ID: 1163462692

View in Genome Browser
Species Human (GRCh38)
Location 19:17448457-17448479
Sequence GGCCATGGCGGGGGTTCCTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 285}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163462684_1163462692 -5 Left 1163462684 19:17448439-17448461 CCGGCCGCCGTAAGAACGGGCCA 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1163462692 19:17448457-17448479 GGCCATGGCGGGGGTTCCTGCGG 0: 1
1: 0
2: 3
3: 26
4: 285
1163462678_1163462692 20 Left 1163462678 19:17448414-17448436 CCAGCAGGGTCATTGCAGCCAGC 0: 1
1: 0
2: 2
3: 18
4: 192
Right 1163462692 19:17448457-17448479 GGCCATGGCGGGGGTTCCTGCGG 0: 1
1: 0
2: 3
3: 26
4: 285
1163462680_1163462692 2 Left 1163462680 19:17448432-17448454 CCAGCACCCGGCCGCCGTAAGAA 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1163462692 19:17448457-17448479 GGCCATGGCGGGGGTTCCTGCGG 0: 1
1: 0
2: 3
3: 26
4: 285
1163462683_1163462692 -4 Left 1163462683 19:17448438-17448460 CCCGGCCGCCGTAAGAACGGGCC 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1163462692 19:17448457-17448479 GGCCATGGCGGGGGTTCCTGCGG 0: 1
1: 0
2: 3
3: 26
4: 285
1163462676_1163462692 29 Left 1163462676 19:17448405-17448427 CCGCGATGCCCAGCAGGGTCATT 0: 1
1: 0
2: 2
3: 30
4: 318
Right 1163462692 19:17448457-17448479 GGCCATGGCGGGGGTTCCTGCGG 0: 1
1: 0
2: 3
3: 26
4: 285
1163462686_1163462692 -9 Left 1163462686 19:17448443-17448465 CCGCCGTAAGAACGGGCCATGGC 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1163462692 19:17448457-17448479 GGCCATGGCGGGGGTTCCTGCGG 0: 1
1: 0
2: 3
3: 26
4: 285
1163462677_1163462692 21 Left 1163462677 19:17448413-17448435 CCCAGCAGGGTCATTGCAGCCAG 0: 1
1: 0
2: 1
3: 13
4: 154
Right 1163462692 19:17448457-17448479 GGCCATGGCGGGGGTTCCTGCGG 0: 1
1: 0
2: 3
3: 26
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163462692 Original CRISPR GGCCATGGCGGGGGTTCCTG CGG Exonic
900135445 1:1115487-1115509 GGGCAGGGAGGGGGTCCCTGGGG - Intronic
900174370 1:1285299-1285321 GGCAGTGGCTGGGCTTCCTGGGG + Intronic
901305132 1:8227299-8227321 GTCCATGGCTTGGGTTGCTGTGG + Intergenic
902584991 1:17433425-17433447 GGGCAGGGCGGGGGTGCCAGTGG + Intronic
902698887 1:18158192-18158214 TGCCATGGCAGGGGGTCCTAAGG - Intronic
902809280 1:18879244-18879266 GGCCAGGGGAGGGGTCCCTGGGG + Intronic
903368308 1:22818360-22818382 AGCCAGGGCGGTGGTTCATGGGG - Intronic
903774916 1:25786864-25786886 GGGCCTGGCGGGGGAGCCTGGGG - Intergenic
904179339 1:28654840-28654862 GGCGATGACAGGGGTTGCTGGGG + Intergenic
905354178 1:37369599-37369621 GGCGATGGCAGGGGTGGCTGGGG - Intergenic
911407830 1:97464562-97464584 AGTCATGGCTGGGGTTGCTGGGG - Intronic
911608237 1:99932510-99932532 GGCCAAGGCGGTGGATCCTGAGG - Intergenic
912028316 1:105206243-105206265 TGCCCTGGCAGGGGTTGCTGAGG + Intergenic
913264549 1:117031544-117031566 GGCCAAGCCTGGGGTCCCTGTGG + Intronic
913326892 1:117635343-117635365 GGCCATGCCTGGGGGTCCAGTGG - Intergenic
913335874 1:117708697-117708719 GGCCTTTACTGGGGTTCCTGTGG - Intergenic
