ID: 1163476390

View in Genome Browser
Species Human (GRCh38)
Location 19:17528534-17528556
Sequence CAGGCCCCTCGGTAGGACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 160}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163476376_1163476390 23 Left 1163476376 19:17528488-17528510 CCCAGCCAGGCCCTGAGGGATGT 0: 1
1: 0
2: 4
3: 49
4: 294
Right 1163476390 19:17528534-17528556 CAGGCCCCTCGGTAGGACCCTGG 0: 1
1: 0
2: 2
3: 18
4: 160
1163476372_1163476390 29 Left 1163476372 19:17528482-17528504 CCCAGACCCAGCCAGGCCCTGAG 0: 1
1: 0
2: 0
3: 66
4: 561
Right 1163476390 19:17528534-17528556 CAGGCCCCTCGGTAGGACCCTGG 0: 1
1: 0
2: 2
3: 18
4: 160
1163476380_1163476390 12 Left 1163476380 19:17528499-17528521 CCTGAGGGATGTCTTCCTGAGCG 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1163476390 19:17528534-17528556 CAGGCCCCTCGGTAGGACCCTGG 0: 1
1: 0
2: 2
3: 18
4: 160
1163476377_1163476390 22 Left 1163476377 19:17528489-17528511 CCAGCCAGGCCCTGAGGGATGTC 0: 1
1: 0
2: 3
3: 44
4: 262
Right 1163476390 19:17528534-17528556 CAGGCCCCTCGGTAGGACCCTGG 0: 1
1: 0
2: 2
3: 18
4: 160
1163476373_1163476390 28 Left 1163476373 19:17528483-17528505 CCAGACCCAGCCAGGCCCTGAGG 0: 1
1: 1
2: 3
3: 65
4: 545
Right 1163476390 19:17528534-17528556 CAGGCCCCTCGGTAGGACCCTGG 0: 1
1: 0
2: 2
3: 18
4: 160
1163476378_1163476390 18 Left 1163476378 19:17528493-17528515 CCAGGCCCTGAGGGATGTCTTCC 0: 1
1: 0
2: 2
3: 30
4: 227
Right 1163476390 19:17528534-17528556 CAGGCCCCTCGGTAGGACCCTGG 0: 1
1: 0
2: 2
3: 18
4: 160
1163476385_1163476390 -3 Left 1163476385 19:17528514-17528536 CCTGAGCGGGCAGGGACCAGCAG 0: 1
1: 0
2: 1
3: 19
4: 243
Right 1163476390 19:17528534-17528556 CAGGCCCCTCGGTAGGACCCTGG 0: 1
1: 0
2: 2
3: 18
4: 160
1163476379_1163476390 13 Left 1163476379 19:17528498-17528520 CCCTGAGGGATGTCTTCCTGAGC 0: 1
1: 0
2: 1
3: 11
4: 167
Right 1163476390 19:17528534-17528556 CAGGCCCCTCGGTAGGACCCTGG 0: 1
1: 0
2: 2
3: 18
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163476390 Original CRISPR CAGGCCCCTCGGTAGGACCC TGG Intronic
900023126 1:199349-199371 CAGGCCTCGCTGTAGGCCCCGGG + Intergenic
900418926 1:2547207-2547229 CAGGCCCCGCAGCTGGACCCCGG + Intergenic
900589405 1:3453140-3453162 CAGGCCAGTCAGCAGGACCCAGG - Intergenic
900760060 1:4464262-4464284 CAGGCCCCGCGCTAGGATTCAGG - Intergenic
902512617 1:16974658-16974680 CAGGCCTCTCTGTGGGACCTGGG - Exonic
903035918 1:20492481-20492503 CAGGCTTCTCGGTGGGATCCTGG - Intergenic
903524143 1:23980126-23980148 CAGGCGCCTGGAGAGGACCCTGG - Intronic
912412835 1:109490011-109490033 CATGCCCCGGGGTGGGACCCAGG + Exonic
912910967 1:113759074-113759096 CCGGCCTCACGGTGGGACCCCGG - Exonic
921263982 1:213407070-213407092 CAGGCCTCCGGGTAGGACCTTGG - Intergenic
922025169 1:221742829-221742851 CAGGGCCCTCCGGAGGACGCAGG - Intergenic
922989860 1:229897306-229897328 AAGGGCCCTGGGTAGGACCGAGG + Intergenic
923035275 1:230281074-230281096 CAGGCCCCTCGGTGGGACAGCGG + Exonic
