ID: 1163483732

View in Genome Browser
Species Human (GRCh38)
Location 19:17574208-17574230
Sequence GGGGTGAGGCCTCTGTCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 202}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163483719_1163483732 9 Left 1163483719 19:17574176-17574198 CCCACCACTGCGTAGATGGAGAC No data
Right 1163483732 19:17574208-17574230 GGGGTGAGGCCTCTGTCCCGGGG 0: 1
1: 0
2: 0
3: 17
4: 202
1163483722_1163483732 5 Left 1163483722 19:17574180-17574202 CCACTGCGTAGATGGAGACTGGG 0: 1
1: 0
2: 0
3: 10
4: 90
Right 1163483732 19:17574208-17574230 GGGGTGAGGCCTCTGTCCCGGGG 0: 1
1: 0
2: 0
3: 17
4: 202
1163483720_1163483732 8 Left 1163483720 19:17574177-17574199 CCACCACTGCGTAGATGGAGACT 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1163483732 19:17574208-17574230 GGGGTGAGGCCTCTGTCCCGGGG 0: 1
1: 0
2: 0
3: 17
4: 202
1163483716_1163483732 20 Left 1163483716 19:17574165-17574187 CCACTGCCATTCCCACCACTGCG 0: 1
1: 0
2: 2
3: 35
4: 352
Right 1163483732 19:17574208-17574230 GGGGTGAGGCCTCTGTCCCGGGG 0: 1
1: 0
2: 0
3: 17
4: 202
1163483715_1163483732 26 Left 1163483715 19:17574159-17574181 CCAAAGCCACTGCCATTCCCACC 0: 1
1: 0
2: 4
3: 47
4: 410
Right 1163483732 19:17574208-17574230 GGGGTGAGGCCTCTGTCCCGGGG 0: 1
1: 0
2: 0
3: 17
4: 202
1163483714_1163483732 30 Left 1163483714 19:17574155-17574177 CCTGCCAAAGCCACTGCCATTCC 0: 1
1: 1
2: 1
3: 50
4: 342
Right 1163483732 19:17574208-17574230 GGGGTGAGGCCTCTGTCCCGGGG 0: 1
1: 0
2: 0
3: 17
4: 202
1163483717_1163483732 14 Left 1163483717 19:17574171-17574193 CCATTCCCACCACTGCGTAGATG 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1163483732 19:17574208-17574230 GGGGTGAGGCCTCTGTCCCGGGG 0: 1
1: 0
2: 0
3: 17
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163483732 Original CRISPR GGGGTGAGGCCTCTGTCCCG GGG Intronic
900465809 1:2824995-2825017 GGGGAGAAGACTCTGTCCCCAGG + Intergenic
900475928 1:2876409-2876431 GGGATGCGGCCTCTGTCTCTTGG + Intergenic
900613312 1:3553483-3553505 GTGGGGAGGCCTCTCTCCCGTGG - Intronic
900923737 1:5690320-5690342 GGGGTGGGGCCTGGGTCCCCTGG - Intergenic
900981899 1:6050443-6050465 AGGGTGAGGACTCAGCCCCGAGG + Intronic
901887176 1:12230860-12230882 GTGGTGGGGTCTCTGTCCCCTGG + Intronic
902208588 1:14888204-14888226 GGGCAGAGGCCTCTGTGCCTGGG - Intronic
902704189 1:18193097-18193119 GGGGTGAGGGCTGTGTCCAGGGG + Intronic
903295222 1:22339350-22339372 GTGGTGAGGCCTCAGCCCTGTGG - Intergenic
903321374 1:22545303-22545325 TTGGTGAGGCCTCGGGCCCGAGG + Intergenic
903734757 1:25523061-25523083 GGGGTGAAGTCTCTGACCCAAGG - Intergenic
904450211 1:30606172-30606194 GGGATGAGGCCTCTGCCCACCGG - Intergenic
904659378 1:32073209-32073231 GGGGTGGGGCCTCTGTTGTGGGG + Intronic
905371431 1:37484556-37484578 GGGATGGGGCATCTTTCCCGAGG + Intergenic
905515445 1:38558892-38558914 GGGAGGGGGCCTCTGACCCGAGG - Intergenic