913529717 1:119725052-119725074 GCAGATGGCGGGGGCTCCTGAGG + Intronic
919751205 1:201039424-201039446 GCCCATGGGCAGGGTTCCTGGGG + Intergenic
922678021 1:227564966-227564988 GGCCAAGGCGGGGGATCACGAGG - Intronic
923937445 1:238778961-238778983 GGCCAAGGCGGGGGATCACGAGG - Intergenic
1063566635 10:7177079-7177101 AGCCATGGAGGGGGTTGCTGGGG - Intronic
1063909524 10:10815161-10815183 GGCCAGGGCAGGGGCTCCAGAGG - Intergenic
1065034568 10:21624810-21624832 GGCCGTGGCCGTGGTTCCCGTGG - Intronic
1067024995 10:42836954-42836976 GGCCATGGGTGCGGTTCCAGCGG - Intergenic
1067668170 10:48296278-48296300 GGACATTTGGGGGGTTCCTGTGG - Intergenic
1072664761 10:97384991-97385013 TGCCAAGGTGGGGGTTCCTCAGG - Intronic
1072805741 10:98423271-98423293 GACCGGGGGGGGGGTTCCTGTGG - Intronic
1073033109 10:100543804-100543826 GGCCAAGGCGGGGGATCATGAGG - Intronic
1074865813 10:117543760-117543782 GGCCTGGGCGGAGGTTCCTCCGG + Intronic
1076316306 10:129544406-129544428 GGCCATGCTGGGGCTTCCTGAGG - Intronic
1077182945 11:1224548-1224570 GGCCAGGGAGGGGCTGCCTGGGG + Intronic
1077230743 11:1457241-1457263 TGCCATGGCGGGGAGTCCCGAGG - Intronic
1077707718 11:4503926-4503948 GGCCATGGCTTGGGACCCTGGGG + Intergenic
1077811665 11:5644044-5644066 GGTCATGGGGGTGGTTCCTATGG - Exonic
1082238856 11:49851917-49851939 GGCCACGGCGGGGCTTTCAGAGG - Intergenic
1083694946 11:64436547-64436569 GGCCCTGGAGGGGGTTCCTGGGG + Intergenic
1083904851 11:65662827-65662849 GTCCATGGCCGGGGTCCCGGGGG + Exonic
1084153195 11:67300771-67300793 GGCCCAGGCTGGGGCTCCTGAGG - Intronic
1084509569 11:69594824-69594846 GCCCGTGGAGTGGGTTCCTGGGG - Intergenic
1085417499 11:76329112-76329134 GGCCCTGGAGCGGGGTCCTGGGG - Intergenic
1089645405 11:119875641-119875663 GGGCATGGCAGGGGCTCCAGTGG - Intergenic
1090471887 11:126988418-126988440 GGCCAGGGCAGGGGTTTCTGTGG + Intronic
1091243211 11:134069067-134069089 CGCCATGTCGAGGGTTGCTGAGG - Exonic
1091460761 12:642461-642483 GGCCGAGGCGGGGGGACCTGAGG - Intronic
1096457356 12:51798655-51798677 GGCAATGACAGGGGTGCCTGGGG + Intronic
1096475480 12:51906877-51906899 GGCCAAGTCGGGAGTTCCCGAGG + Intergenic
1096993911 12:55827341-55827363 GACCATGGCTGGGGTTCCTGAGG - Exonic
1097053080 12:56235250-56235272 GGCCCTTGCTGGGCTTCCTGGGG + Exonic
1097054134 12:56239912-56239934 GGCCATGGCTGGGGTTGGAGAGG + Exonic
1098361151 12:69655576-69655598 GGCCCTGGGGGGGTTTCTTGAGG + Exonic
1098402903 12:70092608-70092630 GGCCGAGGCGGGGGATCATGTGG + Intergenic
1099064712 12:77960067-77960089 GGCCATGGTGTGAGGTCCTGGGG + Intronic
1099689874 12:85938814-85938836 GGCTATGACAGGGGTTGCTGGGG - Intergenic
1100283221 12:93138473-93138495 GCCCATGGCTGGGGTAGCTGTGG + Intergenic
1102240691 12:111322729-111322751 GAACATGGCGGGGGGTCCTGGGG + Intronic
1103513948 12:121494605-121494627 GGCCATCACTGGGGTCCCTGTGG - Exonic
1103788295 12:123450172-123450194 GGCCAAGGCGGGGTATCATGAGG + Intergenic
1103809771 12:123604033-123604055 GGCCAAGGCGGGCGTACCTGAGG - Intronic
