ID: 1163479080

View in Genome Browser
Species Human (GRCh38)
Location 19:17544033-17544055
Sequence GTGCTAGGATTAAGGTCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 207}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163479080_1163479086 -3 Left 1163479080 19:17544033-17544055 CCATTTGACCTTAATCCTAGCAC 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1163479086 19:17544053-17544075 CACTTTGGGAGGCCAAAGTGTGG 0: 39
1: 571
2: 1980
3: 4052
4: 5325
1163479080_1163479087 -2 Left 1163479080 19:17544033-17544055 CCATTTGACCTTAATCCTAGCAC 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1163479087 19:17544054-17544076 ACTTTGGGAGGCCAAAGTGTGGG 0: 2
1: 55
2: 739
3: 2264
4: 5012
1163479080_1163479090 10 Left 1163479080 19:17544033-17544055 CCATTTGACCTTAATCCTAGCAC 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1163479090 19:17544066-17544088 CAAAGTGTGGGGATTGCTTGAGG 0: 1
1: 2
2: 111
3: 1223
4: 4631
1163479080_1163479091 15 Left 1163479080 19:17544033-17544055 CCATTTGACCTTAATCCTAGCAC 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1163479091 19:17544071-17544093 TGTGGGGATTGCTTGAGGCCAGG 0: 1
1: 89
2: 2261
3: 15067
4: 44433
1163479080_1163479088 -1 Left 1163479080 19:17544033-17544055 CCATTTGACCTTAATCCTAGCAC 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1163479088 19:17544055-17544077 CTTTGGGAGGCCAAAGTGTGGGG 0: 25
1: 1810
2: 27585
3: 82127
4: 161325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163479080 Original CRISPR GTGCTAGGATTAAGGTCAAA TGG (reversed) Intronic
902311969 1:15587837-15587859 GTGCTAGGATTACGGGCATGAGG - Intronic
905755548 1:40506210-40506232 GTGCTGGGATTACGGGCATAAGG + Intergenic
906064341 1:42969400-42969422 GTGCTGGGATTATGGGAAAAAGG + Intergenic
908123822 1:61010332-61010354 GGGCTAGAATTAAAGTCAAGCGG - Intronic
908654726 1:66375930-66375952 GTGCTAGGATTATAGGCACAAGG + Intergenic
908737652 1:67292655-67292677 GCCCTATGATTAAGGTCAATGGG + Intergenic
909901367 1:81140445-81140467 GTGCAAGGATGATGGTTAAATGG + Intergenic
910510766 1:88001562-88001584 GAGCTAAGAATAAGTTCAAAGGG + Intergenic
910724257 1:90322166-90322188 CTACTAGGATTAAGGTTAGATGG - Intergenic
912367819 1:109149519-109149541 GTGCTGGGATTACAGCCAAAAGG - Intronic
913519592 1:119632129-119632151 CTGCTAAGTTTATGGTCAAAAGG + Intronic
918403425 1:184187769-184187791 GTCCTAGGATCAAGGTTAAAGGG + Intergenic
918528430 1:185489902-185489924 GTGCTACATTTAAGGTTAAATGG + Intergenic
918610970 1:186491513-186491535 GTGCTAGGATTACAGACATAAGG - Intergenic
918613057 1:186513725-186513747 GTTCCAGGCTTAAGGCCAAATGG + Intergenic
919122102 1:193354156-193354178 GTGCTAGGATTACAGGCAAGAGG - Intergenic
920991242 1:210941798-210941820 GTTCTAGGTTTAAGGTAATAAGG + Intronic
921103161 1:211948968-211948990 GTGCTGGGATTATGGGCATAAGG + Intronic
921293616 1:213681530-213681552 GTGCTAGGATTACAGGCATAAGG - Intergenic
922706208 1:227791685-227791707 GGGTTAGGATCAAGGTCATAAGG - Intergenic
