ID: 1163469215

View in Genome Browser
Species Human (GRCh38)
Location 19:17487036-17487058
Sequence GCCTCGGAAGGCGGCCGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163469201_1163469215 20 Left 1163469201 19:17486993-17487015 CCAGGACTGGCCCCTGGGCGGGC 0: 1
1: 0
2: 2
3: 25
4: 310
Right 1163469215 19:17487036-17487058 GCCTCGGAAGGCGGCCGCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 126
1163469207_1163469215 8 Left 1163469207 19:17487005-17487027 CCTGGGCGGGCGGGGAGATGCTG 0: 1
1: 0
2: 4
3: 24
4: 233
Right 1163469215 19:17487036-17487058 GCCTCGGAAGGCGGCCGCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 126
1163469206_1163469215 9 Left 1163469206 19:17487004-17487026 CCCTGGGCGGGCGGGGAGATGCT 0: 1
1: 0
2: 1
3: 12
4: 132
Right 1163469215 19:17487036-17487058 GCCTCGGAAGGCGGCCGCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 126
1163469199_1163469215 21 Left 1163469199 19:17486992-17487014 CCCAGGACTGGCCCCTGGGCGGG 0: 1
1: 0
2: 2
3: 17
4: 286
Right 1163469215 19:17487036-17487058 GCCTCGGAAGGCGGCCGCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 126
1163469205_1163469215 10 Left 1163469205 19:17487003-17487025 CCCCTGGGCGGGCGGGGAGATGC 0: 1
1: 0
2: 0
3: 11
4: 137
Right 1163469215 19:17487036-17487058 GCCTCGGAAGGCGGCCGCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163469215 Original CRISPR GCCTCGGAAGGCGGCCGCCC TGG Intronic
900171429 1:1271000-1271022 GCCTCTGAAGGCGGTGGCTCTGG - Intronic
900242153 1:1622198-1622220 GCCAGGGAAGGAGGCAGCCCAGG - Intronic
900611616 1:3546784-3546806 GCCTGGGAAGGGGGCTGCCAGGG + Intronic
901206111 1:7496810-7496832 GCCAGGGAAGGAGGCCTCCCAGG + Intronic
901361333 1:8703298-8703320 GGCTAGGGAGGCGGCCGCCCTGG + Intronic
901685304 1:10940465-10940487 GCCTGGGAAGGCGGTGGCCTAGG - Intergenic
902238698 1:15074188-15074210 GCCTCAGAAGGCGGTCGGCAAGG + Intronic
903323204 1:22554696-22554718 GGCTGGGAAGGCGGCCGCGGTGG + Intergenic
904591453 1:31617744-31617766 GCCTAGGGAGGGGGCTGCCCCGG + Exonic
905995859 1:42380482-42380504 GCCTCACAGGGCCGCCGCCCCGG + Intergenic
910450102 1:87335394-87335416 GCCTCGGGCGGCGCCGGCCCGGG - Intronic
912710784 1:111948398-111948420 GCGTAGGGAGGCGGCAGCCCTGG + Intronic
924602998 1:245507715-245507737 GGCTGGGAAGGCTGCCTCCCGGG - Intronic
1063383899 10:5603989-5604011 GAACCGGATGGCGGCCGCCCGGG + Intergenic
1063929806 10:11017893-11017915 CGCTCGGCAGCCGGCCGCCCCGG + Intronic
1064093039 10:12401611-12401633 GCCTCAGAAGGGGGCCGTCAGGG + Intronic
1067077205 10:43194947-43194969 GCCTGGGGAGGAGGCAGCCCTGG - Exonic
1067083745 10:43227554-43227576 GCCTGGGAAGGCTGGGGCCCAGG + Intronic
1071545017 10:86522167-86522189 GCCTGCGGAGGCCGCCGCCCGGG + Intergenic
