ID: 1163462694

View in Genome Browser
Species Human (GRCh38)
Location 19:17448459-17448481
Sequence GCCCGCAGGAACCCCCGCCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 160}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163462694_1163462704 15 Left 1163462694 19:17448459-17448481 CCATGGCGGGGGTTCCTGCGGGC 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1163462704 19:17448497-17448519 GGAATTGAAGTGGTTTTAGAGGG 0: 1
1: 0
2: 1
3: 29
4: 242
1163462694_1163462708 27 Left 1163462694 19:17448459-17448481 CCATGGCGGGGGTTCCTGCGGGC 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1163462708 19:17448509-17448531 GTTTTAGAGGGCAGGGGAGTTGG 0: 1
1: 0
2: 2
3: 28
4: 381
1163462694_1163462709 28 Left 1163462694 19:17448459-17448481 CCATGGCGGGGGTTCCTGCGGGC 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1163462709 19:17448510-17448532 TTTTAGAGGGCAGGGGAGTTGGG 0: 1
1: 0
2: 4
3: 24
4: 265
1163462694_1163462703 14 Left 1163462694 19:17448459-17448481 CCATGGCGGGGGTTCCTGCGGGC 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1163462703 19:17448496-17448518 AGGAATTGAAGTGGTTTTAGAGG 0: 1
1: 0
2: 0
3: 15
4: 202
1163462694_1163462711 30 Left 1163462694 19:17448459-17448481 CCATGGCGGGGGTTCCTGCGGGC 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1163462711 19:17448512-17448534 TTAGAGGGCAGGGGAGTTGGGGG 0: 1
1: 0
2: 2
3: 45
4: 463
1163462694_1163462700 -6 Left 1163462694 19:17448459-17448481 CCATGGCGGGGGTTCCTGCGGGC 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1163462700 19:17448476-17448498 GCGGGCCGGGGGAAGAGTTGAGG 0: 1
1: 0
2: 1
3: 21
4: 255
1163462694_1163462707 21 Left 1163462694 19:17448459-17448481 CCATGGCGGGGGTTCCTGCGGGC 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1163462707 19:17448503-17448525 GAAGTGGTTTTAGAGGGCAGGGG 0: 1
1: 0
2: 0
3: 16
4: 248
1163462694_1163462710 29 Left 1163462694 19:17448459-17448481 CCATGGCGGGGGTTCCTGCGGGC 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1163462710 19:17448511-17448533 TTTAGAGGGCAGGGGAGTTGGGG 0: 1
1: 0
2: 2
3: 28
4: 337
1163462694_1163462705 19 Left 1163462694 19:17448459-17448481 CCATGGCGGGGGTTCCTGCGGGC 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1163462705 19:17448501-17448523 TTGAAGTGGTTTTAGAGGGCAGG 0: 1
1: 0
2: 2
3: 12
4: 138
1163462694_1163462706 20 Left 1163462694 19:17448459-17448481 CCATGGCGGGGGTTCCTGCGGGC 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1163462706 19:17448502-17448524 TGAAGTGGTTTTAGAGGGCAGGG 0: 1
1: 0
2: 0
3: 17
4: 249
1163462694_1163462702 5 Left 1163462694 19:17448459-17448481 CCATGGCGGGGGTTCCTGCGGGC 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1163462702 19:17448487-17448509 GAAGAGTTGAGGAATTGAAGTGG 0: 1
1: 0
2: 3
3: 32
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163462694 Original CRISPR GCCCGCAGGAACCCCCGCCA TGG (reversed) Exonic
900140197 1:1136652-1136674 GCCCGCAGGGACCCAGGGCAGGG - Intergenic
901634806 1:10665524-10665546 GCCTGCAGGCAAGCCCGCCATGG - Exonic