924744363 1:246818420-246818442 CAGGCCTCTCTGTGGGACCTGGG + Intergenic
1067058986 10:43068159-43068181 CAGGACCCTGGGCAGGGCCCAGG + Intergenic
1069907099 10:71738418-71738440 CTGGACCCACGGTGGGACCCAGG + Intronic
1070289559 10:75105460-75105482 CAGGCCCTTGGGTGAGACCCTGG + Intronic
1070663641 10:78328332-78328354 CAGGCCTGTCCTTAGGACCCTGG + Intergenic
1072656413 10:97333641-97333663 CATGCCCCACGGAAGCACCCTGG + Exonic
1073099890 10:101000809-101000831 CAGGCCCCTCTGTAGGGCTGGGG - Exonic
1073328018 10:102653664-102653686 CAGCCCCCTCAGTGGGACCCAGG - Intronic
1074320420 10:112397094-112397116 CAGGGCCCTGGGATGGACCCTGG - Intronic
1074640812 10:115378296-115378318 CACGCCCATCTGTAGGTCCCTGG + Intronic
1075078555 10:119367953-119367975 CAGGCGCCTCGGCAGGGCCAGGG + Intronic
1075715007 10:124550900-124550922 CAGCCTCCTCTGTGGGACCCAGG - Intronic
1075728652 10:124623448-124623470 CAGGACCCCCGCTGGGACCCCGG - Exonic
1076575514 10:131464180-131464202 GAGGCCCCTCTGTAGGGCACAGG - Intergenic
1077247783 11:1547678-1547700 GAGGCCCCACAGTAGGAACCCGG + Intergenic
1077435750 11:2538381-2538403 CAGGCCCCTCTGTGGGGCCCAGG + Intronic
1081020884 11:37947046-37947068 CAGGCCCCTAGGTAGCCCACTGG + Intergenic
1081575696 11:44317425-44317447 GAGGACCCTGGATAGGACCCTGG - Intergenic
1084188818 11:67489590-67489612 CAGGACCCTTGGCAGTACCCTGG + Intronic
1084362409 11:68677543-68677565 CAGGCCCATCAGCAGCACCCAGG - Intergenic
1084459269 11:69287084-69287106 CAGGCACCTCTGTGGGAACCTGG - Intergenic
1087841502 11:102925332-102925354 CAGGCCCCTCAGCAGGATCAAGG + Intergenic
1089609866 11:119663212-119663234 CATGCCCATGGGAAGGACCCTGG - Exonic
1091144385 11:133264995-133265017 GAGGCCTCTCGGTAGGACCCTGG - Intronic
1091229330 11:133977534-133977556 CAGGGCCCTCGGGGGGGCCCTGG + Intergenic
1091376825 12:30887-30909 CAGGCCTCGCTGTAGGCCCCGGG + Intergenic
1091589640 12:1835695-1835717 CAGGCCCCTGGGTGGTATCCCGG - Exonic
1093731186 12:22567756-22567778 CAGGCCCCACGGCAGCATCCAGG + Intergenic
1094834043 12:34313945-34313967 CAGCCCCTGCGCTAGGACCCGGG - Intergenic
1096427639 12:51517615-51517637 CAGGCCACACTGTAGGTCCCTGG + Intergenic
1104815783 12:131644675-131644697 CAGGCCCTTGGGGAGGACCAAGG + Intergenic
1105443361 13:20433204-20433226 CATGCCCCAAGGGAGGACCCTGG + Intronic
1105593067 13:21812152-21812174 TAGGCCCCTGGGCAGGTCCCTGG + Intergenic
1107951399 13:45465262-45465284 CGGGCGCCCCGGCAGGACCCCGG + Intronic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1115773308 14:36688533-36688555 CAAGCCCCTGGGCAGTACCCAGG + Intronic
1121025002 14:90609100-90609122 CAGGTCCCTCGGCAGGAGCTGGG + Intronic
1122947646 14:105020578-105020600 CAGCCCCCTCTGTCGGAGCCCGG - Intronic
1124414875 15:29466599-29466621 CAGCCCCCAGGGTAGGGCCCAGG + Intronic
1124415001 15:29466904-29466926 CAGCCCCCAGGGTAGGGCCCAGG + Intronic
1124425880 15:29562201-29562223 CATGTTCCTGGGTAGGACCCTGG + Intronic
1128529137 15:68432046-68432068 CAGGCCCCTGGGCAGGTCCATGG + Exonic