1074923804 10:118046775-118046797 GGCGGGGAACGCGGCCGCCCCGG + Intergenic
1075369990 10:121927800-121927822 GCGTGGGAAGCCGGGCGCCCGGG - Intronic
1076750107 10:132538099-132538121 GGCGGGGAAGGCGGCCGCCCCGG + Exonic
1081699968 11:45146777-45146799 GCCTCGGCTGGCGGCCCCCGCGG - Intronic
1081766069 11:45610888-45610910 GCCTCGGATGACTGCAGCCCTGG + Intergenic
1083610082 11:64000373-64000395 GCCTGGCAAGGCTGCGGCCCCGG + Intronic
1085396436 11:76209255-76209277 GGCCCGGGAGGCGGCCGCCTGGG + Intronic
1090860582 11:130648969-130648991 GCCTAGGAAGGAGGCCCCTCAGG - Intergenic
1092002597 12:5044409-5044431 TCCTCGGGAGGCGGCCGTCGAGG - Exonic
1092062597 12:5563612-5563634 GCCTGGGGAGGTGGCGGCCCTGG + Intronic
1096674928 12:53221228-53221250 GACTCGGAGGGAGGCGGCCCGGG - Intronic
1102026013 12:109714645-109714667 GCCCCGGACGGGGGCCGCGCGGG - Exonic
1105022793 12:132828605-132828627 GCAGCTGAAGGCGGGCGCCCAGG + Exonic
1106229372 13:27809916-27809938 GCCTCTGAAGGACGCCGCCATGG - Intergenic
1106476978 13:30107529-30107551 CCCTGGGAAGGGGGCCGCCATGG - Intergenic
1113739656 13:112702445-112702467 GCCTCGGAAGGCGTGCACACGGG + Intronic
1114270791 14:21098609-21098631 GCCGCGAGAGGCGGCCGCCAGGG + Exonic
1122018320 14:98816230-98816252 GACTCGCAAGGCTCCCGCCCTGG + Intergenic
1122558005 14:102591979-102592001 GCCAGGGGAGGCGGCCGCCTGGG + Intergenic
1131032729 15:89199974-89199996 GCCTCGGAACGCTGCAGCCCAGG + Exonic
1132560261 16:590251-590273 GCTTCGGCAGGCGGCCGGCGCGG + Exonic
1133634655 16:7653842-7653864 CCCTCGGTAGGCGGCCGCGGCGG - Exonic
1133916081 16:10111328-10111350 GCAGCGGCAGGCGGCCGCGCGGG + Intronic
1134290834 16:12901999-12902021 GCCTCGAGAGGCGGCCGCAGAGG + Exonic
1136705896 16:32187970-32187992 GCCTCCGACGCCGGACGCCCCGG + Intergenic
1136762016 16:32741435-32741457 GCCTCCGACGCCGGACGCCCCGG - Intergenic
1136806084 16:33128953-33128975 GCCTCCGACGCCGGACGCCCCGG + Intergenic
1137381223 16:48001545-48001567 GCCTTGGATGGAGGCCTCCCAGG + Intergenic
1137531610 16:49281894-49281916 GCCTCGGAGGGAGGCGGGCCGGG - Intergenic
1140442884 16:75000117-75000139 GCCTCGGAGGGAGGGCGCGCCGG + Intronic
1141674257 16:85509311-85509333 GCCTCTGAAGACCGCAGCCCCGG - Intergenic
1141925989 16:87169990-87170012 CCCTCGGAGGGCTGCAGCCCAGG - Intronic
1142212229 16:88813612-88813634 GCCTCTGGAGGAGGCCGGCCGGG + Intergenic
1142305050 16:89280164-89280186 GCCGGCGAAGGCGTCCGCCCAGG + Exonic
1203064175 16_KI270728v1_random:1001751-1001773 GCCTCCGACGCCGGACGCCCCGG - Intergenic
1143030435 17:3964379-3964401 GCCTCGCGCGGCGCCCGCCCGGG - Intronic
1144574988 17:16423731-16423753 GCCTCTGAAGCTGGCCGCCAAGG + Exonic
1146063343 17:29618296-29618318 CCCTGGGAGGGCGGCGGCCCTGG - Intronic