903338249 1:22638891-22638913 GCCCTCTGGAAACCCCGGCAAGG + Exonic
904607182 1:31704282-31704304 GCCCGCAGGAGCCCCCTTCCAGG - Exonic
905762546 1:40572324-40572346 GGCCGCAGGAACCTCTGCCTAGG + Intergenic
907120805 1:52006542-52006564 GCCCGCAGGGACCTCTGCCTAGG + Intergenic
908951669 1:69568662-69568684 CCCCGCAGCACCCTCCGCCACGG - Intronic
909698280 1:78491500-78491522 GCCCGCAGGGAACCCCGCAACGG - Intronic
910936460 1:92486826-92486848 GCCCGCGGGACGCGCCGCCAGGG - Intronic
913058545 1:115183887-115183909 GCATGCAGGAGCACCCGCCAGGG - Intergenic
914301494 1:146381447-146381469 GGCCGCAGGGACCTCTGCCAAGG + Intergenic
914444068 1:147734488-147734510 GTCCGCAGGGACCTCTGCCAAGG - Intergenic
915397955 1:155600184-155600206 GCCCGCAGGGACCTCTGCCTAGG - Intergenic
1063566633 10:7177077-7177099 CCCCCCAGCAACCCCCTCCATGG + Intronic
1071149723 10:82620103-82620125 GGCCGCAGGCACCCCCACCTAGG - Intronic
1072664759 10:97384989-97385011 GCCCTGAGGAACCCCCACCTTGG + Intronic
1072805740 10:98423269-98423291 GACCACAGGAACCCCCCCCCCGG + Intronic
1076789366 10:132768507-132768529 GCACTCGGGACCCCCCGCCAGGG - Intronic
1077142316 11:1030017-1030039 GCCTGCAGGTCCCCCAGCCACGG - Intronic
1077230741 11:1457239-1457261 GCCCTCGGGACTCCCCGCCATGG + Intronic
1083694947 11:64436549-64436571 GGCCCCAGGAACCCCCTCCAGGG - Intergenic
1084223213 11:67697533-67697555 GCCCTGAGGAACCTCTGCCATGG - Intergenic
1084509566 11:69594822-69594844 TCCCCCAGGAACCCACTCCACGG + Intergenic
1084660295 11:70542788-70542810 GCCCATTGGAAACCCCGCCAGGG - Intronic
1085508448 11:77073316-77073338 GCCTGCAGGAACCCCTGACCTGG + Intronic
1088830495 11:113532332-113532354 GCCCCCAGGAACCCCCAGGAAGG - Intergenic
1089198205 11:116707652-116707674 GCCGGCAGGAACCCGCGCGAGGG + Intergenic
1089517078 11:119039916-119039938 GGCCGCAGGGACCCCTGCCTAGG - Intergenic
1091628059 12:2137949-2137971 GCCCGCATGAGCTCCCGGCAGGG - Intronic
1092455077 12:8635955-8635977 GGCCGCAGGGACCTCCGCCTAGG + Intergenic
1092545825 12:9450497-9450519 GCCCGCCGGCGCCCCAGCCATGG - Intergenic
1096993910 12:55827339-55827361 ATCCTCAGGAACCCCAGCCATGG + Exonic
1097053082 12:56235252-56235274 GCCCCCAGGAAGCCCAGCAAGGG - Exonic
1098361153 12:69655578-69655600 GCCCTCAAGAAACCCCCCCAGGG - Exonic
1103764468 12:123271103-123271125 GCCCGCAGCGCCCCCCGCCCGGG + Intronic
1104039874 12:125122759-125122781 GCCCACAGGCAGCCCCTCCAGGG - Intronic
1105016025 12:132787398-132787420 GGCCCCAGGAACCCTCCCCAAGG + Intronic
1105688744 13:22814300-22814322 GCCCGCAGGGACCTCTGCCTAGG - Intergenic
1107086363 13:36431681-36431703 GCCCGCAAGGACCCCCGCGATGG + Intergenic
1113765056 13:112875959-112875981 GCCCTGAGGCACCCCCGCCCCGG - Intronic
1113887204 13:113667223-113667245 GTCCCCAGGAACCCTCGACAGGG + Exonic
1114046725 14:18882001-18882023 GCCCTCAGGATCCCCTGCCTTGG + Intergenic
1114063214 14:19038369-19038391 GCACAGAGGAACCCCCGCCATGG - Intergenic
1114099041 14:19361626-19361648 GCACAGAGGAACCCCCGCCATGG + Intergenic
1114117488 14:19637446-19637468 GCCCTCAGGATCCCCTGCCTTGG - Intergenic
