Intergenic
1100424212 12:94468090-94468112 AAATGAGGGAGTTTATTTTTAGG - Intergenic
1101197860 12:102404078-102404100 ACCTGAGGTACTTCTTTTTTTGG + Intronic
1101610319 12:106285206-106285228 GCTTGGGGGCCTATTTTTTTAGG - Intronic
1103360825 12:120352656-120352678 ACTTGGGGGTCTTATTTATTTGG - Intronic
1104506032 12:129333463-129333485 ATACGGGGAACTTTTTGTTTGGG + Intronic
1106355903 13:28982882-28982904 ACATGGGGGAATTGTTTAATAGG + Intronic
1107179987 13:37447667-37447689 TCATGTGGGACTTTGTTTATGGG - Intergenic
1108723476 13:53156257-53156279 ATATAGGATACTTTTTTTTTAGG - Intergenic
1108769170 13:53676900-53676922 TCATGGGAGACTTTTTATTATGG + Intergenic
1111477981 13:88779058-88779080 ACAGAGGGGACATATTTTTTAGG - Intergenic
1111679255 13:91424289-91424311 ACAAGAATGACTTTTTTTTTTGG + Intronic
1112099940 13:96177619-96177641 ATATGGGGGTCTTGTTTTGTAGG + Intronic
1113898565 13:113782849-113782871 AGGTGGGGGACTTTTCTTTCGGG + Intronic
1117228540 14:53689975-53689997 AGATAAGTGACTTTTTTTTTCGG + Intergenic
1117887571 14:60381499-60381521 ACATGGGGTTTTTTTTGTTTTGG - Intergenic
1118944752 14:70374088-70374110 ACATAAGGGTCTTTTTTATTAGG + Intronic
1119814975 14:77557968-77557990 ATTTGGGGGAGTTTTTTTTAAGG - Intronic
1120348269 14:83318563-83318585 AGATGGTGGACTTTTCTATTCGG + Intergenic
1122560232 14:102608170-102608192 ACATGTGAGATTTTCTTTTTAGG - Intronic
1124359946 15:29029331-29029353 ACAGAGGGGTTTTTTTTTTTTGG - Intronic
1125552339 15:40554943-40554965 ATATGGGGGAATTTATGTTTTGG + Intronic
1127744093 15:61946647-61946669 ACTTGGTGGGTTTTTTTTTTTGG - Intronic
1128417866 15:67463559-67463581 ACATGGGGTTGTTATTTTTTAGG + Intronic
1131963820 15:97816306-97816328 AAATGGAGGACTTTATTTTTTGG - Intergenic
1132172900 15:99681064-99681086 ACTTTGGGGACTTTTTACTTTGG + Intronic
1132255966 15:100376286-100376308 ACCTGCAGGATTTTTTTTTTTGG + Intergenic
1134083379 16:11339953-11339975 ACTCTGGGGAATTTTTTTTTTGG - Intronic
1134834753 16:17351730-17351752 ACATTTGAGGCTTTTTTTTTGGG + Intronic
1135777680 16:25271165-25271187 ACCTGGGTAATTTTTTTTTTTGG - Intergenic
1137535642 16:49322590-49322612 ACTTGGGGGAATTTTATTCTTGG + Intergenic
1137581815 16:49638170-49638192 ACATGGGGCACTTGTGTTTCTGG + Exonic
1139362953 16:66414096-66414118 ACATATGGTAATTTTTTTTTTGG - Intergenic
1140323627 16:73978304-73978326 ACATGGGTGTTTTTTTTTGTTGG - Intergenic
1142832732 17:2561326-2561348 ACATTGGGGACTGCTGTTTTAGG + Intergenic
1143130881 17:4676258-4676280 ACATGGGGCAGTTGGTTTTTGGG - Intronic
1143719950 17:8802436-8802458 ACATTTGGGATTTTTTGTTTTGG - Intergenic
1145720801 17:27070692-27070714 ACTTAAGGCACTTTTTTTTTTGG - Intergenic
1148645093 17:49215484-49215506 ACATGGAAAGCTTTTTTTTTTGG + Intronic
1149320729 17:55478194-55478216 ACAACAGGTACTTTTTTTTTGGG - Intergenic
1150520120 17:65857693-65857715 ACCTGAGGGATTTTTTTTTTTGG + Intronic
1150770887 17:68039780-68039802 CCATGCCCGACTTTTTTTTTTGG - Intronic
1151034377 17:70781065-70781087 GCCTGGGGGACTTTATTTTAAGG + Intergenic
