ID: 1163466830

View in Genome Browser
Species Human (GRCh38)
Location 19:17472802-17472824
Sequence CAGGCATGAGCCACCATGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163466823_1163466830 8 Left 1163466823 19:17472771-17472793 CCTGCCTTGGCCTCCTAAAGTGC No data
Right 1163466830 19:17472802-17472824 CAGGCATGAGCCACCATGCCTGG No data
1163466825_1163466830 4 Left 1163466825 19:17472775-17472797 CCTTGGCCTCCTAAAGTGCTGGG No data
Right 1163466830 19:17472802-17472824 CAGGCATGAGCCACCATGCCTGG No data
1163466820_1163466830 27 Left 1163466820 19:17472752-17472774 CCTGACATCACGTAGTCCGCCTG No data
Right 1163466830 19:17472802-17472824 CAGGCATGAGCCACCATGCCTGG No data
1163466827_1163466830 -2 Left 1163466827 19:17472781-17472803 CCTCCTAAAGTGCTGGGATTACA No data
Right 1163466830 19:17472802-17472824 CAGGCATGAGCCACCATGCCTGG No data
1163466829_1163466830 -5 Left 1163466829 19:17472784-17472806 CCTAAAGTGCTGGGATTACAGGC No data
Right 1163466830 19:17472802-17472824 CAGGCATGAGCCACCATGCCTGG No data
1163466822_1163466830 11 Left 1163466822 19:17472768-17472790 CCGCCTGCCTTGGCCTCCTAAAG No data
Right 1163466830 19:17472802-17472824 CAGGCATGAGCCACCATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163466830 Original CRISPR CAGGCATGAGCCACCATGCC TGG Intronic