1129739146 15:77981593-77981615 CAGGCTCCTTGGTGGGACCCGGG - Intergenic
1129846813 15:78771596-78771618 CAGGCTCCTTGGTGGGACCCGGG + Exonic
1130255087 15:82322295-82322317 CAGGCTCCTTGGTGGGACCCGGG - Intergenic
1130599887 15:85267711-85267733 CAGGCTCCTTGGTGGGACCCGGG + Intergenic
1132450096 15:101962107-101962129 CAGGCCTCGCTGTAGGCCCCGGG - Intergenic
1132747146 16:1441539-1441561 CAGCCCCGTGGGTGGGACCCTGG + Intronic
1141548309 16:84787056-84787078 CAGGCCCTTAGGGAGCACCCAGG + Intergenic
1141558824 16:84853538-84853560 CAGGCCCCTCGGTGAGGCCAGGG + Intronic
1142747481 17:1967113-1967135 CAGGCCCCTCTGCAGGCCCCAGG + Intronic
1144511197 17:15878435-15878457 CAGGGCCCTGGCTGGGACCCAGG - Intergenic
1145106981 17:20126015-20126037 CAGGCACCCAGGGAGGACCCAGG - Intronic
1145175359 17:20696138-20696160 CAGGGCCCTGGCTGGGACCCAGG - Intergenic
1146654790 17:34628837-34628859 CAGGCCCCTCAGTGGGATCCTGG + Intronic
1146669039 17:34724241-34724263 CAGGCCTCTAGGAAGAACCCAGG - Intergenic
1147421107 17:40322581-40322603 GAGGACCTGCGGTAGGACCCAGG - Intronic
1147661242 17:42118184-42118206 CAGGTCCCTCAGTGGGATCCAGG + Intronic
1148899873 17:50867118-50867140 CAGGCCTCCCGGTGCGACCCCGG + Intronic
1150008819 17:61486619-61486641 CAGGCCCCTGGGGAGAAGCCAGG + Intergenic
1150283646 17:63943687-63943709 CAGTCCCCTAGGCAGGAGCCTGG + Intronic
1151550350 17:74819135-74819157 CAGGCCCCTCGGAAGTACCCGGG - Intronic
1151678306 17:75611034-75611056 CAAGACCCACGGTAGCACCCTGG - Intergenic
1152703855 17:81833076-81833098 CGGGCCCCTCCCTCGGACCCCGG + Intronic
1153437113 18:5079421-5079443 CAGGCCACCCAGTAGGTCCCCGG + Intergenic
1154388504 18:13916829-13916851 CAGTCCCCTGGGTGGGACCTGGG + Intergenic
1157643009 18:49236740-49236762 AAGGCCACTCCGTAGGAGCCGGG + Intronic
1157792611 18:50546082-50546104 CAGGCCCCGCGGTAGCATCCAGG - Intergenic
1159890756 18:73951147-73951169 GAAGCCTCTGGGTAGGACCCCGG - Intergenic
1160707613 19:536771-536793 CAGACCCCTCCGTCAGACCCGGG - Intronic
1161081111 19:2310588-2310610 CAGGCCCTGCAGTAGGAGCCTGG - Intronic
1162096708 19:8314380-8314402 CAGGACCCTTGGAGGGACCCCGG + Intronic
1163476390 19:17528534-17528556 CAGGCCCCTCGGTAGGACCCTGG + Intronic
1163704566 19:18804669-18804691 CAGGCCCCTCTGCAGGTCTCAGG - Intergenic
1165879566 19:39032491-39032513 CAGGCCCCGGGGTAGGACTTGGG - Exonic
1166098301 19:40555190-40555212 CAGGAACCTCGGTGGGACTCTGG - Intronic
1166266956 19:41690453-41690475 CAGGCCTCCTGGCAGGACCCAGG + Intronic
925328668 2:3042006-3042028 AAGGCCCCTCGGGAGAAACCAGG - Intergenic
925817395 2:7767267-7767289 CAGACCCCTAGGCAGGAGCCAGG + Intergenic
925855289 2:8123648-8123670 GAGGACCCTGGGGAGGACCCTGG + Intergenic
927052862 2:19347782-19347804 CAGGGGCCTCTGTAGGACCGCGG + Intergenic
932479273 2:72028886-72028908 TAGGCCCCTCCGTAGCACCCTGG - Intergenic
932791041 2:74654589-74654611 CAGACCGCTCGGCCGGACCCGGG + Intronic
933298167 2:80514290-80514312 CAGGCCCCCTGGCAGCACCCAGG + Intronic
