ID: 1163468455

View in Genome Browser
Species Human (GRCh38)
Location 19:17483376-17483398
Sequence GAGGGAGGCAATGAGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163468451_1163468455 -8 Left 1163468451 19:17483361-17483383 CCTGGAAGGTTTCCTGAGGGAGG 0: 1
1: 0
2: 19
3: 103
4: 513
Right 1163468455 19:17483376-17483398 GAGGGAGGCAATGAGGCTGCTGG No data
1163468448_1163468455 2 Left 1163468448 19:17483351-17483373 CCATGTGGTGCCTGGAAGGTTTC 0: 1
1: 0
2: 0
3: 12
4: 146
Right 1163468455 19:17483376-17483398 GAGGGAGGCAATGAGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163468455 Original CRISPR GAGGGAGGCAATGAGGCTGC TGG Intronic
No off target data available for this crispr