905652864 1:39668246-39668268 GGGGTGATGGCCCTGTCCCTGGG - Intronic
905867782 1:41385639-41385661 GGGCTGGGGCATCTGTCCCAGGG - Intergenic
907248870 1:53124752-53124774 GAGGTGAGACCACAGTCCCGAGG + Intronic
907409421 1:54274023-54274045 GGGGTGGTGCTTCTGTCCCCTGG + Intronic
912962400 1:114207814-114207836 GTGGTGAGGCCCGTGCCCCGCGG - Intergenic
915216911 1:154346514-154346536 GGAGTGAGCCTTCTGTCCCTGGG + Intronic
915558532 1:156673550-156673572 GGGGTCAGCCCTCTGCCCCCAGG + Intronic
916178153 1:162060164-162060186 GAGCTCAGACCTCTGTCCCGTGG - Intergenic
919895492 1:202007448-202007470 CTGGAGAGGCCTCTGCCCCGTGG + Intergenic
919981486 1:202644849-202644871 GGAGTGAGGTCTATGTCCTGGGG - Intronic
920170029 1:204066133-204066155 GGGTTGGGTCCTCTGTCCCTGGG + Intergenic
920170042 1:204066191-204066213 GGGTTGGGTCCTCTGTCCCTGGG + Intergenic
920191902 1:204199088-204199110 GGGGAGAGGCCACTGCCCCTGGG + Intronic
921358231 1:214306383-214306405 GGGGAGGGGCCGCTGTCCCTGGG - Intronic
924077242 1:240352946-240352968 GGGGTGAGCCCTTTGTCACTGGG - Intronic
1063376756 10:5558614-5558636 GAGGCGAGGCCACTGTCCCCAGG + Intergenic
1063887052 10:10590057-10590079 GAGGTGAGGCCACTGTCTGGGGG + Intergenic
1064137907 10:12766386-12766408 GGAGTGTTGCCTCTGTCCCCAGG + Intronic
1064442912 10:15370439-15370461 GGGGTGCCCCCTGTGTCCCGGGG - Intronic
1067040556 10:42951231-42951253 GGAGTGAGCTCGCTGTCCCGAGG + Intergenic
1072625398 10:97107967-97107989 GGGGTGAGGCTCCGGTCCGGGGG + Intronic
1074359541 10:112814163-112814185 GGTGTGGGGTCTCTGTTCCGTGG + Intronic
1075066701 10:119293723-119293745 GTGGTGCTGCCTCTGCCCCGAGG + Intronic
1076765924 10:132633050-132633072 TGGAGGAGGCCTCTGTCCCCAGG + Intronic
1078090528 11:8262140-8262162 GGCCTGAGCCCTCTGTCCCTGGG - Intronic
1078879482 11:15433918-15433940 GAGGTGAGGGCTCTTTTCCGGGG + Intergenic
1083186257 11:61019561-61019583 GGTGTGAGCCCTCTGTCTCGGGG + Exonic
1084261891 11:67984269-67984291 GGGGTGAGGCCCCCCACCCGGGG - Intergenic
1084264397 11:67997454-67997476 GGGCTGAGGCCTGTGGTCCGAGG - Intronic
1084365272 11:68693493-68693515 GGTGTGCGGCCTCTGTGCAGGGG + Intergenic
1084455192 11:69264312-69264334 GTGGGGAGGCCTCTGTCACAGGG - Intergenic
1084564099 11:69919903-69919925 GGGGTGAGTCCTCCTTCCTGAGG + Intergenic
1084623326 11:70288931-70288953 TGGGTGTGGCCACTGTCACGGGG + Intronic
1084652695 11:70498506-70498528 GGGGTGGGGCCTCTGCCCCTGGG - Intronic
1084943701 11:72627649-72627671 GGGGTGTGGTCTTTGTCCCAAGG + Intronic
1085018078 11:73188402-73188424 GGGGTGTGGGCTCAGTCCCTTGG + Intergenic
1085267901 11:75248174-75248196 TGGGTCTGGCCTCTGTCCTGTGG - Intergenic
1089350671 11:117819941-117819963 AGGCTGAGGCCTCTGTCCCCAGG + Intronic
1090235749 11:125145549-125145571 AGGGTGAGGCCTCAGTGCTGGGG - Intergenic
1091273097 11:134331841-134331863 GGGGCGGGGCCTCTGTCGGGGGG - Intergenic
1092117931 12:6022720-6022742 CAGGTGAGGCCTCTATCCCTGGG - Exonic