933752619 2:85612590-85612612 CTGTCCCCGCGGGAGGACCCAGG + Intronic
933984062 2:87575960-87575982 CAGACCCCTGGTTTGGACCCTGG + Intergenic
934663291 2:96154405-96154427 CAGACCCCGTGGGAGGACCCCGG + Intergenic
935328709 2:101961005-101961027 CAGGACCCTTGGGAGCACCCAGG - Intergenic
936566322 2:113584602-113584624 CAGGCCTCGCTGTAGGCCCCGGG - Intergenic
937812374 2:126213171-126213193 AAGCCCCCTGGGAAGGACCCAGG + Intergenic
938491650 2:131764333-131764355 CAGGCCCCTTGTTAATACCCCGG + Intronic
938495918 2:131798009-131798031 CAGGCCCCTTGTTAATACCCCGG - Intronic
942061051 2:172228980-172229002 CAGGCCCCTAATTAAGACCCAGG - Intergenic
942462624 2:176178682-176178704 CAGGCGCGTTGGGAGGACCCTGG - Intergenic
946421915 2:219570187-219570209 GAGGCCCCTCCCTAGGTCCCGGG + Intronic
946811594 2:223531092-223531114 CAGGCCCCATGGTGGCACCCAGG - Intergenic
948503552 2:238411796-238411818 CATGCCACCCGGCAGGACCCTGG - Intergenic
1174309018 20:49635942-49635964 CAGGCTCCACGGCAGGACCACGG + Exonic
1174489101 20:50879727-50879749 CAGGCCCCACGCTAGGAGCATGG + Intronic
1177491480 21:21831166-21831188 CAGGCCCCGCGGTAGCATCTGGG - Intergenic
1177968517 21:27759399-27759421 CAGGCCTCTTGGCAGGATCCAGG - Intergenic
1180041448 21:45282316-45282338 CAGGCCCCCCGGGAGCAGCCTGG - Intronic
1180167691 21:46038504-46038526 CAGGCCCCACGGCTGCACCCAGG + Intergenic
1182744872 22:32597810-32597832 CAGGCCCCTCAGCAAGACCTAGG + Intronic
1184501868 22:44879369-44879391 CAGCCCCCTCGCCAGGACCCTGG - Intergenic
1184507589 22:44913793-44913815 CAGGCCTCTCCGGAGGGCCCAGG - Intronic
1185148549 22:49151889-49151911 CAGGCCCCTCCGCAGGCCCTGGG - Intergenic
1185218339 22:49616361-49616383 CAGTCCCCTGGGTAGCATCCAGG - Intronic
950099071 3:10346199-10346221 CAGGCCCCTCCCGAGGACCAGGG - Intronic
950215110 3:11153734-11153756 GAGGCCCCTCTGCAGGTCCCCGG - Intronic
950629807 3:14274959-14274981 CAGGCCCCTGGGAAGTCCCCCGG + Intergenic
953398446 3:42591123-42591145 CAGGCGCCGGGGCAGGACCCCGG + Intronic
954596439 3:51829556-51829578 CAGGCCACTTCTTAGGACCCAGG + Intronic
961734972 3:128995595-128995617 CAGGCCAGTGGGTAGGACCTGGG - Intronic
968901481 4:3433976-3433998 CAGGCCCCTCGTGAGGCTCCAGG + Intronic
969598512 4:8162153-8162175 CAGAACCCCCAGTAGGACCCTGG + Intergenic
973944618 4:55944092-55944114 CAAGCCCCTCGGTGGGAGCAGGG + Intergenic
982312756 4:154002832-154002854 CAGGCCCCTTGGCAGGAAGCTGG + Intergenic
983194011 4:164784684-164784706 CAGGCTCATAAGTAGGACCCAGG - Intergenic
983405438 4:167323662-167323684 CATTCCCCTCAGTAGGACTCTGG - Intergenic
983936018 4:173503088-173503110 CAGGTCCCTGGGTACGTCCCAGG + Intergenic
984206292 4:176792233-176792255 CGGGCGCCTCGCGAGGACCCGGG + Exonic
985419881 4:189774067-189774089 CAGGACCCTGGATAGGTCCCTGG - Intergenic
985545389 5:506446-506468 GGGGCCCCTCGGGAGGACCCCGG - Intronic
985879501 5:2627915-2627937 GAGGCCACTCAGTAGGTCCCAGG + Intergenic
985880105 5:2632972-2632994 CAGGCCCCTTGCTTGGACCCCGG + Intergenic
