ID: 1163483732

View in Genome Browser
Species Human (GRCh38)
Location 19:17574208-17574230
Sequence GGGGTGAGGCCTCTGTCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163483716_1163483732 20 Left 1163483716 19:17574165-17574187 CCACTGCCATTCCCACCACTGCG No data
Right 1163483732 19:17574208-17574230 GGGGTGAGGCCTCTGTCCCGGGG No data
1163483714_1163483732 30 Left 1163483714 19:17574155-17574177 CCTGCCAAAGCCACTGCCATTCC No data
Right 1163483732 19:17574208-17574230 GGGGTGAGGCCTCTGTCCCGGGG No data
1163483722_1163483732 5 Left 1163483722 19:17574180-17574202 CCACTGCGTAGATGGAGACTGGG No data
Right 1163483732 19:17574208-17574230 GGGGTGAGGCCTCTGTCCCGGGG No data
1163483715_1163483732 26 Left 1163483715 19:17574159-17574181 CCAAAGCCACTGCCATTCCCACC No data
Right 1163483732 19:17574208-17574230 GGGGTGAGGCCTCTGTCCCGGGG No data
1163483717_1163483732 14 Left 1163483717 19:17574171-17574193 CCATTCCCACCACTGCGTAGATG No data
Right 1163483732 19:17574208-17574230 GGGGTGAGGCCTCTGTCCCGGGG No data
1163483719_1163483732 9 Left 1163483719 19:17574176-17574198 CCCACCACTGCGTAGATGGAGAC No data
Right 1163483732 19:17574208-17574230 GGGGTGAGGCCTCTGTCCCGGGG No data
1163483720_1163483732 8 Left 1163483720 19:17574177-17574199 CCACCACTGCGTAGATGGAGACT No data
Right 1163483732 19:17574208-17574230 GGGGTGAGGCCTCTGTCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163483732 Original CRISPR GGGGTGAGGCCTCTGTCCCG GGG Intronic