923384144 1:233449721-233449743 ATCCTAGGTTCAAGGTCAAATGG + Intergenic
1062919444 10:1268608-1268630 GAACTAGAATTAAGATCAAATGG + Intronic
1064729657 10:18317197-18317219 TTGGTAGGATGAAGGCCAAAAGG - Intronic
1067512273 10:46905966-46905988 ATCCTAGGTTCAAGGTCAAATGG + Intergenic
1068802180 10:61153916-61153938 TAGCTTGGATTAAAGTCAAAGGG + Intergenic
1071308760 10:84323929-84323951 GCCCTATGATTAAGGTCAATGGG + Intergenic
1071364221 10:84882672-84882694 GTCCTGTGATTAAGGTCAATGGG - Intergenic
1072166418 10:92817669-92817691 GTTCTAGGAGTCAGGTCAAAAGG + Intergenic
1073635981 10:105199615-105199637 GTGCTTGCATTAAGGAGAAATGG + Intronic
1074243950 10:111669136-111669158 ATGCTGTGATTAAGGTCAATGGG - Intergenic
1074928829 10:118102904-118102926 CAGATAGGAGTAAGGTCAAAGGG - Intergenic
1077631013 11:3810997-3811019 GTGCTAGGATAAAGCTTGAATGG - Intronic
1080019928 11:27549880-27549902 GTCCTGTGATTAAGGTCAATAGG - Intergenic
1083093384 11:60222944-60222966 GCCCTATGATTAAGGTCAATGGG + Intronic
1085490791 11:76915256-76915278 GTCCTAGGATCAAGGTAAAAGGG - Intronic
1088191422 11:107232862-107232884 GTCCTGTGATTAAGGTCAATGGG - Intergenic
1090291353 11:125548012-125548034 GTCCTAGGATCAAGGTTAAAGGG - Intergenic
1091105393 11:132914529-132914551 TTTCAAGGATTAAGGACAAAGGG - Intronic
1091544672 12:1493612-1493634 GTGCAAGGACAAAGGTTAAAAGG - Exonic
1093234517 12:16590246-16590268 GAGCTAGGATTAAGGTTAGTGGG + Intronic
1096158132 12:49353381-49353403 GTGCTAGGATTATAGGCAAGAGG - Exonic
1098731347 12:74039518-74039540 GTCCTATGATTAAGGTCAATGGG + Intergenic
1098776080 12:74619497-74619519 GTCCTGTGATTAAGGTCAATAGG + Intergenic
1099231202 12:80027453-80027475 GGGCTAGGACTGAGGCCAAAGGG + Intergenic
1100083550 12:90880024-90880046 GTCCTGTGATTAAGGTCAATGGG + Intergenic
1100544861 12:95591798-95591820 GTCCTGTGATTAAGGTCAATGGG + Intergenic
1102431748 12:112889447-112889469 GTGCAAGGGTTAAGGTTTAATGG - Intronic
1102776735 12:115526241-115526263 GTCCTAGGATTAGGGACTAAAGG + Intergenic
1104687862 12:130800826-130800848 GTGCTAGAATTAAGAGAAAAGGG - Intronic
1105306778 13:19174397-19174419 GTGCTAGGATTACAGTCATGAGG + Intronic
1108738239 13:53307822-53307844 GTGGTAGCATGAAGGGCAAAGGG - Intergenic
1109950777 13:69500391-69500413 GCCCTATGATTAAGGTCAATGGG - Intergenic
1111154236 13:84300908-84300930 GTGCTAAGAGTAAAGACAAATGG + Intergenic
1112264758 13:97913124-97913146 CTGCACGGATTCAGGTCAAATGG + Intergenic
1112933634 13:104772163-104772185 GTGCTAAGATTAAGGTTGATAGG - Intergenic
1114281436 14:21195793-21195815 GTCCTAGGATCATGGTTAAACGG + Intergenic
1116020133 14:39450511-39450533 TTTCTAGTATCAAGGTCAAATGG + Intergenic
1116249291 14:42459460-42459482 GTCCTGTGATTAAGGTCAATGGG + Intergenic
1116348738 14:43831230-43831252 GTGATAGATTTATGGTCAAATGG + Intergenic
1116531221 14:45976416-45976438 GCCCTATGATTAAGGTCAATGGG - Intergenic
1117319996 14:54612725-54612747 GTGCTAGGATTTGGGTATAAGGG + Intronic
