ID: 1163471140

View in Genome Browser
Species Human (GRCh38)
Location 19:17497579-17497601
Sequence ACCCCGCCCTGCGTGCGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 104}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163471140_1163471144 -6 Left 1163471140 19:17497579-17497601 CCAAGGCGCACGCAGGGCGGGGT 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1163471144 19:17497596-17497618 CGGGGTGTAAGGGGAGTTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 95
1163471140_1163471149 18 Left 1163471140 19:17497579-17497601 CCAAGGCGCACGCAGGGCGGGGT 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1163471149 19:17497620-17497642 ACTCCCGGTGCACCACCAGAGGG 0: 1
1: 0
2: 0
3: 2
4: 56
1163471140_1163471145 -5 Left 1163471140 19:17497579-17497601 CCAAGGCGCACGCAGGGCGGGGT 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1163471145 19:17497597-17497619 GGGGTGTAAGGGGAGTTCCTGGG 0: 1
1: 0
2: 3
3: 15
4: 158
1163471140_1163471148 17 Left 1163471140 19:17497579-17497601 CCAAGGCGCACGCAGGGCGGGGT 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1163471148 19:17497619-17497641 GACTCCCGGTGCACCACCAGAGG 0: 1
1: 0
2: 0
3: 4
4: 72
1163471140_1163471146 3 Left 1163471140 19:17497579-17497601 CCAAGGCGCACGCAGGGCGGGGT 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1163471146 19:17497605-17497627 AGGGGAGTTCCTGGGACTCCCGG 0: 1
1: 0
2: 2
3: 29
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163471140 Original CRISPR ACCCCGCCCTGCGTGCGCCT TGG (reversed) Intronic