ID: 1163472309

View in Genome Browser
Species Human (GRCh38)
Location 19:17504771-17504793
Sequence CCCGTGCCTCTCTGCTGCCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 299}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163472304_1163472309 12 Left 1163472304 19:17504736-17504758 CCATCCTGGACTGAGAAACTGGA 0: 1
1: 0
2: 1
3: 23
4: 258
Right 1163472309 19:17504771-17504793 CCCGTGCCTCTCTGCTGCCTTGG 0: 1
1: 0
2: 2
3: 36
4: 299
1163472305_1163472309 8 Left 1163472305 19:17504740-17504762 CCTGGACTGAGAAACTGGAACCT 0: 1
1: 0
2: 1
3: 15
4: 151
Right 1163472309 19:17504771-17504793 CCCGTGCCTCTCTGCTGCCTTGG 0: 1
1: 0
2: 2
3: 36
4: 299
1163472302_1163472309 13 Left 1163472302 19:17504735-17504757 CCCATCCTGGACTGAGAAACTGG 0: 1
1: 0
2: 0
3: 7
4: 157
Right 1163472309 19:17504771-17504793 CCCGTGCCTCTCTGCTGCCTTGG 0: 1
1: 0
2: 2
3: 36
4: 299
1163472301_1163472309 23 Left 1163472301 19:17504725-17504747 CCTGGCACGGCCCATCCTGGACT 0: 1
1: 0
2: 0
3: 16
4: 181
Right 1163472309 19:17504771-17504793 CCCGTGCCTCTCTGCTGCCTTGG 0: 1
1: 0
2: 2
3: 36
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163472309 Original CRISPR CCCGTGCCTCTCTGCTGCCT TGG Exonic