1151254908 17:72869151-72869173 ACATGGGGGGCTCGTTTATTTGG - Intronic
1152028319 17:77825980-77826002 ACCTGGGTGACTTTACTTTTTGG + Intergenic
1153095659 18:1399311-1399333 ACATGTGGGAGGTTTTTTTGCGG - Intergenic
1153316834 18:3731071-3731093 ACATGTGTGACTCTTTTTTAAGG + Intronic
1154013989 18:10600283-10600305 GCATGGGGGACTTAATGTTTAGG + Intergenic
1154534116 18:15380306-15380328 ACGTGGGGGACCTTATTGTTTGG - Intergenic
1155390692 18:25333520-25333542 ACAGGATGTACTTTTTTTTTGGG - Intronic
1157152624 18:45233486-45233508 AAATAGGGGACTTTTTTGTTTGG - Intronic
1158034532 18:53009555-53009577 AGTTAGGTGACTTTTTTTTTAGG + Intronic
1159385405 18:67718338-67718360 ACAAGGGGAGCATTTTTTTTTGG + Intergenic
1159408343 18:68035970-68035992 ACATTGTGGACATTTTATTTAGG + Intergenic
1159677372 18:71302619-71302641 ACATGTTGGACATTTTTTTCAGG + Intergenic
1163432689 19:17277709-17277731 AGAGGGGGGACTTTTGATTTGGG - Intronic
1163461668 19:17441707-17441729 ACATGGGGGACTTTTTTTTTTGG + Intronic
1163909318 19:20175702-20175724 ACATGGGAGACTTTTCATTTTGG - Intronic
1164166950 19:22687998-22688020 ATATGAGAGATTTTTTTTTTAGG + Intergenic
1164893566 19:31847158-31847180 ACAATGAGAACTTTTTTTTTTGG - Intergenic
1165575578 19:36814122-36814144 ACCTGGCGGGTTTTTTTTTTTGG + Intergenic
1166820515 19:45576546-45576568 CCATTTTGGACTTTTTTTTTTGG - Intronic
927132442 2:20071950-20071972 ACATGTTGGCCTTTTTTTTTTGG - Intergenic
928182300 2:29077419-29077441 ACATGAAGGAATTTTTTTTAGGG + Intergenic
930118144 2:47737580-47737602 CCAAGGGGGACTTTTCCTTTTGG + Intronic
930501323 2:52221802-52221824 ACATGTAGGACTTCTTTTTGGGG + Intergenic
931079925 2:58757441-58757463 ACATGTGTGGCTTTTATTTTGGG + Intergenic
931539878 2:63318663-63318685 ACATGGGGTATTTGGTTTTTTGG - Intronic
932401666 2:71484961-71484983 ACATGGGGCACTGGTTTTTAGGG - Intronic
933505061 2:83166405-83166427 ACTTTGGGGTTTTTTTTTTTTGG + Intergenic
936660475 2:114537492-114537514 AGAAGGGAGACTTTTTTTTTTGG + Intronic
936704613 2:115057363-115057385 AGATGGAGGGATTTTTTTTTAGG + Intronic
937679646 2:124630088-124630110 ACTTGGGATTCTTTTTTTTTTGG - Intronic
938430609 2:131233593-131233615 ATATGTTGGCCTTTTTTTTTTGG + Intronic
940444254 2:153758295-153758317 AAATGGGGTTTTTTTTTTTTTGG + Intergenic
940467838 2:154054959-154054981 AGATATGGGACTTTTTTTTTAGG + Intronic
941047436 2:160692491-160692513 ACATGGAATATTTTTTTTTTTGG + Intergenic
942299040 2:174544649-174544671 ACATGGGGGAATTTTGCTTCTGG - Intergenic
942346001 2:175004433-175004455 CTATTGGGGAATTTTTTTTTTGG - Intronic
943049661 2:182899711-182899733 AGATGCGGTACTTTTTTTTAGGG - Intergenic
945276292 2:207990812-207990834 ACTTTGGAGACTTTCTTTTTGGG + Intronic
945509934 2:210688379-210688401 ACATGTGGGATTTTTTTTTTTGG + Intergenic
947423347 2:229960467-229960489 CCATGCCGGTCTTTTTTTTTTGG + Intronic
948406511 2:237724797-237724819 ACATTTTGGATTTTTTTTTTCGG + Intronic
949003523 2:241632089-241632111 AGATGTGTGTCTTTTTTTTTTGG + Intronic
1170867601 20:20173757-20173779 GCATTGGTGACTTTTTTTCTTGG + Intronic