1095178725 12:39122853-39122875 GGGGTGAGGCCTCTGGCTGCTGG - Intergenic
1095562929 12:43587014-43587036 GGGCTGAGGCATCAGTCCCTGGG - Intergenic
1095950686 12:47780287-47780309 GGGGTGAGGTCTCTGCACCCTGG + Exonic
1099041965 12:77667457-77667479 GGGGTGAGGCCTGTGACTTGTGG + Intergenic
1099153620 12:79146516-79146538 GGGTTAAGGCCTCTGTACTGTGG - Intronic
1101224616 12:102675714-102675736 GTGGTCAGTCCTCTGTCCCCAGG + Intergenic
1102589818 12:113948807-113948829 GGGGTGTGGCCTCCGGGCCGTGG - Intronic
1104892853 12:132148705-132148727 GGGGTGAGGCCTCCGCCCTGGGG - Intronic
1110318763 13:74136251-74136273 GCGGTGCGGTCTCTGTTCCGGGG + Intergenic
1114418980 14:22563937-22563959 GGGGTGAGGCCTGTGCTCCCAGG + Intergenic
1116270026 14:42751869-42751891 GTTGTGAGGGCTCTGTCTCGTGG + Intergenic
1117471613 14:56051678-56051700 GGAGTGAGGCCTGTCTCCAGGGG + Intergenic
1120978428 14:90270123-90270145 GGGCTGAGGCCTCTGAGCCATGG + Exonic
1122577528 14:102751455-102751477 GGGGTGAGGCCTGAGGCCCCTGG + Intergenic
1123031885 14:105455862-105455884 GGGAGGAGGCCTCTGTGCTGAGG + Intronic
1123034362 14:105465941-105465963 GGGTTGTGGCCCCTGTCCTGTGG + Intronic
1123047702 14:105526780-105526802 GGGGTGAGGCCTGGGGCCGGCGG + Intronic
1124077043 15:26456059-26456081 GAAGTGAGGGCTCTGTCCAGAGG - Intergenic
1126965313 15:54045531-54045553 GTGGTGGGGCCTCTGACCAGTGG + Intronic
1128469589 15:67941040-67941062 GGTGAGAGGCCTGTGTCCTGAGG + Intergenic
1129245120 15:74274575-74274597 GGTTTGAAGCCTCTGTCCCCAGG - Intronic
1129644763 15:77419907-77419929 GGGTTGAGGGCGCTGACCCGGGG - Intronic
1132657469 16:1047239-1047261 GAGATGGGGCCTCTTTCCCGGGG + Intergenic
1132978073 16:2720379-2720401 GGGGTGAGGGGTCTGCCCTGGGG - Intronic
1133132242 16:3684089-3684111 GCAGTGAGGCCTCTGCCCCCCGG - Intronic
1136267639 16:29130678-29130700 GGGGTGAGGACTGTGTCCCCTGG + Intergenic
1136501044 16:30669775-30669797 GGGTTGAGGCTTCTGTTCCCAGG - Exonic
1137031775 16:35531418-35531440 TGGGTGAGGGCTGTGGCCCGTGG - Intergenic
1139633867 16:68246311-68246333 GGGATGAGACCTCTGTCTGGGGG + Intronic
1140191080 16:72817624-72817646 GGAGGGAGGCCTCTGGCCAGAGG - Intronic
1140245693 16:73246002-73246024 GGGGAATGGCCTCTGTCCTGTGG - Intergenic
1140880132 16:79190492-79190514 GGTGTGAGGCCTCTCTCTTGGGG - Intronic
1141012811 16:80418704-80418726 GGGGAGAGGCCTCTGTGCTCTGG + Intergenic
1141788474 16:86217259-86217281 AGGGTGAGGACTCTGCCCTGGGG + Intergenic
1141902049 16:86997302-86997324 AGGGAGAGGGCTGTGTCCCGGGG - Intergenic
1142070944 16:88091022-88091044 GGGGTGAGGACCGTGTCCCCTGG + Intronic
1142363402 16:89637713-89637735 GGGCTGAGAGCTCTGTCCTGTGG + Intronic
1145786776 17:27598785-27598807 AGAGTGAGGCCTCTGTGCAGGGG - Intronic
1145992970 17:29090236-29090258 TGGGGGAGGCCTCTGGCCCAGGG - Intronic
1147210569 17:38870485-38870507 GGGGTGGGCTCTGTGTCCCGGGG + Intronic