1117596020 14:57328052-57328074 GCCCTATGATTAAGGTCAATGGG - Intergenic
1117634378 14:57726202-57726224 GCCCTGGGATTAAGGTCAATGGG + Intronic
1125224049 15:37374335-37374357 GGGCTATTATAAAGGTCAAATGG - Intergenic
1128193198 15:65724323-65724345 GTGTTAGGATTACAGGCAAAAGG + Intronic
1133662658 16:7933934-7933956 GTGCTAGGATTACAGTCATGAGG + Intergenic
1134560565 16:15205813-15205835 GTGCTAGGATTACGGGCATGAGG - Intergenic
1134921102 16:18117428-18117450 GTGCTAGGATTACGGGCATGAGG - Intergenic
1137013494 16:35347699-35347721 GTGCTAGGATGAGTGTAAAAGGG - Intergenic
1140710557 16:77673320-77673342 GTGCAAGGATTTAGGTCATCAGG + Intergenic
1140743475 16:77961773-77961795 GAGCTGGGAGTAAGGTCAGAAGG - Intronic
1143811728 17:9477121-9477143 GTGCTAGGATTACAGGCACAAGG + Intronic
1146212786 17:30955310-30955332 GTGCTGGGATTACAGACAAAAGG - Intronic
1146795776 17:35779464-35779486 GTTCTGGGATTAAAGTCAAAAGG + Intronic
1149255131 17:54817268-54817290 GTCCTGTGATTAAGGTCAATGGG + Intergenic
1150897125 17:69225079-69225101 GTTCTAGTATAAAGGGCAAACGG + Intronic
1151037556 17:70819796-70819818 GTCCTGTGATTAAGGTCAATGGG - Intergenic
1152548680 17:81018102-81018124 GTGCTGGGATTAATGACACACGG + Intergenic
1153131021 18:1855901-1855923 GTGCTGTGATTAAGGTCAATGGG - Intergenic
1153217429 18:2833787-2833809 GCCCTATGATTAAGGTCAATGGG - Intergenic
1155384094 18:25258352-25258374 GTGATAGGATTAGGCCCAAAGGG + Intronic
1155870324 18:31019352-31019374 GTGCTAGGATTACAGGCATAAGG + Intronic
1156002616 18:32402310-32402332 TTGAAAGGATCAAGGTCAAATGG - Intronic
1156595417 18:38542750-38542772 GTGCTCAGATGTAGGTCAAATGG + Intergenic
1157266894 18:46232493-46232515 GTACTAGGATTAAGGGCATATGG - Intronic
1157535504 18:48454420-48454442 TTGCTAAGATCAAGGGCAAATGG + Intergenic
1158945625 18:62444751-62444773 GTCCCAGGATCAAGGTTAAAGGG + Intergenic
1159643328 18:70888581-70888603 GTCCTAGGATCATGGTTAAATGG - Intergenic
1161794852 19:6380764-6380786 GTGCCAGGATTAGGGTTCAAGGG + Intronic
1161952039 19:7472965-7472987 GTGCTGGGATTACGGGCACAGGG + Intergenic
1163479080 19:17544033-17544055 GTGCTAGGATTAAGGTCAAATGG - Intronic
1164609893 19:29624729-29624751 GTGCTGGGATTAAAGGCATAAGG - Intergenic
1165404913 19:35623645-35623667 GTGCTAGGATAAATTCCAAATGG - Exonic
925105301 2:1285877-1285899 GCCCTATGATTAAGGTCAATGGG - Intronic
925992515 2:9264871-9264893 GTGCTAGGATTAGAGGCATAAGG - Intronic
926827017 2:16915485-16915507 GTCCTGTGATTAAGGTCAATGGG + Intergenic
927046740 2:19286595-19286617 GTGCTGGGATTCTGGTCAATGGG + Intergenic
927222550 2:20726976-20726998 GTGTTAGGATTTAGGACAAGAGG - Intronic
927496990 2:23557676-23557698 GTGCTTGGGATCAGGTCAAAGGG - Intronic
927780653 2:25937157-25937179 GAGCAAGGATAAAAGTCAAAAGG + Intronic
929386787 2:41417507-41417529 GTCCTGTGATTAAGGTCAATGGG - Intergenic
930480921 2:51947443-51947465 GTTCTGTGATTAAGGTCAATGGG - Intergenic
930574759 2:53133121-53133143 ATCCTAGGATCAAGGTTAAATGG - Intergenic