1170905238 20:20509507-20509529 ACATGAGGGCCTTTTTTCCTAGG - Intronic
1171244382 20:23599458-23599480 ACATGGGGAAGTTTTAATTTTGG - Intergenic
1172074335 20:32282546-32282568 AAAAGCAGGACTTTTTTTTTTGG - Intronic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1174969975 20:55264226-55264248 ACATGAGGGATTTTTGTTTTTGG - Intergenic
1175733662 20:61371022-61371044 GCCTGGGGGATTTTTTATTTGGG + Intronic
1178948166 21:36965707-36965729 ACAGGTGGGAGTTTTTTGTTTGG + Intronic
1180556287 22:16579767-16579789 CCATGTGGGACTTTTCTATTAGG + Intergenic
1183988171 22:41580681-41580703 GCCACGGGGACTTTTTTTTTGGG - Intronic
956237765 3:67093836-67093858 ACTTGGGGGTATTTTTTTATGGG + Intergenic
956881545 3:73515889-73515911 ACTTTGGGGACTGTTGTTTTAGG - Intronic
957146978 3:76436545-76436567 AAATAGGCAACTTTTTTTTTTGG + Intronic
958844210 3:99245766-99245788 AAATAGGTCACTTTTTTTTTTGG - Intergenic
959459491 3:106607229-106607251 ACAAAGAGGATTTTTTTTTTGGG - Intergenic
960206738 3:114911121-114911143 AACTAGGGCACTTTTTTTTTTGG - Intronic
961859953 3:129908466-129908488 ACAGGTAGGACTTTTTTATTAGG + Intergenic
962223949 3:133588789-133588811 TCTTGGGGGTTTTTTTTTTTTGG + Exonic
962332686 3:134493467-134493489 ACATGGGAACCTTTTTCTTTAGG + Intronic
962867118 3:139456280-139456302 ACATTTGGGCCTGTTTTTTTTGG + Intronic
962955370 3:140261366-140261388 CCATGGGAGACATTTTTATTTGG + Intronic
963784407 3:149519027-149519049 CCATGGGGGACTTATTTGTTGGG - Exonic
966449168 3:180037655-180037677 AGATCAGGGACTTTTTTTTAGGG + Intergenic
967459035 3:189723918-189723940 CCATGGGGAACTTTATTTTCTGG + Intronic
967695116 3:192521937-192521959 ACAATGGGGACTTTTACTTTGGG + Intronic
970408956 4:15789485-15789507 ACTTTGGGGATTTCTTTTTTAGG + Intronic
970540010 4:17068268-17068290 ACATGGGGCACTTTTTGTAGGGG - Intergenic
970625620 4:17875727-17875749 ACTTGGGGACCTATTTTTTTTGG + Intronic
970993339 4:22237727-22237749 ACAAGTGGGATTTTGTTTTTGGG - Intergenic
972385138 4:38558779-38558801 ACATTTGGGATTTTTTTTTTTGG - Intergenic
973902088 4:55485913-55485935 AGTTGGGGAACTTTGTTTTTTGG - Intronic
974014179 4:56634055-56634077 GCGTGGGCCACTTTTTTTTTTGG - Intergenic
974493138 4:62592209-62592231 TCATTGGGGTTTTTTTTTTTTGG + Intergenic
975484492 4:74919580-74919602 ACATCGGGGATTTCTTGTTTTGG - Intergenic
976525279 4:86080311-86080333 TCATTTGGGATTTTTTTTTTTGG - Intronic
978421767 4:108541201-108541223 ACATGAGGGACTTTCTGATTGGG + Intergenic
979061827 4:116072137-116072159 CCAATGGGGACTTTTTTTTTTGG + Intergenic
979062573 4:116082095-116082117 ATATTGTGCACTTTTTTTTTAGG + Intergenic
981950961 4:150406777-150406799 AAATTGAGGAATTTTTTTTTTGG + Intronic
982543302 4:156703019-156703041 ACATGGAGGACATTTTCTGTGGG - Intergenic
982804797 4:159749701-159749723 ACATGTGTGAGTTTATTTTTGGG + Intergenic
983455741 4:167961887-167961909 AGATGGGGGACTTTTTATTATGG - Intergenic
983463596 4:168057832-168057854 AAATGGAGGAGTTTATTTTTGGG - Intergenic
984228057 4:177059079-177059101 AGATGTGGGACTTTATTTCTGGG - Intergenic