1147324044 17:39661981-39662003 GTGGTGAGCTCTCTGTCCCTGGG + Intronic
1149237769 17:54612956-54612978 GGGGTCAGGCCTGTGTCCTTGGG - Intergenic
1152204350 17:78966540-78966562 GGGGTTCGGCAGCTGTCCCGAGG + Intergenic
1152577906 17:81150937-81150959 GGGGTCAGGCCAGTGTCCCTGGG + Intronic
1152643124 17:81457444-81457466 TGGGTGGTGCCTCTGTCCCCAGG - Exonic
1152814062 17:82397326-82397348 GGGGTGAGGGCAGTGTCCTGGGG + Intronic
1152891615 17:82884819-82884841 GGAGTGAGGCCTGTGTCTCTTGG + Intronic
1154154139 18:11930626-11930648 AGGTTGAGGCCTCGGTCCCCAGG + Intergenic
1157858481 18:51121584-51121606 CAGGTGGGGCCTCTGTCCTGGGG - Intergenic
1159034627 18:63264901-63264923 GGGATGAGGCCTCTGTGGCAAGG + Intronic
1160630987 18:80246637-80246659 GGGGTGGGGTGTCTGGCCCGGGG + Intronic
1160721815 19:600902-600924 GGGGTGCGGTTTCTGTCCGGGGG - Intronic
1160754635 19:751058-751080 TGGGTGGGGCCTCTGTTCCCTGG + Intergenic
1160951263 19:1668775-1668797 GGGCTGAGACCTCTGCCCTGTGG - Intergenic
1161428454 19:4217247-4217269 GGGTAGAGGCCACGGTCCCGGGG + Exonic
1161844802 19:6706680-6706702 AGGAGGAGGCCTCTGTCTCGGGG - Intronic
1162440210 19:10687927-10687949 TAGCTGAGGCCTCTGTCCCGAGG + Intronic
1163051747 19:14689808-14689830 GGGGTGGGGCTTAGGTCCCGGGG - Intronic
1163366739 19:16879739-16879761 GGGCTGAGGCGACTGTCCCATGG + Exonic
1163483732 19:17574208-17574230 GGGGTGAGGCCTCTGTCCCGGGG + Intronic
1163526532 19:17824829-17824851 GGGCTGAGGCCTCAGTACAGAGG - Exonic
1163722264 19:18903928-18903950 TGGGTGAGGCTTCAGCCCCGTGG + Intronic
1164855318 19:31516527-31516549 TGGATGAGGTCTCTGTTCCGGGG - Intergenic
1166269896 19:41707490-41707512 GGGTTGAGGCCTCATTCCTGGGG - Intronic
1168267992 19:55232608-55232630 AGTGTGAAGCCTCTGTCCAGAGG - Intronic
924988687 2:293185-293207 TGGGTGAGGGCTCAGTCCAGTGG + Intergenic
925093455 2:1173777-1173799 GGCGTGAGCCCTGTGTCCCAGGG - Intronic
925906598 2:8543505-8543527 TGAGTGAGGCCCCTCTCCCGGGG - Intergenic
927289782 2:21394058-21394080 GAGGTGAGGCCTTTGGGCCGTGG - Intergenic
927467544 2:23348414-23348436 GGGGGGAGCCCTGTGTCCTGGGG + Intergenic
927577057 2:24208753-24208775 GGGCTGAGGCCTGTGGCCCAAGG + Intronic
933216622 2:79637296-79637318 GGAGTGAGGCCTCAGTCAGGAGG + Intronic
936029483 2:109059688-109059710 GGGCAGAGGCCCCTGTCCCGGGG - Intergenic
937097032 2:119242194-119242216 GAGGAGAGGCTTCTGTCCAGAGG + Intronic
937909643 2:127069174-127069196 GGGGTGAGCTCTCTGCCACGAGG - Intronic
938314983 2:130319024-130319046 GGGGTGAGTGCCCTGTCCTGAGG - Intergenic
940601260 2:155863907-155863929 GGAGTGAGGCCACTGTTCGGTGG + Intergenic
947527258 2:230886276-230886298 GGAGGGAGTCCTGTGTCCCGAGG + Intergenic
947549671 2:231037470-231037492 GGGGCGTGTCCTCTGTGCCGGGG + Exonic
948151470 2:235747920-235747942 GGGGTGAGGCCTCCGCCCGCTGG + Intronic
948607585 2:239146035-239146057 GGAGCGAGGCCTCTGTGCTGTGG + Intronic
948738415 2:240025784-240025806 GGGGTGGGACCCCTGTCGCGGGG + Intergenic