930925182 2:56809513-56809535 GTCCTAAAATTAAGGGCAAAGGG + Intergenic
932996714 2:76864200-76864222 GTGGTGGGATTCAGATCAAAAGG + Intronic
933677641 2:85071109-85071131 TTGCTGGGATTAATGTAAAATGG - Intergenic
934582640 2:95457380-95457402 GTGCTGGGATTAAAGGCATAAGG + Intergenic
934596810 2:95619334-95619356 GTGCTGGGATTAAAGGCATAAGG - Intergenic
936244480 2:110814776-110814798 TTCCTAGCATCAAGGTCAAATGG + Intronic
936840629 2:116764235-116764257 GTCCTAGGTTCAAGGTTAAATGG - Intergenic
937581830 2:123497316-123497338 GTTCTGTGATTAAGGTCAACAGG - Intergenic
943750315 2:191503530-191503552 ATGCTAGGTTCAAGATCAAATGG + Intergenic
943833366 2:192489306-192489328 GCCCTATGATTAAGGTCAATGGG - Intergenic
945907309 2:215609649-215609671 GTGCTAGGATTGATTTCCAACGG - Intergenic
946601608 2:221365600-221365622 GTGCCTGGATTAAGGGGAAAAGG + Intergenic
947281771 2:228463186-228463208 GTCCTGTGATTAAGGTCAAAGGG - Intergenic
947833601 2:233159430-233159452 GTGCTGGGATTATGGGCATAAGG - Intronic
1169626620 20:7578507-7578529 GCCCTATGATTAAGGTCAATGGG - Intergenic
1171176505 20:23053969-23053991 GTGTTAGGATGAAGATTAAATGG + Intergenic
1174540080 20:51282330-51282352 CGGCTAGGATGAAGGTGAAATGG - Intergenic
1177463066 21:21438394-21438416 GTCCTAGGTTTAAGGTACAATGG + Intronic
1181452837 22:23035431-23035453 GTCCTAGGATCATGGTTAAATGG + Intergenic
1182045157 22:27268465-27268487 CTGCTCTCATTAAGGTCAAAAGG - Intergenic
1183074966 22:35421157-35421179 GTTCTATGACTAAGATCAAAAGG + Intronic
1183078303 22:35440633-35440655 GGGCCAGGATTAGGGTCAAATGG - Intergenic
1184014444 22:41775405-41775427 ATGGTAGGATTAGGGTCAAGAGG - Intronic
949868239 3:8564535-8564557 GTGCTAGAATTAAAGGCATAAGG + Intronic
952313155 3:32208818-32208840 GTCCTGTGATTAAGGTCAATGGG - Intergenic
954643330 3:52115307-52115329 GTGCCAGGATTGGGGTCAAGTGG + Intronic
955981292 3:64530087-64530109 GTGCTGGGATTATGGGCACAAGG + Intronic
956861622 3:73329664-73329686 GTGCTAGGTTTGAGGGCAAGTGG + Intergenic
958435409 3:94089705-94089727 GTCATAGGATTAAGGTTAAATGG + Intronic
960996008 3:123340709-123340731 CTGCTGGGAAGAAGGTCAAATGG + Intronic
961014803 3:123459318-123459340 GTTCTAGGATTATGGTGATATGG + Intergenic
961843892 3:129744160-129744182 GTGCCAGTATTAAAGTTAAAAGG - Intronic
963453763 3:145517524-145517546 GCCCTATGATTAAGGTCAATGGG - Intergenic
965226513 3:165998954-165998976 GCCCTATGATTAAGGTCAATGGG - Intergenic
971572491 4:28231233-28231255 GTTCTAGGATCACGGTTAAATGG - Intergenic
971688002 4:29795418-29795440 GTGCTATCATAAATGTCAAAAGG + Intergenic
972352112 4:38245423-38245445 GTGATAGTATTGAGGTCATAAGG + Intergenic
972943899 4:44229597-44229619 GTCCTAGGATCATGGTTAAATGG + Intronic
973641493 4:52907087-52907109 GTTCTAGAATTAAGAGCAAAGGG + Intronic
974679390 4:65141592-65141614 GTACTATAATTAAGGTCAATGGG - Intergenic
974910081 4:68107394-68107416 GTGGTAGGATTAAGGTGATCAGG + Intronic
975033355 4:69651944-69651966 GTCCTAGGATCGAGGTTAAACGG + Intronic
