ID: 1163485051

View in Genome Browser
Species Human (GRCh38)
Location 19:17580539-17580561
Sequence TGGAGTGAATGCAGGAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 455}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163485051_1163485055 25 Left 1163485051 19:17580539-17580561 CCTGGGCTCCTGCATTCACTCCA 0: 1
1: 0
2: 4
3: 36
4: 455
Right 1163485055 19:17580587-17580609 GCTGAGCCTGCTCCCATCCCAGG 0: 1
1: 1
2: 1
3: 36
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163485051 Original CRISPR TGGAGTGAATGCAGGAGCCC AGG (reversed) Intronic
900925715 1:5705015-5705037 TGGGGTCAATGCAGGTCCCCTGG + Intergenic
901093114 1:6656649-6656671 TGGAGGGATTGCTTGAGCCCAGG + Intronic
902995644 1:20222709-20222731 TGGAGTGCATGCAGGAGGGGAGG + Intergenic
903071783 1:20730400-20730422 GGGAGGGACTGCAGCAGCCCTGG - Intronic
903206543 1:21786596-21786618 TGGAGGGATTGCTTGAGCCCAGG + Intergenic
903797111 1:25937731-25937753 TGGAATGATTGCTTGAGCCCAGG - Intergenic
904003411 1:27350988-27351010 TGGGGTAAATGCAGGAGACCCGG - Intronic
904254126 1:29243816-29243838 AGGGGTGAATGCAGGAGCTGGGG + Intronic
904377280 1:30089905-30089927 TGGAGGGACTACAGAAGCCCTGG + Intergenic
904434275 1:30484118-30484140 TGGAGTGAAGTCAGGAGCTTGGG - Intergenic
904793474 1:33041157-33041179 TGGAAGGATTGCATGAGCCCAGG + Intronic
905177566 1:36147404-36147426 TGGAGGGACTGCTTGAGCCCAGG + Intronic
905578056 1:39061895-39061917 TGGAAGGATTGCTGGAGCCCAGG - Intergenic
906492362 1:46278551-46278573 AGGAGGGAAGGCAGGAACCCAGG + Exonic
906526587 1:46496823-46496845 TGGAGTTGGGGCAGGAGCCCTGG + Intergenic
906948735 1:50317324-50317346 TGGAGTGAAGGAAGGTGGCCTGG - Intergenic
906995451 1:50788922-50788944 TGGATTGATTGCTGGAGTCCAGG - Intronic
908697375 1:66858446-66858468 TGGCGTGAACCCAGGAGGCCGGG + Intronic
908931559 1:69322102-69322124 TGGTGTGGATTCAGAAGCCCAGG - Intergenic
909308360 1:74112016-74112038 GGGAGAGAATACTGGAGCCCTGG + Intronic
910774895 1:90864923-90864945 TGGAAAGATTGCATGAGCCCAGG + Intergenic
912658353 1:111507584-111507606 TGCAGTGTTAGCAGGAGCCCAGG + Intronic
913276754 1:117145724-117145746 TGGAAGGATTGCATGAGCCCAGG - Intronic
913365141 1:118029155-118029177 TGGAATGACTGCTTGAGCCCAGG + Intronic
914490188 1:148146793-148146815 TGCAGTGGAGGCGGGAGCCCAGG - Intronic
914890025 1:151613333-151613355 AGGAGTGAAGGCAGGAGGCCAGG - Intronic
919043031 1:192416326-192416348 TGGAGTGAACCCTGGAGTCCAGG - Intergenic
919481140 1:198091408-198091430 TGAAGTGAGGGCATGAGCCCTGG + Intergenic
919691289 1:200530704-200530726 TAGCTTGAATGCAGGAGCCCAGG - Intergenic
919883678 1:201917338-201917360 TGCAGTGAATGCAGAAGCCTTGG - Intronic
920002181 1:202807787-202807809 TGGAGTGATGGCAGGAGCCGGGG - Intronic