1104604285 12:130176572-130176594 GGCAATGGCTGGGGTGGCTGGGG + Intergenic
1104719992 12:131039921-131039943 GGCCCTGCCGGCGGTCCCTGAGG + Intronic
1105016026 12:132787400-132787422 GGCCTTGGGGAGGGTTCCTGGGG - Intronic
1106717922 13:32410159-32410181 GGCCTTGCCCGGGGTCCCTGCGG + Intronic
1107951420 13:45465326-45465348 GGCCATGGTGGCGGATCCGGTGG + Intronic
1109252094 13:60031974-60031996 GGCCAAGGCGGTGGATCATGAGG - Intronic
1109277932 13:60322794-60322816 GGGCAGGGAGGGTGTTCCTGGGG - Intergenic
1110827462 13:79989337-79989359 GACCATGGAGTGGGTGCCTGGGG - Intergenic
1113887205 13:113667225-113667247 GGCCCTGTCGAGGGTTCCTGGGG - Exonic
1114421754 14:22589596-22589618 GGCAATGCCTGGCGTTCCTGGGG + Intergenic
1114635185 14:24183213-24183235 GGCCAGGCTGGGGGTTCTTGGGG - Intronic
1116817921 14:49599938-49599960 GGCCGGGGCGGGGGCTCCGGGGG + Intronic
1117257865 14:53998784-53998806 GGCCATTGCTGGTGTCCCTGGGG + Intergenic
1118770751 14:68941065-68941087 GGACTTGGGAGGGGTTCCTGTGG + Intronic
1119712193 14:76830312-76830334 GCCTATGGCAGGGCTTCCTGAGG - Intronic
1120976895 14:90256794-90256816 GGCCTTGCCCGGGGATCCTGGGG + Intronic
1121037728 14:90720236-90720258 GGTCATGGGGGGTTTTCCTGAGG - Intronic
1121941902 14:98078819-98078841 GGCCAAGGCGGCGGATCATGAGG + Intergenic
1122053298 14:99074826-99074848 GGGCATTGTGGGGCTTCCTGGGG - Intergenic
1122315929 14:100826160-100826182 GGCCTTGGCGGCGGCTCCTCAGG + Intergenic
1122503051 14:102213994-102214016 GGGCATGGCGGGGGATCCGGTGG + Intronic
1122937787 14:104967899-104967921 GGCCGAGGCGGGGCTTCCTCAGG - Intronic
1122976444 14:105172780-105172802 GGCCATGCAGGTGGTTGCTGTGG - Intergenic
1126986805 15:54321049-54321071 GGCCATGGAGGCGGTTTCGGGGG - Intronic
1126990888 15:54374375-54374397 GGCCGGGGTGGGGGTTACTGAGG - Intronic
1129324618 15:74793551-74793573 GGGCAAGGCGGGGGTCCCTAGGG - Intronic
1129774976 15:78230483-78230505 GGCCATGGTGGCTGCTCCTGGGG - Intronic
1129999825 15:80036812-80036834 GGTCATTGCAGGGGTTGCTGGGG - Intergenic
1130709043 15:86261292-86261314 GGCCATGGCTGAGGTTGCAGTGG + Intronic
1132028136 15:98420102-98420124 GGCCATGGGGGCGGATCCCGGGG + Intergenic
1132952115 16:2568953-2568975 GCCCAGGGAGGTGGTTCCTGAGG - Intronic
1132962235 16:2631217-2631239 GCCCAGGGAGGTGGTTCCTGAGG + Intergenic
1133046610 16:3091804-3091826 GGCCATGGTGAGGGGCCCTGGGG + Exonic
1134065302 16:11224523-11224545 GGCCATGGTGGGGGTGTCTTGGG + Intergenic
1134785671 16:16940542-16940564 GGCCAGGGAGGGGGATTCTGTGG + Intergenic
1136356347 16:29746724-29746746 GGCCAAGCAGGGGGTGCCTGTGG - Intergenic
1137055780 16:35746187-35746209 GGCCATGGTGGGGGTGCAGGTGG - Intergenic
1138336792 16:56259693-56259715 GGGCAGGGCGGGGGTTCATGTGG + Intronic
1139547927 16:67658346-67658368 GGGTAAGGCCGGGGTTCCTGAGG + Exonic
1139853378 16:69963467-69963489 GCCCATGGCCGTGGTCCCTGTGG - Intronic
1139882347 16:70186376-70186398 GCCCATGGCCGTGGTCCCTGTGG - Intronic
1140370162 16:74409128-74409150 GCCCATGGCCGTGGTCCCTGTGG + Intronic
1140863577 16:79040412-79040434 GGCCATGGTGGTGCATCCTGTGG - Intronic