949073232 2:242039253-242039275 GGAGGGAGGCCTCAGTCCCCGGG - Intergenic
1169273346 20:4217132-4217154 GGGGAGAGGGCTCTGTCCCCAGG - Intergenic
1169329671 20:4706416-4706438 AGAGGGAGGCCTCTGTCCCGTGG - Intergenic
1173496856 20:43525705-43525727 GTGGTCAGGCCTCTTTCCAGTGG + Intronic
1174202299 20:48815590-48815612 GCAGTCAGGCATCTGTCCCGTGG + Intronic
1175904503 20:62372759-62372781 GAGGGGAGGCCTTTGTCCTGAGG - Intergenic
1176029973 20:63007101-63007123 GGGGTGGGGGCTCTGGACCGAGG + Intergenic
1176265424 20:64206662-64206684 GGAGTGAGTGCGCTGTCCCGTGG + Intronic
1178721510 21:35014755-35014777 GGGCTGAGCCCTCTCTGCCGAGG + Intronic
1179642702 21:42757817-42757839 AGGGTGAGGCCTTGGTCCCATGG - Intronic
1180569366 22:16701134-16701156 CAGGTGAGGCCTCTATCCCTGGG - Intergenic
1180840155 22:18955334-18955356 GGGGTGAGGCCTCTATGGTGAGG + Intergenic
1181270020 22:21653222-21653244 GGGGCGGGGCCTCTGCCCGGGGG - Intronic
1181541291 22:23574533-23574555 GGGGTGACCCCTGTGTCCCCAGG + Intronic
1181797091 22:25318789-25318811 GGGGTGACGCCTGTGTCCCCAGG - Intergenic
1183320593 22:37162973-37162995 GGGGAGAAGCCTCTGGCCTGGGG - Intronic
1183661370 22:39223464-39223486 TGGGGGAGGCCTCTGTCTGGCGG - Exonic
1183742944 22:39678525-39678547 GGGGTAAGGCCTCGGTTCCGGGG + Intronic
1183947981 22:41337689-41337711 GGGGTGAGGACCCTGCCCTGTGG + Intronic
1185383039 22:50518857-50518879 GGGGCGAGGCCTCACTCCCATGG - Intronic
951196424 3:19828367-19828389 AGGGTGAGGGCTCAGTCCCCAGG + Intergenic
952166309 3:30753172-30753194 GGGGTGGGGCCTGTGTAGCGTGG - Intronic
953902489 3:46851226-46851248 GTGGTGAGCCCTCTGTTCTGAGG - Intergenic
954645996 3:52131865-52131887 GGGCTGTGGCCTCTGCCCCAGGG - Intronic
962686589 3:137853734-137853756 GTGGTGAGGTCTGTGTCCCCTGG - Intergenic
964021822 3:152022064-152022086 GGGGTGAGGCCTCTCTGCCAGGG + Intergenic
969497780 4:7535777-7535799 CAGGTGAGGCCTCTGTTCCATGG - Intronic
969524992 4:7699817-7699839 GGAGTGAGCTCTCTGTCTCGGGG - Intronic
969686717 4:8679588-8679610 GGGGTGAGGGGTCTGCCCTGGGG - Intergenic
970855667 4:20647686-20647708 GGGGTTGGGACTCTGTCCCAGGG + Intergenic
976612668 4:87045982-87046004 AGGGTGAGGCCTCAGTCACTTGG - Intronic
977433896 4:96968527-96968549 GAAGTGAAGCCTCTGTCCTGTGG + Intergenic
985648418 5:1095951-1095973 GGGGTGGGGCCGCTGCTCCGTGG - Intronic
985991447 5:3565296-3565318 GAGGTGGGGACTCTGTCCAGTGG - Intergenic
986558770 5:9039411-9039433 GGGGAGAAACCTCTGTCCCTAGG - Exonic
986691818 5:10319624-10319646 GGAGTGAAGCCTCTTTCCCAAGG + Intergenic
999142481 5:149371636-149371658 GGGATGAGGCCCCTGTCCCACGG + Intronic
999561834 5:152812075-152812097 GAGGTGAGGCCTCTGAACCAAGG - Intergenic
999755131 5:154658603-154658625 GGGATGTGGCCTCTGTCCCCTGG + Intergenic
999770690 5:154773473-154773495 GGGTTGAGGCCTCTGAGCCTGGG + Intronic
1001203207 5:169737999-169738021 TGGGTGAGGGCTCAGTCCCCAGG - Intronic