920238594 1:204527065-204527087 TGGAGGGATTGCATGAACCCAGG + Intronic
920352510 1:205346830-205346852 TGCAGTGAAGAAAGGAGCCCAGG + Intronic
920907580 1:210186202-210186224 TGGATTGATTGGAGGAGCTCTGG + Intergenic
921135751 1:212257521-212257543 TAGGGGGAATGCATGAGCCCAGG + Intergenic
922744528 1:228036811-228036833 TGCAGTGGATGCAGCAGCCCAGG + Intronic
923773733 1:236960062-236960084 TGGAGGGATTGCTTGAGCCCAGG + Intergenic
924039058 1:239965450-239965472 CGGAGTGAAAGCCGGAGACCTGG + Intergenic
924043411 1:240005817-240005839 TGGAGGGATTGCTTGAGCCCAGG + Intergenic
924060523 1:240169557-240169579 CGGAAGGAATGCATGAGCCCGGG - Intronic
924227206 1:241932045-241932067 AGGAGTGGATGGAGGAGTCCAGG + Intergenic
924419739 1:243897007-243897029 TGGAGTGTAGGCAGAAGCCTTGG + Intergenic
924514987 1:244758474-244758496 TGGAAGGACTGCATGAGCCCAGG - Intergenic
1063441182 10:6074684-6074706 TGGCGTGACTGCATGAGCCAGGG + Intergenic
1063524578 10:6772969-6772991 TTTAGTGAGTGCAGGAGCCATGG - Intergenic
1063604216 10:7508360-7508382 TGGAGGGAAAGAAGGGGCCCAGG + Intergenic
1065617714 10:27545999-27546021 TGGGATGATTGCATGAGCCCAGG - Intergenic
1066322372 10:34316960-34316982 TGGGAGGAATGCTGGAGCCCAGG - Intronic
1067661667 10:48240722-48240744 TGGAGGGAATGCATGAGCAAAGG - Intronic
1069797339 10:71061831-71061853 CGGAGTGAAGACCGGAGCCCAGG + Intergenic
1071498951 10:86190077-86190099 TGAAGGGAAGGCAGGAGCCTGGG - Intronic
1072158389 10:92744296-92744318 TGAAGGGAAAGCAGCAGCCCAGG - Intergenic
1072201246 10:93160927-93160949 TGGTGTGAATGTGGGAGGCCTGG + Intergenic
1072310622 10:94150843-94150865 TGCAGTGAGTGAAGGTGCCCAGG + Intronic
1072801109 10:98393029-98393051 TGGAGGGAATGCAGGGGGCCTGG - Exonic
1073264536 10:102217383-102217405 TGGGAGGAATGCAGGATCCCAGG + Intergenic
1073425468 10:103452893-103452915 AGGATTGAATTCAGGAGCCTAGG + Intergenic
1074111053 10:110423125-110423147 GTGAGTGAATGGGGGAGCCCAGG + Intergenic
1075416225 10:122266516-122266538 AGGAGTGAATGAGGCAGCCCTGG + Intergenic
1075600021 10:123760994-123761016 TGCATTGACTGCAGGACCCCAGG - Intronic
1075640201 10:124059199-124059221 TGCAGTGATCTCAGGAGCCCAGG + Intronic
1075804229 10:125173796-125173818 TGGAGGGATTGCTTGAGCCCAGG + Intergenic
1076319590 10:129568191-129568213 TCAAGTGAAGGCAGGAGGCCTGG - Intronic
1076345300 10:129775136-129775158 TTCAGTGCATGCAGGAGCCCAGG - Intergenic
1076478597 10:130769347-130769369 TGGGGTGAGGGCAGGGGCCCTGG + Intergenic
1076675180 10:132143954-132143976 TGGGGTGATGGGAGGAGCCCAGG + Intronic
1076791314 10:132778387-132778409 TGGGTGGAATGCTGGAGCCCAGG - Intronic
1077134068 11:990060-990082 TTTAGTGAACGGAGGAGCCCAGG + Intronic
1077400254 11:2352118-2352140 TGGAGTCAAGGGAGGAACCCAGG - Intergenic