1116433125 14:44869225-44869247 GTCTGCAGGAACCCTCGCCCTGG + Intergenic
1116928545 14:50667794-50667816 ACCCGCCGGCGCCCCCGCCAGGG + Intronic
1122162177 14:99792986-99793008 GCCCGGGGTAACCTCCGCCACGG - Intronic
1122619648 14:103048104-103048126 GCCCGCAGGACACCCGGCCCAGG + Intronic
1122959427 14:105087703-105087725 GCCCGGAGGAGCCCCCGCAGAGG + Intergenic
1123451050 15:20358796-20358818 GACCCCAGGAAGCCCCTCCAGGG - Intergenic
1123493331 15:20799817-20799839 GCACAGAGGGACCCCCGCCATGG + Intergenic
1123549840 15:21368919-21368941 GCACAGAGGGACCCCCGCCATGG + Intergenic
1125722538 15:41852143-41852165 GGCTGCAGGCACCCCCGCCGTGG - Intronic
1129264710 15:74387483-74387505 GCCCGCAGGGCCCCCGGTCAGGG + Intergenic
1129541044 15:76347151-76347173 GCCCGCGGCAGCCCCCGCCTGGG + Intergenic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1131154660 15:90067539-90067561 GCCAGCAGAAGCCCCCGCCGAGG + Exonic
1202958169 15_KI270727v1_random:96137-96159 GCACAGAGGGACCCCCGCCATGG + Intergenic
1132498656 16:275369-275391 GCGCGCACGCACCCCCGCCCCGG + Intronic
1134483319 16:14636786-14636808 GCCCGCAGGGACCTCTGCCTAGG - Intronic
1135429819 16:22374050-22374072 GCCCGCAGGAAGCCTCGGCACGG - Intronic
1138417354 16:56879122-56879144 CCTCGCAGGCACCCCAGCCAGGG - Exonic
1139705533 16:68738090-68738112 GCCCCCAGGAACTCCCGGGAGGG - Intronic
1139851043 16:69951750-69951772 GCCCGGAGGAGCCCCAGACAGGG + Intronic
1139880023 16:70174662-70174684 GCCCGGAGGAGCCCCAGACAGGG + Intronic
1140372488 16:74420855-74420877 GCCCGGAGGAGCCCCAGACAGGG - Intronic
1140850708 16:78932528-78932550 GCCGGCAGGCACACCTGCCAAGG + Intronic
1141430642 16:83968860-83968882 GCCGGCCGGGACCCCCGCCGTGG + Intronic
1141948052 16:87323749-87323771 GCCCAGAGGAGCCCCAGCCAAGG + Intronic
1145303654 17:21657287-21657309 GGCCGCCTGAACCTCCGCCAGGG + Intergenic
1145346390 17:22044562-22044584 GGCCGCCTGAACCTCCGCCAGGG - Intergenic
1147573765 17:41587160-41587182 GCCCTCAGGAACCCGCGCACTGG + Intergenic
1148722552 17:49764067-49764089 GCCCGCTGCGGCCCCCGCCATGG + Exonic
1148820232 17:50355740-50355762 CCCTGCAGGATCCCCAGCCATGG + Intronic
1149849262 17:60025803-60025825 GCCCGGAGCGACCCCCGCCGGGG - Intergenic
1149860906 17:60120721-60120743 GCCCGGAGCGACCCCCGCCGGGG + Intergenic
1151758947 17:76089933-76089955 GCCTGCAGGCGCCCCCGCCGTGG - Intronic
1152379901 17:79937064-79937086 ACCCCCAGCAACCCCCTCCAAGG + Exonic
1152699722 17:81812956-81812978 GCCCGCCGGCTCCCCCGCCCGGG + Intronic
1153244641 18:3061761-3061783 GCCCACAGGAAGCCTCTCCAAGG - Intergenic
1158111378 18:53944089-53944111 ACCCACAGGAGCCCCTGCCATGG - Intergenic
1160716136 19:577678-577700 GCCCACAGGACTCCCAGCCAGGG - Intronic
1160768805 19:821413-821435 GCCCGCAGAGACCCCCGCGCTGG - Intronic
1160812069 19:1017249-1017271 GCCCACAGTAACCCTCCCCAGGG + Intronic
1160963700 19:1736349-1736371 GCCCCCAGGAAGCCCCCCCAGGG + Intergenic
1161219230 19:3110420-3110442 GCCGGCCGGGACCCCCGGCATGG - Intronic
1161470369 19:4454037-4454059 GCCCCCAGGCCGCCCCGCCAGGG - Exonic
