ID: 1163472302

View in Genome Browser
Species Human (GRCh38)
Location 19:17504735-17504757
Sequence CCAGTTTCTCAGTCCAGGAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163472302_1163472309 13 Left 1163472302 19:17504735-17504757 CCCATCCTGGACTGAGAAACTGG 0: 1
1: 0
2: 0
3: 7
4: 157
Right 1163472309 19:17504771-17504793 CCCGTGCCTCTCTGCTGCCTTGG 0: 1
1: 0
2: 2
3: 36
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163472302 Original CRISPR CCAGTTTCTCAGTCCAGGAT GGG (reversed) Exonic