1142209975 16:88804197-88804219 GGACAGGCCGGGGGATCCTGGGG + Intronic
1142314983 16:89338083-89338105 GGCCATAGTGGGGGCCCCTGGGG - Intronic
1143586946 17:7855071-7855093 GGCCATGGCGGATGTCCCCGGGG + Exonic
1143984171 17:10896822-10896844 GGCCAAGGCGGTGGATCATGAGG + Intergenic
1144047847 17:11469576-11469598 GGGGTTGGCGGGGGTTCCTGTGG + Intronic
1145090021 17:19978283-19978305 GGCCGTGGCGGGTTCTCCTGAGG - Intronic
1146261875 17:31427370-31427392 GGCCATGGCGTGGGTGCTTCGGG + Intronic
1146669726 17:34728668-34728690 TGCCATGACGGGCCTTCCTGGGG - Intergenic
1147486380 17:40818952-40818974 GGCCACGGCGGCAGTTCCAGCGG - Exonic
1147486405 17:40819045-40819067 GGCCACGGCGGCAGTTCCGGCGG - Exonic
1147573768 17:41587162-41587184 GCCCAGTGCGCGGGTTCCTGAGG - Intergenic
1147839652 17:43362206-43362228 GGCCCAGGCGGGGGATCATGAGG - Intergenic
1151575879 17:74952363-74952385 GGCGAGGGACGGGGTTCCTGGGG + Intronic
1151801140 17:76380602-76380624 GGCCAAGGCGGGTGATCATGAGG - Intronic
1151988434 17:77558580-77558602 GGCCATGGTGGGCCGTCCTGAGG - Intergenic
1152093275 17:78258448-78258470 GGACATGGCGAGGATTCCAGAGG + Intergenic
1152097261 17:78279259-78279281 GGCCTTGGGGCAGGTTCCTGGGG + Intergenic
1152592124 17:81218840-81218862 GGGCCTGCCAGGGGTTCCTGTGG + Intronic
1152697911 17:81805583-81805605 GCCCAATGCGGGGGTTCCCGAGG - Intronic
1152756195 17:82088077-82088099 GACCAAGGCGGGGGTAGCTGGGG - Intronic
1153184494 18:2471516-2471538 GGCGATGGCAGGGGTGGCTGGGG - Intergenic
1153800275 18:8662520-8662542 GGCCCTGGGGCGGGTGCCTGGGG + Intergenic
1153822446 18:8843962-8843984 GGCCTTGGTGGGGGTACCTGGGG - Intergenic
1153914784 18:9735543-9735565 GGCCATGGCCGTGGCTCGTGTGG + Intronic
1156461975 18:37326326-37326348 GGCCATGGCCAGGGTCCCAGGGG - Intronic
1158111375 18:53944087-53944109 TCCCATGGCAGGGGCTCCTGTGG + Intergenic
1158473628 18:57760426-57760448 GGCCACAGAGGGGGTTCCTCAGG - Intronic
1159011021 18:63058470-63058492 GGCCTGGGCTGGGGATCCTGAGG + Intergenic
1160328779 18:77973748-77973770 GGCCCTGGCGAGGCTGCCTGGGG + Intergenic
1160447813 18:78941067-78941089 GGCCATGGGGCGGTTTCTTGTGG + Intergenic
1160864649 19:1251325-1251347 GTCCAGGGCGGGGGTTCCACTGG + Intronic
1160944210 19:1633714-1633736 GGCCAGGCAGGGGGCTCCTGTGG + Intronic
1160963702 19:1736351-1736373 GACCCTGGGGGGGCTTCCTGGGG - Intergenic
1160991654 19:1862803-1862825 GGCAGTGGCGGGGGCTCCGGGGG - Intronic
1162022122 19:7872719-7872741 GGCCGGGGACGGGGTTCCTGGGG + Exonic
1162931308 19:13959259-13959281 GGCCAAGGGCGGGGTCCCTGAGG + Exonic
1163167494 19:15508185-15508207 GGCCATGGGGGGTGTTGGTGTGG + Intergenic
1163462692 19:17448457-17448479 GGCCATGGCGGGGGTTCCTGCGG + Exonic
1164727433 19:30475733-30475755 GGCCATGTCTGGGGCTCGTGTGG - Intronic
1165947558 19:39453478-39453500 CTCCATGGCGGGGTTTCTTGGGG - Exonic
1166720377 19:44992850-44992872 GGCTTTGGAGGGGCTTCCTGGGG - Exonic
1166804008 19:45474105-45474127 GGCCAGGGCTGAGGGTCCTGAGG - Exonic
1167052014 19:47085162-47085184 GGCCGTGGCAGGGGCTCCCGAGG - Exonic