1146492393 17:33292294-33292316 GCCTCCGCGGGCGCCCGCCCGGG + Exonic
1147139526 17:38453617-38453639 GCCGCGGACAGGGGCCGCCCCGG + Intronic
1147768366 17:42851652-42851674 GCCTCCCAAGGCTGCAGCCCTGG + Exonic
1147770956 17:42867584-42867606 GCCTCCCAAGGCTGCAGCCCTGG + Intergenic
1148084953 17:44988226-44988248 GCCTGGGATGGGGGCTGCCCTGG - Intergenic
1148445297 17:47733696-47733718 GCCGGGGAAGCCGGCCGCCTGGG - Exonic
1150267838 17:63842492-63842514 GGGGCGGAAGGCGGCGGCCCCGG + Exonic
1152468277 17:80477418-80477440 GCTTCGGAAGGGGGCCCCGCGGG + Intronic
1152617841 17:81346040-81346062 GCCCCGGAGGGCGGCGGCCGCGG - Intergenic
1157529769 18:48410376-48410398 GCTTCGGAAGGCCGCCTTCCAGG - Intronic
1161102394 19:2427587-2427609 GCGCCGGAAGCGGGCCGCCCGGG + Exonic
1161222087 19:3122475-3122497 GCCCCGGGAGGCGGCCCCCGGGG - Exonic
1161276527 19:3421348-3421370 GCCTGGGCAGCCGGCCGTCCGGG - Intronic
1161290601 19:3491713-3491735 GCCCCAGCTGGCGGCCGCCCTGG - Exonic
1162861135 19:13506409-13506431 GGCTCAGAAGGCGGCTGCCCGGG + Intronic
1163469215 19:17487036-17487058 GCCTCGGAAGGCGGCCGCCCTGG + Intronic
1168145072 19:54415978-54416000 GCCTGGGAAGCCGGCCTCCAGGG + Intronic
1168275832 19:55277802-55277824 GCCTCGGAAGGCAGCCGACATGG + Exonic
932006921 2:67936725-67936747 CCCTCGGAAGGAAGCCGGCCTGG - Intergenic
932329171 2:70887884-70887906 GCCGCGGAAGCCGGCAGCGCGGG - Intergenic
937953875 2:127408386-127408408 GCATGGGAGGACGGCCGCCCCGG + Intergenic
938451546 2:131425335-131425357 GCCTCGGCAGGCGGCGGCGGCGG - Intergenic
946235740 2:218323459-218323481 GGCTCGGGAGGCGGGCGCGCTGG + Intronic
946921290 2:224584754-224584776 GCCCGGGAGGGCGGCCGCGCCGG + Intronic
947593214 2:231396351-231396373 GCCTCGGTGGGCGGCTTCCCTGG + Intronic
947623456 2:231605004-231605026 GCCCCGGAAGGCTGCGGGCCCGG + Intergenic
1169075658 20:2758636-2758658 CCCTCTGAAGGAGGCCACCCTGG + Intronic
1169251368 20:4063756-4063778 GCCTTGGCAGACGGCAGCCCAGG + Intergenic
1170945600 20:20888460-20888482 CCCCCGGAAAGCGGCCGCGCAGG + Intergenic
1171256598 20:23693298-23693320 GCCTCTGCAGGCTGCAGCCCAGG - Intergenic
1173576468 20:44115694-44115716 GGCGCGGAAGGAGGCCGCACTGG - Exonic
1174287672 20:49483944-49483966 GCCCCAGGAGGCGGCCGCCCTGG - Intergenic
1175428979 20:58889723-58889745 GCCGCGGAGCGCGGCTGCCCGGG - Intronic
1184034119 22:41910510-41910532 GCCCCGGGGGTCGGCCGCCCCGG - Exonic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
970332817 4:15002986-15003008 GCCCCCGAAAGCGGCCGCGCCGG - Exonic
982357890 4:154490058-154490080 GTCTCTGAAGGCGCCCGACCGGG - Intronic
985671108 5:1207105-1207127 GCCTCGGAAGCCGGGCGCCACGG + Intronic
985683721 5:1270950-1270972 GCCTCGGGAGCCTGCAGCCCAGG + Intronic
