ID: 1163472304

View in Genome Browser
Species Human (GRCh38)
Location 19:17504736-17504758
Sequence TCCAGTTTCTCAGTCCAGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 258}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163472304_1163472309 12 Left 1163472304 19:17504736-17504758 CCATCCTGGACTGAGAAACTGGA 0: 1
1: 0
2: 1
3: 23
4: 258
Right 1163472309 19:17504771-17504793 CCCGTGCCTCTCTGCTGCCTTGG 0: 1
1: 0
2: 2
3: 36
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163472304 Original CRISPR TCCAGTTTCTCAGTCCAGGA TGG (reversed) Exonic