1167260724 19:48456213-48456235 GCCCACGGGGGTGGTTCCTGAGG + Exonic
1168297428 19:55384241-55384263 GGCCATGGCGGCGGCGCCAGCGG - Exonic
1168381909 19:55931283-55931305 GGGCAGGGCGGGGGTTGTTGTGG + Intronic
926223002 2:10948575-10948597 GGCCATGGCAGGGATTCAGGGGG + Intergenic
926347150 2:11957726-11957748 GCCCATGGGTGGGGTCCCTGGGG + Intergenic
927854392 2:26518821-26518843 GGCCATGGCTGGAGGCCCTGTGG - Intronic
929155763 2:38787250-38787272 GGGCATGGTGGGTGTGCCTGTGG - Intergenic
929966914 2:46542994-46543016 GGCCGGGGCGGGGGCTCCGGGGG + Exonic
930404644 2:50940240-50940262 GGCCAAGGCGGAGGATCATGAGG + Intronic
932698096 2:73973826-73973848 GGACATGGTGGGTGTGCCTGTGG - Intergenic
934245153 2:90299239-90299261 GGCCATGGGAGAGGTTACTGGGG + Intergenic
934263592 2:91497792-91497814 GGCCATGGGAGAGGTTACTGGGG - Intergenic
934311687 2:91872829-91872851 GGCCAAGGCGGTGGATCATGAGG + Intergenic
934572691 2:95382689-95382711 GGCCAGAGCTGGGGATCCTGAGG + Intronic
935054970 2:99557785-99557807 GGCTGTGCTGGGGGTTCCTGGGG - Intronic
935786684 2:106555384-106555406 GGCCATGGCTGGGTTTCTGGAGG + Intergenic
935868684 2:107420869-107420891 CAGCATGGCTGGGGTTCCTGAGG + Intergenic
937278837 2:120703701-120703723 GGCAATGGCTGGCCTTCCTGGGG - Intergenic
937487347 2:122328705-122328727 TGCCAGGGCATGGGTTCCTGAGG + Intergenic
938455671 2:131460946-131460968 GGCCGGGGCGGGGGCTCCGGGGG + Intergenic
942247886 2:174024115-174024137 GGCCACGGTGATGGTTCCTGCGG + Intergenic
945465981 2:210171194-210171216 GGCCGTGGTGGGGGCTGCTGAGG + Exonic
946326063 2:218985236-218985258 GGGCGTGGCGGGGGTTGCGGGGG + Exonic
948551351 2:238774986-238775008 GACCATGGCAGAGGTCCCTGTGG - Intergenic
948879750 2:240850706-240850728 GGCTCTGACGGGGGTTCCAGTGG - Intergenic
1169773230 20:9224187-9224209 GGCAATGGAGAGGGTCCCTGAGG - Intronic
1172208249 20:33179847-33179869 AGGCATGGCTGGGGTTGCTGGGG + Intronic
1172248198 20:33460575-33460597 GGCCATGGCAGAGATGCCTGTGG + Intergenic
1172277211 20:33686240-33686262 GGCCTTGGCCGGGGCCCCTGCGG - Exonic
1173803821 20:45911447-45911469 GGCCATGGCGAGCGGGCCTGGGG + Exonic
1174945453 20:54980305-54980327 GGCCATGGCAATGGGTCCTGTGG + Intergenic
1175174410 20:57102351-57102373 GGCCATCGCTGGGGCTCCTGAGG + Intergenic
1175281100 20:57804692-57804714 GGCCATGGAGGGTGTTTCTCAGG + Intergenic
1175955190 20:62605456-62605478 GGTCATTGCGGTGGTTTCTGTGG - Intergenic
1176313088 21:5164970-5164992 GGCCATGCTGGGACTTCCTGGGG + Intergenic
1178719534 21:34996171-34996193 GGTCAGGGCGGTGGTTCCTTGGG - Intronic
1179634991 21:42703177-42703199 GCCCAGGGAGGGGGTTGCTGCGG + Intronic
1179843960 21:44097060-44097082 GGCCATGCTGGGACTTCCTGGGG - Intronic
1181645997 22:24232152-24232174 GGCCATGGGAGTGGGTCCTGAGG + Exonic
1182055606 22:27352275-27352297 GGCCATGGAAGGTTTTCCTGTGG - Intergenic
1183634223 22:39051301-39051323 GGCCAAGGCGGGGGATCACGAGG + Intronic
1184522102 22:45000812-45000834 GGGCAGGGGGGTGGTTCCTGTGG + Intronic
1184537366 22:45096286-45096308 GGCCATGGCTTGGGTTTCTATGG - Intergenic