976373509 4:84317737-84317759 GTTCTATGATGAAAGTCAAATGG + Intergenic
976743846 4:88383911-88383933 GAGATAAGATTAAGATCAAAGGG - Intronic
977386454 4:96345952-96345974 GTGCTAGGATGATCCTCAAATGG - Intergenic
977526000 4:98145594-98145616 GTGCTAGGATTAAGGATTACAGG - Intergenic
979814448 4:125082764-125082786 GTGCTAGGTTGCAGGGCAAAAGG + Intergenic
980602460 4:135041828-135041850 GTCCTGTGATTAAGGTCAATGGG + Intergenic
981702688 4:147623741-147623763 GTGCTAGGATTATAGGCACAAGG + Intronic
982835788 4:160118441-160118463 GCGCTATAATTAAGGTCAATAGG + Intergenic
983420972 4:167516580-167516602 GTGGTAGAAATAGGGTCAAACGG - Intergenic
985832566 5:2245141-2245163 GCCCTATGATTAAGGTCAATGGG + Intergenic
986960080 5:13200997-13201019 GTCCTGTGATTAAGGTCAACGGG + Intergenic
987737951 5:21869259-21869281 GCCCTATGATTAAGGTCAATGGG + Intronic
988079575 5:26399594-26399616 GTTCTGTGATTAAGGTCAATGGG - Intergenic
988168969 5:27631027-27631049 GTCCTGTGATTAAGGTCAATGGG - Intergenic
989307007 5:39969591-39969613 GTCCTGGGATCAAGGTGAAAGGG + Intergenic
989486136 5:41994567-41994589 GCCCTATGATTAAGGTCAAAGGG - Intergenic
991013539 5:61909071-61909093 GTCCTGTGATTAAGGTCAATAGG - Intergenic
991040029 5:62165661-62165683 GTTGTAGCATCAAGGTCAAAAGG - Intergenic
993007358 5:82443102-82443124 GTGCTAGGATTACAGTCTAATGG - Intergenic
993150410 5:84154468-84154490 GTTCTAGCATTACAGTCAAATGG + Intronic
994604992 5:101955644-101955666 GCCCTATGATTAAGGTCAATGGG - Intergenic
995172675 5:109135744-109135766 GTCAAAGGAATAAGGTCAAAGGG - Intronic
995407907 5:111822491-111822513 ATGCTAGGAGTAAAGTCAAATGG + Intronic
997884918 5:137621438-137621460 GTGCTAGAATAAGGGACAAATGG - Exonic
1001213444 5:169832899-169832921 GTGCTAAGATGAAGATCACAAGG - Intronic
1003168555 6:3702199-3702221 GTCCCAGGATTAAGGTTAAATGG + Intergenic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1004916546 6:20338142-20338164 TTGCTAGGAATCAGGTCAACAGG + Intergenic
1009462977 6:63936174-63936196 GGTCTAGGTTTAATGTCAAAGGG - Intronic
1010010465 6:71042290-71042312 GTCCCAGGATTATGGTTAAATGG + Intergenic
1010584125 6:77636780-77636802 GTGCTAGGAATAAAATCAACAGG + Intergenic
1010917546 6:81639240-81639262 TTGCTAGGATTAAAATCGAATGG - Intronic
1012232989 6:96782395-96782417 GTCCTAGGATCAAGGTTAAACGG + Intergenic
1012363745 6:98414457-98414479 GTAATGGGATTAGGGTCAAATGG - Intergenic
1012821030 6:104084585-104084607 GTCCTGTGATTAAGGTCAATGGG + Intergenic
1012920532 6:105217732-105217754 GCCCTATGATTAAGGTCAATGGG - Intergenic
1013406914 6:109851560-109851582 GCACTATGATTAAGGTCAATGGG + Intergenic
1013737335 6:113242828-113242850 GTGCTAGGATTAATGCTATAAGG - Intergenic
1013849769 6:114499947-114499969 ATAATAGGATAAAGGTCAAATGG + Intergenic
1014568319 6:122978026-122978048 GTCCTAGGATCATGGTTAAATGG + Intergenic
1015443030 6:133270724-133270746 GCCCTATGATTAAGGTCAATGGG - Intronic
1015503650 6:133959303-133959325 GTGCTGGGATTATGGGCAATGGG + Intronic
1016447009 6:144144144-144144166 GTGCTAGGCTCTAGGTAAAAAGG + Intergenic