1077591073 11:3491420-3491442 TGGAGTGTAGGCAGGACCCGTGG + Intergenic
1077722700 11:4644027-4644049 TGAGGTGAGTGCAGGAGGCCAGG + Exonic
1078155926 11:8800044-8800066 TGGAATGATTGCTTGAGCCCTGG - Intronic
1078849625 11:15151793-15151815 TGGGGTGTAAGCTGGAGCCCAGG + Intronic
1079160633 11:17990065-17990087 TGCAGTGAAAGCAGAAGACCTGG - Intronic
1079447018 11:20566803-20566825 TGGAAGGAATGCTTGAGCCCCGG + Intergenic
1081542393 11:44045345-44045367 TGGAAGGAACGCTGGAGCCCAGG + Intergenic
1081744261 11:45462033-45462055 TGCTGTGAATGCAGCAGCCCTGG + Intergenic
1082069760 11:47929447-47929469 AGGGGAGAATGCTGGAGCCCAGG + Intergenic
1083414139 11:62514355-62514377 TTGAGTGAAAGCAGCACCCCGGG + Intronic
1083550854 11:63589219-63589241 TGGCCTGACTCCAGGAGCCCAGG + Intronic
1083934946 11:65865276-65865298 TGGGGAGAAGGCAGCAGCCCTGG + Exonic
1084246786 11:67863171-67863193 TGGAGTGTAGGCAGGACCCGTGG + Intergenic
1084290149 11:68159310-68159332 TGTAGGGAATGCAGGTGCGCTGG - Intronic
1084803474 11:71562858-71562880 TGCAGTGAATCCTGTAGCCCTGG - Intronic
1084825892 11:71731321-71731343 TGGAGTGTAGGCAGGACCCATGG - Intergenic
1085510931 11:77087877-77087899 TGGGCTGAAGGCAGGTGCCCAGG - Intronic
1085646211 11:78224684-78224706 TGGCTTGAGTGCAGGATCCCAGG - Intronic
1087006475 11:93476885-93476907 TCTAGTGAGTGGAGGAGCCCTGG - Intergenic
1089665203 11:120013824-120013846 AGGAGTAAAGGCAGGAGCCGGGG - Intergenic
1090486620 11:127118331-127118353 TGTAGAGGATGCAGGGGCCCAGG + Intergenic
1090765136 11:129869917-129869939 TGGAGTGGATGAAGGGGCACTGG + Exonic
1092741122 12:11630550-11630572 TGGAGGGAGTGGAGGTGCCCGGG - Intergenic
1094805055 12:34082726-34082748 TGGAAGGAATGCAGGAGCCCAGG + Intergenic
1095117070 12:38367638-38367660 TGGAAGGAATGCGGGAGCCTAGG + Intergenic
1095419135 12:42007067-42007089 TGCAGTGAATGAAGCATCCCTGG - Intergenic
1096541048 12:52307377-52307399 TGGAGTGAACTCAGGAGCTTTGG + Intronic
1096768925 12:53920024-53920046 TGGAAGGATTGCTGGAGCCCAGG - Intergenic
1096859632 12:54515916-54515938 AGGAGTCAAGGCAGGAGCACAGG + Intronic
1097046181 12:56189263-56189285 TGGAGGGTAGGCAGGATCCCGGG + Intronic
1098273611 12:68792238-68792260 TGGAAGGATTGCTGGAGCCCAGG - Intronic
1098445722 12:70563918-70563940 CTGAATGAATGCAGGGGCCCTGG - Intronic
1102170750 12:110840760-110840782 TGGACAGAATGCTGGAGTCCTGG - Intergenic
1102453420 12:113057266-113057288 TGGAGGGAAGGCAGGGGCCGGGG - Intronic
1102498877 12:113337717-113337739 TGGGGGGATTGCATGAGCCCAGG - Intronic
1103171125 12:118820967-118820989 TGGGATGATTGCTGGAGCCCAGG - Intergenic
1103789798 12:123461528-123461550 TGGAGTGACAGAAGGAGCACAGG - Intronic
1104537051 12:129627892-129627914 TGGAATGATTGCTTGAGCCCAGG + Intronic