1185216228 22:49601378-49601400 GGCCCTGGGGGCCGTTCCTGGGG - Intronic
1185237924 22:49725396-49725418 GGCCGGGGCGGGGGTTCCCCGGG - Intergenic
950098952 3:10345755-10345777 GGCCAGGGTGAGGCTTCCTGAGG - Intronic
951133665 3:19077932-19077954 TGCCAAGGCGGGGGTTCCACTGG - Intergenic
952439536 3:33311856-33311878 GGCCAAGGCGAGGGATCATGGGG - Intronic
953770531 3:45775972-45775994 GACCACGGCAGGGGATCCTGTGG + Exonic
954468980 3:50675320-50675342 GGCCGTGGCGGGGGTTCTGGGGG + Intronic
958892214 3:99794987-99795009 GGGCATGGGAGGTGTTCCTGGGG + Exonic
961167532 3:124773891-124773913 GGCCATGGCGAGTGTCACTGCGG - Exonic
961822199 3:129580831-129580853 GGCAATTGTGGGGGTCCCTGGGG - Intronic
962978985 3:140470824-140470846 GTCCAGGGCTGGGGTTCCTGGGG - Intronic
964251379 3:154721853-154721875 GGACATGGCGGGATTTCCAGAGG + Intergenic
965535650 3:169821397-169821419 GGCCAAGGCGGGTGGACCTGAGG + Intergenic
967717385 3:192777779-192777801 GGCCAAGGCGGCGGATCATGAGG - Intergenic
968077672 3:195825307-195825329 GACCTTGGCAGGGCTTCCTGAGG - Intergenic
968298914 3:197598745-197598767 GGCCAAGGCGGTGGATCATGAGG - Intergenic
968421208 4:486390-486412 GGCCAAGGCGGGCGGTCATGAGG - Intronic
968472020 4:786715-786737 GGTCAGGGCGGGGGTCCCGGCGG + Intronic
968522295 4:1039504-1039526 AGCCATGGCGGGGGGTCTTCAGG + Intergenic
968735200 4:2291615-2291637 GGACAGGGCTGGGGGTCCTGGGG + Intronic
970123586 4:12784363-12784385 GGCCATGAGGGGGGCCCCTGGGG + Intergenic
971242945 4:24905132-24905154 GGCCACGGCGGTGGATCATGAGG - Intronic
971254547 4:25002237-25002259 GGTCCTGGCGGGGGTTCCTTTGG + Exonic
977415088 4:96722286-96722308 GGCCAGGGGTGGGGTTCCTTTGG + Intergenic
978266419 4:106831643-106831665 GGCCAAGGGTGGTGTTCCTGGGG + Intergenic
981480418 4:145233045-145233067 GGCCAAGGCGGGTGATCATGAGG + Intergenic
981641045 4:146944163-146944185 AGCACTGGCGGAGGTTCCTGTGG - Intronic
981902101 4:149878784-149878806 ATCAATGGCTGGGGTTCCTGAGG - Intergenic
984452072 4:179914733-179914755 GGCCAAGGCAGGGGGTCATGAGG + Intergenic
985789672 5:1918766-1918788 GGTCAGCGCGGGGGTTCCTGGGG + Intergenic
988117108 5:26909216-26909238 GGCCAAGGCGGGCGATCATGAGG - Intronic
992888092 5:81178970-81178992 GGCCAAGGCGGTGGATCATGAGG - Intronic
994103062 5:95915333-95915355 GGCCAAGGCGAGTGTTCATGAGG - Intronic
997856723 5:137379204-137379226 GGCCAAGGAGGGGGTTGCTTGGG - Intronic
1000165025 5:158640029-158640051 GAGGATGGCGGGTGTTCCTGTGG - Intergenic
1002534308 5:179867747-179867769 GGGCATGTCGGGTGTTCCAGTGG + Intronic
1002575231 5:180170554-180170576 GGCCAGGGCGGGGGCTCCGCGGG - Intronic
1002924877 6:1599550-1599572 GGCCATCCCGGGGGTTTCAGAGG + Intergenic
1003086584 6:3065317-3065339 GGCTGTGGCGGGGGTGGCTGGGG + Intronic
1006101375 6:31688204-31688226 GGCCATCTCTGGGGTTCCTGAGG + Intronic
1006163812 6:32053075-32053097 GGCCATGAGTGGGGGTCCTGGGG + Intronic
1007902306 6:45423080-45423102 GGCCCGGCCGGGGGTTTCTGGGG - Intronic
1010063062 6:71646668-71646690 AGCCATGGCTGGGGTGACTGAGG + Intergenic