1162094994 19:8304993-8305015 GCCCCCTGTAAGCCCCGCCAAGG + Intronic
1163462694 19:17448459-17448481 GCCCGCAGGAACCCCCGCCATGG - Exonic
1163920695 19:20286050-20286072 GCCCGCAGGGATCCCTGCCTAGG + Intergenic
1165227586 19:34365553-34365575 GCCCCCAGGAACGCACTCCAAGG - Intronic
1165947556 19:39453476-39453498 CCCCCCAAGAAACCCCGCCATGG + Exonic
1167893178 19:52558994-52559016 GGCCGCAGGAACCTCTGCCTAGG + Intronic
926937552 2:18101456-18101478 GCCTGCAGCAACCTCCTCCAAGG - Intronic
929208084 2:39321459-39321481 GGCCGCAGGGACCTCCGCCTAGG + Intronic
931665561 2:64607863-64607885 GACCCCTGGAAGCCCCGCCAAGG - Intergenic
933838033 2:86261598-86261620 GCCCGCAGGGACCTCTGCCTAGG + Intronic
933868821 2:86548315-86548337 GGCCGCAGGAACCTCTGCCTAGG - Intronic
938270126 2:129962612-129962634 GGCCGCAGGAACCTCTGCCTAGG - Intergenic
942604541 2:177676538-177676560 CCCCACAGGAAACCCCTCCAGGG + Intronic
943838241 2:192542588-192542610 GCCCGCAGGGACCTCTGCCTAGG - Intergenic
944801101 2:203238853-203238875 GCGCTCAGGAACCCGCGCCCCGG + Intronic
945119615 2:206443917-206443939 GGCCGCAGGAAGCGCCGGCAAGG - Exonic
945451458 2:210000691-210000713 GCGCGCAGGAGCCCACGGCATGG + Intergenic
947119473 2:226800010-226800032 GCCCGCAGGAATCCCCGCGGCGG + Intergenic
948138758 2:235657704-235657726 GCCCACAGGAATCACCACCATGG - Intronic
948551349 2:238774984-238775006 GCCCACAGGGACCTCTGCCATGG + Intergenic
1168914035 20:1471915-1471937 GCCCCAAGGAACCCCCATCAAGG - Intronic
1169349745 20:4858662-4858684 GCCCACAGCAGCCACCGCCAAGG + Intronic
1169924111 20:10765435-10765457 GCCCCCACCAACCCCAGCCATGG + Intergenic
1170714881 20:18823021-18823043 GCCTGCAGGAACACCTCCCAGGG - Intronic
1170892222 20:20385710-20385732 GCCCTGAGGACCCCACGCCAAGG + Intergenic
1171521174 20:25774972-25774994 GGCCGCCTGAACCTCCGCCAGGG + Exonic
1171555750 20:26081506-26081528 GGCCGCCTGAACCTCCGCCAGGG - Intergenic
1172277209 20:33686238-33686260 GCCCGCAGGGGCCCCGGCCAAGG + Exonic
1174898725 20:54476324-54476346 TCCGGCAGGCACCCCCGCCCGGG - Intronic
1175228985 20:57461617-57461639 GCCCTGAGGTGCCCCCGCCATGG + Intergenic
1175790674 20:61738152-61738174 GTCTGCAGCAACCACCGCCAGGG + Intronic
1176520351 21:7819510-7819532 GCCCGCAGGTCCCCCCGCAGCGG - Exonic
1178113340 21:29392318-29392340 GCCCGCAGGGACCTCTGCCTAGG - Intronic
1178799455 21:35778971-35778993 GCCAGAAGGTACCCTCGCCATGG + Intronic
1179634994 21:42703179-42703201 ACCCGCAGCAACCCCCTCCCTGG - Intronic
1179719762 21:43308373-43308395 GCCCGGAAGGACCCCCGCCCAGG + Intergenic
1179809983 21:43864690-43864712 GCCCGCAGGAGACCCCGGCAGGG + Intergenic
1179878488 21:44283500-44283522 GGCCGCAGGGACCCCTGCCTAGG - Intergenic
1180465263 22:15604640-15604662 GCCCTCAGGATCCCCTGCCTTGG + Intergenic
1180481706 22:15760998-15761020 GCACAGAGGAACCCCCGCCATGG - Intergenic
1183699835 22:39445030-39445052 GCCAGCAGCAACACGCGCCAGGG + Intergenic
950506329 3:13397102-13397124 GCCCTCAGGAACCCCTGCAGTGG - Intronic
953059959 3:39418946-39418968 GGCCGCAGGGACCCCTGCCTAGG - Intergenic
954468981 3:50675322-50675344 GTCCCCCAGAACCCCCGCCACGG - Intronic
