ID: 1163472301

View in Genome Browser
Species Human (GRCh38)
Location 19:17504725-17504747
Sequence AGTCCAGGATGGGCCGTGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163472301_1163472309 23 Left 1163472301 19:17504725-17504747 CCTGGCACGGCCCATCCTGGACT 0: 1
1: 0
2: 0
3: 16
4: 181
Right 1163472309 19:17504771-17504793 CCCGTGCCTCTCTGCTGCCTTGG 0: 1
1: 0
2: 2
3: 36
4: 299
1163472301_1163472306 -2 Left 1163472301 19:17504725-17504747 CCTGGCACGGCCCATCCTGGACT 0: 1
1: 0
2: 0
3: 16
4: 181
Right 1163472306 19:17504746-17504768 CTGAGAAACTGGAACCTCAGAGG 0: 1
1: 0
2: 2
3: 46
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163472301 Original CRISPR AGTCCAGGATGGGCCGTGCC AGG (reversed) Exonic