ID: 1163466829

View in Genome Browser
Species Human (GRCh38)
Location 19:17472784-17472806
Sequence GCCTGTAATCCCAGCACTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163466829_1163466830 -5 Left 1163466829 19:17472784-17472806 CCTAAAGTGCTGGGATTACAGGC No data
Right 1163466830 19:17472802-17472824 CAGGCATGAGCCACCATGCCTGG No data
1163466829_1163466834 16 Left 1163466829 19:17472784-17472806 CCTAAAGTGCTGGGATTACAGGC No data
Right 1163466834 19:17472823-17472845 GGCTCCCTTTTTTTTGAGACAGG No data
1163466829_1163466835 17 Left 1163466829 19:17472784-17472806 CCTAAAGTGCTGGGATTACAGGC No data
Right 1163466835 19:17472824-17472846 GCTCCCTTTTTTTTGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163466829 Original CRISPR GCCTGTAATCCCAGCACTTT AGG (reversed) Intronic