989206078 5:38809941-38809963 CTCACAGAAGGCGGCCGCCCGGG + Intergenic
990937124 5:61162677-61162699 GCCTGGAAAGGAGCCCGCCCGGG - Intergenic
993716558 5:91280653-91280675 GCCCCGGGCTGCGGCCGCCCAGG - Intergenic
993915687 5:93741259-93741281 CCCTCCGAAGGCGCCCTCCCGGG - Exonic
994403552 5:99314820-99314842 GCCTCAGAAGACTGCAGCCCTGG - Intergenic
996329354 5:122312059-122312081 GCTTCGGGCCGCGGCCGCCCAGG + Exonic
997302195 5:132814054-132814076 GGCTCGGAGGCCGGCCCCCCCGG - Exonic
998176277 5:139904065-139904087 GCGTGGGGACGCGGCCGCCCGGG + Intronic
1003108204 6:3231363-3231385 GCCTGGGAAGCCAGCGGCCCCGG + Intronic
1006028553 6:31162665-31162687 GCATCGGAAGTCGGCCTCCCTGG - Exonic
1007783149 6:44265455-44265477 GCCCGGGAAGGAGGCCGCCGCGG - Exonic
1010209956 6:73354588-73354610 ACCTCGGAAAGCGGGCGTCCAGG + Intergenic
1011603458 6:89080933-89080955 GCGGCGCAAGGCGGCCACCCAGG - Exonic
1014632504 6:123803790-123803812 GCGTCGGGCGGCGGCCGCGCTGG + Intergenic
1019492335 7:1321313-1321335 GCCTGGGGAGGGGGCCTCCCTGG + Intergenic
1019720467 7:2567522-2567544 GCTTGGGATGGCGGCTGCCCAGG - Intronic
1023000370 7:35801633-35801655 GCCGCGGAAGCCGGCGGGCCCGG - Intronic
1024579773 7:50792788-50792810 GCCTGGGAGGGTGGGCGCCCAGG - Intronic
1033406144 7:141073115-141073137 GCCCCGGGAGCCTGCCGCCCAGG - Intergenic
1034824838 7:154252353-154252375 GCCTGGGAAGGCAGCTCCCCTGG - Intronic
1035260532 7:157659045-157659067 GCCAAGGAAGCCGGCAGCCCGGG - Intronic
1035288120 7:157819159-157819181 GCTTCCGAAGGGGGCTGCCCAGG - Intronic
1037913098 8:22756145-22756167 GCCTCGCAAGGCTGTCGCTCTGG - Intronic
1040928905 8:52714212-52714234 GCCGCGGCGGGCGGGCGCCCGGG - Exonic
1042174558 8:66026550-66026572 GCCTTGGCAGGCGGCCACACTGG + Intronic
1047235983 8:123042285-123042307 GCCTCAGAAGGCTGCCTCGCTGG - Exonic
1047369774 8:124246761-124246783 GCCTAGCAAGGCAGCTGCCCAGG + Intergenic
1048999140 8:139813661-139813683 GCCTCGGAAAGCTGGTGCCCAGG + Intronic
1049271504 8:141698594-141698616 GCCTCTGCAGCCGGCAGCCCTGG - Intergenic
1057546315 9:96022049-96022071 GCCTCCGAAGCCGGCGCCCCCGG + Intergenic
1059471117 9:114505377-114505399 GCCCCGGGATGCAGCCGCCCGGG + Intronic
1061128247 9:128689848-128689870 GCCTCGCAGCGCGGCCGCCGCGG - Intronic
1061991268 9:134160016-134160038 GGGTGGGAGGGCGGCCGCCCTGG + Intergenic
1062363916 9:136199963-136199985 GCCTGGGAAGGCGGCCCCGGAGG + Intronic
1062589200 9:137265857-137265879 TCCCTGGAAGGAGGCCGCCCTGG - Exonic
1189534503 X:41923157-41923179 TCCTCTGCAGGCGACCGCCCCGG + Intronic
1190246964 X:48696997-48697019 GCCTCGGAACGCAGCGGGCCTGG + Intronic
1199317174 X:146394815-146394837 GAGTCAGAAGGCGGACGCCCGGG + Intergenic
1201178085 Y:11322013-11322035 GCCTGGTAGGGCGCCCGCCCAGG + Intergenic