984295725 4:177852509-177852531 ATTTGGGGGACTTTTGTTTATGG - Intronic
985979240 5:3448646-3448668 ACAAGGTGCATTTTTTTTTTAGG + Intergenic
986629971 5:9762253-9762275 ACATAGGGGTCTTTTATTTTAGG - Intergenic
988982318 5:36584037-36584059 AAATAGGTGACTTTTTTCTTCGG - Intergenic
990768750 5:59218728-59218750 ACATTGTGAACTTTGTTTTTTGG - Intronic
992160749 5:73998737-73998759 CCATGGGTTACTTTTTTTCTAGG - Intergenic
994009015 5:94878021-94878043 CCATGGGGGCCTTTTATTTTGGG + Intronic
996957878 5:129207029-129207051 AAATTGTGGACTCTTTTTTTAGG + Intergenic
1001017612 5:168155451-168155473 ACATGGGGGCCCTTTCTCTTGGG - Intronic
1003946844 6:11083888-11083910 ACATGGGGGAACTGTGTTTTGGG - Intergenic
1005135116 6:22559341-22559363 CCATGGGGGACCTTTTTATAAGG - Intergenic
1005910315 6:30303714-30303736 AGTTGGGGTATTTTTTTTTTTGG - Intergenic
1006000635 6:30962441-30962463 ACAGGAGGGACTTTTCCTTTTGG + Intergenic
1007052052 6:38841716-38841738 ACATGTGGGATTTTTTTTTTTGG + Intronic
1007139948 6:39561950-39561972 ACATAGGAGACTTCTTGTTTCGG - Intronic
1007985998 6:46207181-46207203 ATGTGGGTCACTTTTTTTTTTGG - Intergenic
1008692777 6:53999549-53999571 AGATGCGGGACTTTTCTTCTAGG - Intronic
1009803750 6:68575402-68575424 ACATGGGTGACCTTGTTTTCAGG - Intergenic
1009835321 6:68993415-68993437 ACATGGGGGACTGTTTAGTAAGG - Intronic
1011359189 6:86503640-86503662 ACATGTGTGACTATTTTTGTAGG + Intergenic
1011948827 6:92938666-92938688 ACATGTGGGACTATTATTCTAGG + Intergenic
1014086141 6:117346560-117346582 GCATGGACGTCTTTTTTTTTTGG + Intronic
1014489060 6:122039077-122039099 TCATGTGGGATTTTTTCTTTTGG + Intergenic
1014805439 6:125824331-125824353 ACTTGGGAGACTTTTGCTTTTGG + Intronic
1014861502 6:126473221-126473243 ACATGTAGGCCTTTTTGTTTTGG + Intergenic
1018002569 6:159592554-159592576 ACAAGGGGGACTTTTTTTTTTGG + Intergenic
1018345530 6:162895108-162895130 ACATGGCTAAATTTTTTTTTGGG - Intronic
1020839867 7:13202628-13202650 ACATCTGGGATTTTTTGTTTTGG + Intergenic
1023640826 7:42255443-42255465 ACATGAGGGATTTTTCTTTTAGG - Intergenic
1026342304 7:69444940-69444962 ACATTGGGGATTAATTTTTTGGG + Intergenic
1026957795 7:74388794-74388816 ACCTGGCGGTTTTTTTTTTTTGG - Intronic
1027956975 7:84892481-84892503 ATATGTGGAACTTTTTGTTTTGG + Intergenic
1029017048 7:97325774-97325796 ATGTGGGGGACTTTTTTTCCAGG + Intergenic
1030710764 7:112746352-112746374 AAAAGGGAGGCTTTTTTTTTTGG - Intergenic
1031250729 7:119377336-119377358 ACAAGGGGGACATATTTTTGAGG - Intergenic
1033184249 7:139211578-139211600 TCATGGAGGATTTTTTTTTAAGG + Intergenic
1033972302 7:147056962-147056984 AGATGGGGTTATTTTTTTTTTGG + Intronic
1035861764 8:3036795-3036817 ACATGGGATTCTTTTCTTTTTGG + Intronic
1036450195 8:8859351-8859373 ACATGGTGAACTTTTTTTTTTGG - Intronic
1037165365 8:15821576-15821598 AGATGAGGGTTTTTTTTTTTAGG + Intergenic
1038239486 8:25795532-25795554 ACATTGAGGAGTTGTTTTTTTGG + Intergenic
1038337487 8:26657030-26657052 ACATGGGAGCTTTTTATTTTCGG + Exonic
1038773694 8:30508613-30508635 ACATAATGGATTTTTTTTTTTGG + Intronic