962978983 3:140470822-140470844 CCCCCCAGGAACCCCAGCCCTGG + Intronic
963511117 3:146250849-146250871 GCCCGCAGGCACCGCGGCCTCGG + Intronic
968003643 3:195224746-195224768 GCTTGCAGGAATCCCCGCTAGGG - Intronic
968077670 3:195825305-195825327 CCCCTCAGGAAGCCCTGCCAAGG + Intergenic
968522297 4:1039506-1039528 GCCCTGAAGACCCCCCGCCATGG - Intergenic
968589144 4:1449087-1449109 GTCCCCAGGAGCCCCAGCCAGGG + Intergenic
969842668 4:9893738-9893760 GCCAGGAGGGACCCCCGCAAAGG + Intronic
971266102 4:25097213-25097235 GCCCTCTGTAACCCACGCCATGG + Intergenic
973808259 4:54546121-54546143 GCCCACAGGAACCCCAGACCAGG - Intergenic
984639188 4:182144308-182144330 GCCCGCGGGACGCCCGGCCAGGG - Intronic
992561612 5:77958084-77958106 GCTCGCGGGAACCCCCACCTCGG + Intergenic
992962671 5:81971867-81971889 GCCCGCGACCACCCCCGCCAAGG - Intergenic
1001265131 5:170268596-170268618 GCCCACATGAGCCCCAGCCACGG + Intronic
1002482821 5:179514610-179514632 GCCCGCAGGGACCTCTGCCTAGG - Intergenic
1003175520 6:3750678-3750700 GCCCCCCCGCACCCCCGCCAGGG - Intronic
1006101377 6:31688206-31688228 GCCCTCAGGAACCCCAGAGATGG - Intronic
1017018276 6:150118696-150118718 GCCCGCAGGGCCCCCAGGCAGGG - Intergenic
1023863570 7:44228643-44228665 GCCCACAGGAAGCCCCGCCAGGG + Intronic
1024634588 7:51276643-51276665 GCCCGCAGTAAACACTGCCAGGG + Intronic
1025281653 7:57629915-57629937 GACCGCCTGAACCTCCGCCAGGG + Intergenic
1025303077 7:57835600-57835622 GACCGCCTGAACCTCCGCCAGGG - Intergenic
1026153139 7:67804777-67804799 GCCCAAAGGAACCTCAGCCAGGG - Intergenic
1026772230 7:73209813-73209835 TCCCGCAGGACCTCCCTCCAGGG - Intergenic
1027013099 7:74763206-74763228 TCCCGCAGGACCTCCCTCCAGGG - Intergenic
1027074942 7:75182828-75182850 TCCCGCAGGACCTCCCTCCAGGG + Intergenic
1034441288 7:151087163-151087185 GCGCGCAAGGACCCCCGACAGGG - Intronic
1035173435 7:157033609-157033631 GGCCACAGGAAGCCCCGCCCTGG - Intergenic
1039873642 8:41567495-41567517 CCCCGCAGGAAGCCCCTACAGGG - Intergenic
1040537479 8:48322714-48322736 GCCGCCAGGGACCCCCGCCATGG - Intergenic
1048472000 8:134712468-134712490 GCAAGAAGGAAGCCCCGCCAAGG + Intronic
1049549811 8:143251975-143251997 GCACTCAGGACCCCCTGCCATGG - Intronic
1049678157 8:143902696-143902718 GCCCGCAGCAGCCGCCGCCGTGG + Intergenic
1049844173 8:144792126-144792148 GCCCCCAGGACCCGTCGCCATGG - Exonic
1051774688 9:20621462-20621484 GCCCGCAGGAAAACACGCCGAGG + Intronic
1051893637 9:21967329-21967351 GCCCTCTGGAACCCCAGCCTGGG + Exonic
1053527016 9:38840526-38840548 GCACGCAGGAGCACCCTCCAGGG + Intergenic
1054199242 9:62064957-62064979 GCACGCAGGAGCACCCTCCAGGG + Intergenic
1054639114 9:67523400-67523422 GCACGCAGGAGCACCCTCCAGGG - Intergenic
1055554861 9:77463742-77463764 TACCCCAGGAACCCCCACCAAGG + Intronic
1055757852 9:79573456-79573478 GCCCGCAGGCCCCCGCGCCCCGG - Intronic
1061015077 9:127976833-127976855 ACCCCCAGGAACCCCCGAGATGG - Intronic
1061961779 9:133992371-133992393 GCCCGCGCGAAGCCCCGCCCCGG - Intronic
1202029096 Y:20553122-20553144 GGCCGCAGGAACCTCTGCCTAGG + Intergenic