1010971099 6:82264297-82264319 AGACATGACGGGTGTTCCTGTGG + Intergenic
1011681379 6:89786691-89786713 GGCCAAGGCGGAGGATCATGAGG + Intronic
1014631743 6:123797583-123797605 GGCGATGGCAGGGGTGACTGGGG - Intergenic
1016278035 6:142378358-142378380 GACCCTGGAGGGAGTTCCTGTGG - Intronic
1017823429 6:158064782-158064804 GGCCGTGAGGGGGGTCCCTGGGG - Intronic
1017955582 6:159174855-159174877 GGCCAAGGAGGCAGTTCCTGAGG - Intronic
1019477723 7:1252016-1252038 GGCCCTGGCCTCGGTTCCTGAGG + Intergenic
1019727499 7:2611180-2611202 GGCCTAGGAGGGAGTTCCTGGGG + Exonic
1020062149 7:5160598-5160620 GGCCAAGGCGGGGGATCACGAGG + Intergenic
1020101264 7:5395422-5395444 GGGCATGGCGGGGCTGGCTGTGG - Intronic
1020165995 7:5808079-5808101 GGCCAAGGCGGGGGATCACGAGG - Intergenic
1021125846 7:16850875-16850897 GGCCACTGCGGGGGATCCAGGGG + Intergenic
1022454641 7:30547578-30547600 GCCAATGGCAGGGGTTCATGTGG + Intronic
1023151024 7:37201614-37201636 GGCCAAGACAGGGGTTCTTGGGG - Intronic
1023863572 7:44228645-44228667 TGCCCTGGCGGGGCTTCCTGTGG - Intronic
1026353519 7:69537934-69537956 GGCCATGGCTTGAGTTCCAGTGG - Intergenic
1027387624 7:77674027-77674049 TCTCATGGCGGGGATTCCTGGGG - Intergenic
1030277646 7:107737429-107737451 GGCGATGGCAGGGGTGGCTGGGG - Intergenic
1030382183 7:108824931-108824953 TCCCATGACGGGGCTTCCTGTGG + Intergenic
1031676249 7:124615885-124615907 GGCCTTGGGGGTGGGTCCTGAGG - Intergenic
1034383941 7:150722392-150722414 GGCTATGGTGAGGGGTCCTGAGG + Exonic
1034937496 7:155209495-155209517 GGCCAGGATGGGGGGTCCTGGGG - Intergenic
1035096442 7:156360008-156360030 GTCCTTGGCGTGGGGTCCTGGGG + Intergenic
1035173434 7:157033607-157033629 GTCCAGGGCGGGGCTTCCTGTGG + Intergenic
1035488692 7:159253032-159253054 GGCCATTGAGGAGTTTCCTGAGG - Intergenic
1035924522 8:3712840-3712862 GGCCAGGGCTGGGGGACCTGGGG + Intronic
1038424921 8:27458790-27458812 GTCCATGCAGGGGGCTCCTGGGG + Exonic
1042997797 8:74720082-74720104 GGCCGAGGCGGGGGATCATGAGG - Intronic
1045569081 8:103351342-103351364 CGCTATGGAGGGGATTCCTGGGG + Intergenic
1048181814 8:132202095-132202117 GGTCATGGCTGGGGTGGCTGAGG + Intronic
1048865071 8:138754864-138754886 GGCCATGATGGGGGTTTCTGGGG - Intronic
1048997404 8:139802404-139802426 GGCTATGGGAGGGGTCCCTGGGG + Intronic
1049555300 8:143278599-143278621 GGCCAGGCCGGGGGTTCTGGAGG + Intergenic
1049571705 8:143372870-143372892 GGGGATGGCGTGGGTTCCAGGGG + Intronic
1049571735 8:143372947-143372969 GGGGATGGCGCGGGTTCCAGGGG + Intronic
1049571750 8:143372985-143373007 GGGGATGGCGCGGGTTCCAGGGG + Intronic
1049571765 8:143373023-143373045 GGGGATGGCGTGGGTTCCAGGGG + Intronic
1049571780 8:143373061-143373083 GGGGATGGCGTGGGTTCCAGGGG + Intronic
1049571811 8:143373138-143373160 GGGGATGGCGTGGGTTCCAGGGG + Intronic
1049571826 8:143373177-143373199 GGGGATGGCGTGGGTTCCAGGGG + Intronic
1049571857 8:143373254-143373276 GGGGATGGCGCGGGTTCCAGGGG + Intronic
1049571872 8:143373292-143373314 GGGGATGGCGTGGGTTCCAGGGG + Intronic