1040308167 8:46223060-46223082 GGATGGGAGAGTTTTTTTTTAGG - Intergenic
1040514233 8:48121441-48121463 CCATGGGTGACTGTTTTGTTTGG + Intergenic
1042319212 8:67457415-67457437 ATATGGGGGACTTATTTTTTTGG + Intronic
1046393205 8:113603831-113603853 TCATGGTTGACTTTTTTATTTGG - Intronic
1047001153 8:120573840-120573862 AAATGGGTGAATTTATTTTTGGG + Intronic
1047277757 8:123418471-123418493 ACATGGTTTACTTGTTTTTTTGG - Intronic
1047425165 8:124738824-124738846 ACATGGGAGACTATTTTTAATGG + Intergenic
1047708072 8:127522724-127522746 ACATGGAGGACATTGTTTGTAGG - Intergenic
1050041434 9:1498686-1498708 GCATGGAGGTATTTTTTTTTTGG - Intergenic
1050562302 9:6846746-6846768 ACATGCTTGACTTGTTTTTTGGG + Intronic
1050648417 9:7747614-7747636 ACATAAGGGACTTTCTTGTTTGG - Intergenic
1052629072 9:31013811-31013833 ATATGGGTGACTGTTTCTTTTGG - Intergenic
1053037520 9:34838041-34838063 ATATGGGGGATTTTTTTGGTTGG - Intergenic
1053400665 9:37817737-37817759 TTCTGGGAGACTTTTTTTTTTGG - Intronic
1053711415 9:40813525-40813547 ACATGGAGGACCTTATTGTTTGG - Intergenic
1054421328 9:64934342-64934364 ACATGGAGGACCTTATTGTTTGG - Intergenic
1055635733 9:78276494-78276516 ATATGGGGTCTTTTTTTTTTTGG + Intronic
1056255297 9:84793294-84793316 AACTGGGGCAATTTTTTTTTTGG - Intronic
1057385553 9:94603122-94603144 GCAAGGGAGACTTTTTTTTAAGG + Exonic
1058673777 9:107382731-107382753 AAATTGGTGATTTTTTTTTTTGG - Intergenic
1059034574 9:110740061-110740083 AAATGGGGGACTTCTTTTTAAGG + Intronic
1059478599 9:114570277-114570299 ACATGGGAGACTTTTTCTTCAGG + Intergenic
1059859430 9:118442127-118442149 ACATGTCTGACTGTTTTTTTAGG - Intergenic
1185452218 X:288758-288780 AAATGGGGGACTTCTTGTTCAGG - Exonic
1186015882 X:5192758-5192780 ACATGGGTGACATTTTTTCTTGG + Intergenic
1187553181 X:20326393-20326415 AAATTAGGGATTTTTTTTTTTGG + Intergenic
1188970650 X:36611534-36611556 CCATGGTGGACTGTTTTTTCAGG - Intergenic
1189585115 X:42452367-42452389 TCACGGGGGATTTTTTTTTAAGG + Intergenic
1189751677 X:44228885-44228907 ACAAAGGGGACTTTCTCTTTAGG - Intronic
1191683014 X:63860531-63860553 ACACTGGGGACTGTTTTTTGCGG - Intergenic
1193068221 X:77279926-77279948 ACATGGGAGACTTTTCATTTTGG + Intergenic
1193599039 X:83486338-83486360 TGATGGGGGACTTTTTATTATGG - Intergenic
1193681283 X:84521551-84521573 ACTTGGGAGACTTTTATTTCTGG + Intergenic
1193945930 X:87734462-87734484 AAATGAGGGGTTTTTTTTTTTGG - Intergenic
1194969150 X:100323758-100323780 ACATTGAGAATTTTTTTTTTGGG - Intronic
1196333966 X:114507832-114507854 ACAGGGTGGGTTTTTTTTTTTGG + Intergenic
1200176021 X:154116890-154116912 AAATGGGGGACTTTATTCTCTGG - Intergenic
1200676487 Y:6152575-6152597 AGCTGTAGGACTTTTTTTTTTGG - Intergenic
1202075623 Y:21035355-21035377 ACAAGGGCAGCTTTTTTTTTAGG + Intergenic
1202270327 Y:23065988-23066010 AGAGGGGGCACTTTTTTTTTTGG + Intergenic
1202295700 Y:23354694-23354716 AGAGGGGGCACTTTTTTTTTTGG - Intergenic
1202423321 Y:24699733-24699755 AGAGGGGGCACTTTTTTTTTTGG + Intergenic
1202447468 Y:24970353-24970375 AGAGGGGGCACTTTTTTTTTTGG - Intergenic