986684809 5:10267326-10267348 TAGGCCCCTTGGAAAGACCCAGG - Intergenic
986785721 5:11112272-11112294 CAGGCCCCTTGTGAGGACACAGG - Intronic
987005066 5:13702519-13702541 CACCCACCTCGGTAGGACCCAGG - Intronic
995543077 5:113203154-113203176 CAGGCCCCTGGGTAGTTTCCCGG - Intronic
1001159376 5:169300454-169300476 GGGCCCCCTCGGTGGGACCCAGG + Intronic
1001439819 5:171734051-171734073 CAGGACCCTGGTCAGGACCCCGG + Intergenic
1002297467 5:178239498-178239520 CACGGCTCTCGGCAGGACCCAGG - Intronic
1002297476 5:178239553-178239575 CACGGCTCTCGGCAGGACCCAGG - Intronic
1002297486 5:178239608-178239630 CACGGCTCTCGGCAGGACCCAGG - Intronic
1002297496 5:178239663-178239685 CACGGCTCTCGGCAGGACCCAGG - Intronic
1002297506 5:178239718-178239740 CACGGCTCTCGGCAGGACCCAGG - Intronic
1002297516 5:178239773-178239795 CACGGCTCTCGGCAGGACCCAGG - Intronic
1002297526 5:178239828-178239850 CACGGCTCTCGGCAGGACCCAGG - Intronic
1002590885 5:180291393-180291415 CAGACGCCTGGGCAGGACCCCGG - Intronic
1006677948 6:35777278-35777300 CCGGCCCCTCAGCAGGACCCAGG - Intronic
1006942084 6:37759139-37759161 CAGGCCCCGAGGTAGGCCCCGGG - Intergenic
1006947293 6:37793204-37793226 CAGGCCCCCAGGGAGGACCTGGG - Intergenic
1007596392 6:43053634-43053656 CAGGCCTCGCGCCAGGACCCCGG - Intronic
1017445437 6:154503225-154503247 CAGGATCCTCAGTAGGACCTAGG - Intronic
1018263072 6:161989754-161989776 CAGGCCCATCGTCAGGGCCCTGG - Intronic
1019175103 6:170155477-170155499 AGGGCCCCTCTGTAGAACCCAGG + Intergenic
1021099833 7:16575020-16575042 CAGGACAATCGGTTGGACCCGGG + Intronic
1024293528 7:47824760-47824782 CAGGCCTCTCCCTAGGAGCCTGG + Intronic
1026903092 7:74047763-74047785 CAGCACCCTTGCTAGGACCCTGG - Intronic
1035034260 7:155884956-155884978 CAGGCCCCTCGTAGGGCCCCTGG + Intergenic
1035858716 8:3005213-3005235 CAGTACCCTGGGTGGGACCCAGG + Intronic
1039063687 8:33591967-33591989 CAGGCCCGTGGGTAGGTCCCTGG - Exonic
1042040206 8:64581368-64581390 CAGGCCCCCCGGGGGGACGCTGG - Exonic
1043169030 8:76940734-76940756 CAGGCACCTTGTTAGGTCCCAGG - Intergenic
1049379274 8:142303936-142303958 CAGGCCCCTCGGCAGGGGCACGG + Intronic
1049476922 8:142801197-142801219 CAGGCCCCTCAGTCTGAACCTGG + Intergenic
1049790842 8:144472135-144472157 CAGGGCCCTCCTGAGGACCCCGG + Exonic
1049867227 8:144946885-144946907 CAGGCCCCACAGCAGGACACAGG - Intronic
1049867281 8:144947102-144947124 CAGGCCCCACAGCAGGACACAGG - Intronic
1049867316 8:144947249-144947271 CAGGCCCCACAGCAGGACACAGG - Intronic
1056438567 9:86597332-86597354 CAGGGCCCTCTGCAGGAGCCTGG - Intergenic
1057201096 9:93140372-93140394 CAGCCCCCTCGATGGAACCCAGG + Intergenic
1059308791 9:113374386-113374408 CAGGTCCCACGGTGGGTCCCAGG + Exonic
1190335974 X:49261806-49261828 CAGGACTCTAGGTGGGACCCTGG - Intronic
1199840626 X:151643904-151643926 CAGACCCCTGGGTAGGAACTTGG + Intronic
1200061500 X:153485817-153485839 CAGGCCCCGCGGCAGGAAGCGGG - Intronic
1200142786 X:153910142-153910164 CAGTCCCCTCGGCAGCACCAAGG + Intronic