1003398343 6:5771976-5771998 GGAGTCAGGCCTCTGGCCCCAGG + Intergenic
1003853777 6:10251802-10251824 GGAGTGAGGGCTCTGTCCAAGGG + Intergenic
1006025144 6:31141986-31142008 GGGGAGAGGCCTCTGAGCAGGGG - Intergenic
1007073634 6:39053482-39053504 GGGGTGGGGCCCCAGTCCCCAGG + Intronic
1011056608 6:83211161-83211183 GGACTGTGGCCCCTGTCCCGAGG - Exonic
1012545507 6:100414401-100414423 GGGGTGAGGCCTCTGTAGTTTGG - Intronic
1017245647 6:152221908-152221930 GAGGTGAGGCCTCTGAACCAAGG - Intronic
1017538321 6:155372478-155372500 GGGGTGAAGCCTGTTTCCCCAGG - Intergenic
1018494730 6:164337684-164337706 GGGGTGAGGCCTCTGGTGAGCGG - Intergenic
1019258107 7:64457-64479 CTGGTGATGCCTCTGTCCTGGGG + Intergenic
1019615264 7:1956573-1956595 GGGGTGGGGGCTCTGCCCCTAGG - Intronic
1022408600 7:30118081-30118103 TGGGTGACGCCTCTCTCCAGGGG + Intronic
1023553310 7:41391989-41392011 GAGGAAAGGCCTCTGTCCCTGGG - Intergenic
1027314036 7:76974498-76974520 GGGGTGAGCCTTCTGCTCCGGGG - Intergenic
1027390317 7:77697034-77697056 GAGGTGAAGCCGCTGCCCCGAGG + Exonic
1034940636 7:155228166-155228188 GGGCTCAGGCCACTGTCCTGGGG + Intergenic
1035225835 7:157431677-157431699 GTGGGAAGGCCTCTGTCCCGCGG - Intergenic
1035766875 8:2113467-2113489 GGGGTGGGGCTTCTGTGCCCAGG + Intronic
1049469995 8:142770953-142770975 GGGGGGTGGCCTCTCTCCCACGG + Intronic
1049798627 8:144507642-144507664 GGGGTGGGGCCACTGTCTGGGGG + Intergenic
1053269361 9:36739701-36739723 GCTGTCAGGCCTCCGTCCCGGGG - Intergenic
1055507711 9:76964982-76965004 GGGGAAAGGCCTCTGTCTGGTGG + Intergenic
1056754447 9:89373146-89373168 GCGGAGAGGCCTGTGTCCTGGGG - Intronic
1057316035 9:93969119-93969141 TTGGTGAGGCCTCTGCCCAGGGG - Intergenic
1059308179 9:113370918-113370940 GGCCAGAGGACTCTGTCCCGGGG + Exonic
1060515029 9:124260099-124260121 GGGGTCAAGCCTGTGTCCTGGGG + Intronic
1060826888 9:126692896-126692918 GGAGTGAGGCGTGTGTGCCGGGG + Intronic
1060918734 9:127406061-127406083 CAGGTGTGGCCCCTGTCCCGGGG + Intronic
1061069309 9:128299169-128299191 GGGGTGGGGCTGCTGTCCCAGGG - Intergenic
1061488170 9:130930753-130930775 GAGGTGAGGCCCCTGGCCCAAGG - Intronic
1061884409 9:133584337-133584359 AGGGAGAGGCCTCTGACCCAAGG - Intronic
1061923274 9:133793821-133793843 GGAGTGAGCCCTCAGTCCCTAGG + Intronic
1062445015 9:136589984-136590006 TGGGTCAGGGCTCTGTCCCCCGG - Intergenic
1062452307 9:136620851-136620873 GGGCTGCGGCCTCCGTCCTGAGG - Intergenic
1062637389 9:137498697-137498719 TGGCTGGGGCCTCTGACCCGGGG + Intronic
1186812221 X:13201605-13201627 CGGTTCAGTCCTCTGTCCCGTGG - Intergenic
1195478989 X:105321083-105321105 GGGGTGGGGCATCTGTGCTGGGG + Intronic
1196679217 X:118453731-118453753 AGAGTGAGACCTCTGTCTCGGGG + Intergenic
1199627948 X:149757967-149757989 GGGGTGGGCCCCCTGTCCTGGGG + Intergenic
1199628713 X:149761855-149761877 GGGGTGGGCCCCCTGTCCTGGGG + Intergenic
1200057621 X:153469983-153470005 GCAGTGAGGGCTCTGTCCTGTGG + Intronic