1017919419 6:158858187-158858209 GTGCTAGGAATTAGGTCTACAGG + Intergenic
1017942628 6:159066450-159066472 CTGCCAAGATTAAGGGCAAATGG + Intergenic
1018780879 6:167064219-167064241 GCCCTATGATTAAGGTCAATGGG - Intergenic
1026850717 7:73721607-73721629 GTGCTTGGCTTCAGGTCAAGAGG - Intergenic
1027610313 7:80352105-80352127 GCCATATGATTAAGGTCAAAGGG - Intergenic
1028044081 7:86093279-86093301 GTCCTGTGATTAAGGTCAATAGG + Intergenic
1028342045 7:89733906-89733928 GTCCTAGGATCAAGGTTAAATGG - Intergenic
1028664331 7:93323075-93323097 GGGCTAGGATTCAGGGCAATGGG + Intronic
1030506938 7:110436500-110436522 GTCCTGTGATTAAGGTCAATGGG + Intergenic
1030883036 7:114904720-114904742 GTCCTATGATTAAGGTCAATGGG - Intergenic
1031768010 7:125805501-125805523 GCGCTGTGATTAAGGTCAATGGG + Intergenic
1036433475 8:8711056-8711078 GTGGAAGGCTTAAGGTCCAAAGG + Intergenic
1037020173 8:13960307-13960329 GTCCTAGAATCAAGGTTAAATGG - Intergenic
1039011879 8:33102794-33102816 GTGCTGGGATTACAGACAAAAGG - Intergenic
1041605633 8:59779658-59779680 GTTATAGGATCAAGGTTAAATGG + Intergenic
1043669511 8:82864608-82864630 GTGCTAGGGATAAAGACAAACGG - Intergenic
1044232730 8:89798051-89798073 GTGCTAGGATAGGGGGCAAAGGG + Intergenic
1044823725 8:96177320-96177342 GTGCTGGGATTAGGGTAAGAGGG - Intergenic
1045511896 8:102818102-102818124 GTGCTAGGATTATGGGCACCCGG + Intergenic
1045851227 8:106700646-106700668 GTACTAGGATTAAGGTATTAAGG + Intronic
1046735482 8:117772007-117772029 GTCATAGGATAAAAGTCAAAAGG - Intergenic
1046799211 8:118406537-118406559 GTGCTAGGATTACAGTCATGAGG + Intronic
1050423011 9:5486672-5486694 GTGTTTGTATTAAGGTCAAAGGG - Intergenic
1055540322 9:77297840-77297862 GTTCTAGAAATTAGGTCAAAAGG + Intronic
1057114334 9:92506418-92506440 GTGGTATGATCCAGGTCAAATGG + Intronic
1058241315 9:102564828-102564850 GTGCTAGGTTTTACGTTAAATGG + Intergenic
1188905589 X:35787281-35787303 GTCCTAGGATCAAGGTTAAATGG + Intergenic
1190914579 X:54801522-54801544 TTTCTAGCATCAAGGTCAAATGG - Intergenic
1191769261 X:64738274-64738296 GTCCTGTGATTAAGGTCAATGGG - Intergenic
1192661341 X:73045971-73045993 GTCCTGTGATTAAGGTCAATGGG - Intergenic
1194140606 X:90204364-90204386 GTCCTGTGATTAAGGTCAATGGG - Intergenic
1194802563 X:98290906-98290928 GTCCTAGGATCACGGTTAAATGG - Intergenic
1194880184 X:99241230-99241252 TTGCTAGGAGTAATGTCAAATGG - Intergenic
1195318654 X:103703180-103703202 GTCCTAGGATCATGGTTAAACGG - Intergenic
1196275873 X:113764502-113764524 GCCCTATGATTAAGGTCAATGGG + Intergenic
1200184412 X:154172807-154172829 GTGCCTGTATTAAGGTCACAGGG - Intergenic
1200190064 X:154209940-154209962 GTGCCTGTATTAAGGTCACAGGG - Intergenic
1200195817 X:154247749-154247771 GTGCCTGTATTAAGGTCACAGGG - Intergenic
1200201471 X:154284865-154284887 GTGCCTGTATTAAGGTCACAGGG - Intronic
1200486371 Y:3773484-3773506 GTCCTGTGATTAAGGTCAATGGG - Intergenic
1201305140 Y:12543247-12543269 GTGTTAAGATGATGGTCAAAGGG - Intergenic