1049571887 8:143373330-143373352 GGGGATGGCGCGGGTTCCAGGGG + Intronic
1049571920 8:143373407-143373429 GGGGATGGCGTGGGTTCCAGGGG + Intronic
1049571935 8:143373445-143373467 GGGGATGGCGCGGGTTCCAGGGG + Intronic
1049571950 8:143373483-143373505 GGGGATGGCGCGGGTTCCAGGGG + Intronic
1049571985 8:143373561-143373583 GGGGATGGCGTGGGTTCCAGGGG + Intronic
1049572000 8:143373599-143373621 GGGGATGGCGCGGGTTCCAGGGG + Intronic
1049572032 8:143373676-143373698 GGGGATGGCGCGGGTTCCAGGGG + Intronic
1049572049 8:143373715-143373737 GGGGATGGCGTGGGTTCCAGGGG + Intronic
1049710253 8:144060148-144060170 GCGCATGCGGGGGGTTCCTGAGG + Intronic
1049844170 8:144792124-144792146 GCCCATGGCGACGGGTCCTGGGG + Exonic
1050901886 9:10960423-10960445 GGCAATGACAGGGGTGCCTGGGG - Intergenic
1053136010 9:35650621-35650643 GGTTATGGAGGGGATTCCTGTGG + Exonic
1053177989 9:35943162-35943184 GGCCAGGGAGGGTGTTCCGGGGG + Intergenic
1053188238 9:36037046-36037068 GGCCGTGGCGGGGGTCGCGGAGG + Exonic
1053577641 9:39369069-39369091 GGACATGGTGGGGGCGCCTGTGG + Intergenic
1053842146 9:42197021-42197043 GGACATGGTGGGGGCACCTGTGG + Intergenic
1054099217 9:60927786-60927808 GGACATGGTGGGGGCGCCTGTGG + Intergenic
1054120614 9:61203410-61203432 GGACATGGTGGGGGCGCCTGTGG + Intergenic
1054587134 9:66979146-66979168 GGACATGGTGGGGGAGCCTGTGG - Intergenic
1054987886 9:71283536-71283558 GGCCAAGGCGGGGGATCACGAGG - Intronic
1055554862 9:77463744-77463766 GTCCTTGGTGGGGGTTCCTGGGG - Intronic
1056548102 9:87629608-87629630 GGCCAAGGCGGGGTTGCTTGAGG - Intronic
1057133701 9:92671886-92671908 GGCCAAGGCGGTGGATCATGAGG + Intergenic
1057757811 9:97851980-97852002 GGCCTTGGCGCGGGTTCCAGTGG - Intergenic
1059349392 9:113653894-113653916 GGCCAGGGCAGGGGTGCCAGGGG - Intergenic
1059517962 9:114913386-114913408 GTCCATGGCGAGGGTTCTAGAGG - Intronic
1059769877 9:117414933-117414955 GGCCATGGCGGGAGGGGCTGCGG + Exonic
1059780516 9:117521523-117521545 GGCAATGGGGGTGGTTGCTGGGG + Intergenic
1060722106 9:125986345-125986367 GCCCATGGCAGGGGTCCCTGGGG - Intergenic
1061015075 9:127976831-127976853 GGCCATCTCGGGGGTTCCTGGGG + Intronic
1185736473 X:2500445-2500467 GGCCATGGCCGGGGACCCGGGGG - Intronic
1186181536 X:6977775-6977797 TGCCATGGCGGAGCTTCCTATGG - Intergenic
1186383995 X:9090973-9090995 GGCCATGACAGGGGTGGCTGGGG + Intronic
1187787589 X:22910084-22910106 GGCCAAGGCGGGCGATCATGAGG + Intergenic
1187901162 X:24027873-24027895 GGCCAAGGCGGGCGATCATGAGG - Intergenic
1190129025 X:47730139-47730161 GGTCATTGCAAGGGTTCCTGTGG + Intergenic
1190305438 X:49079227-49079249 GAGGATGGGGGGGGTTCCTGGGG - Intronic
1190718284 X:53123603-53123625 GGCCAAGGAGGGGCTTCCTGAGG - Intergenic
1191014525 X:55794258-55794280 GGAGATGGCAGGGATTCCTGTGG - Intergenic
1191629930 X:63311796-63311818 GGCTATGGCAGGGGTGGCTGGGG + Intergenic
1194878423 X:99219418-99219440 AGCCATGGCTGGGGTGGCTGAGG + Intergenic
1197586405 X:128353467-128353489 GGCCATGCCTGGGGTGACTGAGG - Intergenic
1200119070 X:153781918-153781940 GGGCAGGGCGGGGCTCCCTGAGG + Intronic