ID: 1163476508

View in Genome Browser
Species Human (GRCh38)
Location 19:17529191-17529213
Sequence GCCTAGCTCATGGGGCTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163476497_1163476508 21 Left 1163476497 19:17529147-17529169 CCTGGGCTTCATTCTCTTATATG No data
Right 1163476508 19:17529191-17529213 GCCTAGCTCATGGGGCTGGGGGG No data
1163476496_1163476508 22 Left 1163476496 19:17529146-17529168 CCCTGGGCTTCATTCTCTTATAT No data
Right 1163476508 19:17529191-17529213 GCCTAGCTCATGGGGCTGGGGGG No data
1163476495_1163476508 25 Left 1163476495 19:17529143-17529165 CCTCCCTGGGCTTCATTCTCTTA No data
Right 1163476508 19:17529191-17529213 GCCTAGCTCATGGGGCTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163476508 Original CRISPR GCCTAGCTCATGGGGCTGGG GGG Intronic