1104743149 12:131193533-131193555 TGGAGGTGATGCAGGTGCCCAGG - Intergenic
1104755926 12:131269349-131269371 GGGAGTCAACGCAGGAGCCCGGG - Intergenic
1104777786 12:131401332-131401354 GGGAGTCGACGCAGGAGCCCGGG + Intergenic
1104918812 12:132279922-132279944 GGAAGTGAATCCAGGAGACCTGG - Intronic
1106279326 13:28250286-28250308 TGGAAGGATTGCTGGAGCCCAGG - Intronic
1106436708 13:29729695-29729717 TGGAGTAAATGCAGGAGGAGGGG - Intergenic
1110375015 13:74783528-74783550 TGGAAGGATTGCATGAGCCCAGG + Intergenic
1111636181 13:90907274-90907296 GTGAGTGAGTGCAGGAGCCCGGG + Intergenic
1112471857 13:99696455-99696477 TGGAAGGATTGCTGGAGCCCAGG - Intronic
1112939153 13:104840049-104840071 TGGAGGGAAAGCAGGAACTCAGG - Intergenic
1113650950 13:112033884-112033906 TGGAGAGCTTGCAGGAGCCACGG - Intergenic
1114075664 14:19159885-19159907 TGCAGTGAACACGGGAGCCCAGG - Intergenic
1114086497 14:19239687-19239709 TGCAGTGAACACGGGAGCCCAGG + Intergenic
1114740119 14:25088250-25088272 TGGAAGGAATGCTTGAGCCCAGG + Intergenic
1115677473 14:35695138-35695160 TGGGAGGAATGCTGGAGCCCAGG + Intronic
1116472956 14:45306470-45306492 AGGAGTGAGTGAAGGAACCCTGG - Intergenic
1118251234 14:64163507-64163529 TGGAGAGAGTGCAGGGGGCCCGG - Exonic
1118625497 14:67655110-67655132 TGGAATGATTGCTTGAGCCCAGG + Intronic
1119128930 14:72153961-72153983 TGAAGTTACTGCAGGAGACCAGG + Intronic
1120877240 14:89386320-89386342 TCTAGTGAAAGCAGGAGCACTGG + Intronic
1121482517 14:94290160-94290182 AAGAGGGAAGGCAGGAGCCCGGG + Exonic
1121632719 14:95432766-95432788 TGGAGTGGCATCAGGAGCCCTGG - Intronic
1121796700 14:96741741-96741763 TCGTGTAAATGCACGAGCCCAGG - Intergenic
1121952934 14:98187696-98187718 TGGAGTCACGGCTGGAGCCCAGG + Intergenic
1121966043 14:98306696-98306718 TGGAGTGGAATCAGGAGTCCAGG + Intergenic
1122857962 14:104568968-104568990 GGGGCTGAGTGCAGGAGCCCTGG - Intronic
1122955224 14:105067256-105067278 TGGAGGGCAGGCAGGAGCCTGGG + Intergenic
1123736346 15:23187897-23187919 TGGCGTGAACCCAGGAGGCCAGG + Intergenic
1123826628 15:24088555-24088577 TGGGATGAATGCTGGAACCCAGG - Intergenic
1123851105 15:24358012-24358034 TGGGATGAATGCTGGAACCCAGG - Intergenic
1123855996 15:24412251-24412273 TGGGATGAATGCTGGAACCCAGG - Intergenic
1123860917 15:24465828-24465850 TGGGATGAATGCTGGAACCCAGG - Intergenic
1124029343 15:25995296-25995318 TGTAATGAATGCAGGATCTCAGG - Intergenic
1124166507 15:27330871-27330893 CAGAGTGAATGTAGGAGCCAGGG + Intronic
1125410952 15:39405663-39405685 TCGAGTCATTGCAGGAGCCCTGG + Intergenic
1125452782 15:39826393-39826415 TGGAGTAAAGACAGGACCCCAGG + Intronic
1125836586 15:42757197-42757219 TGGAGGGATTGCTTGAGCCCAGG - Intronic
1125927432 15:43574229-43574251 GGGAACGAATGCAGGACCCCAGG - Exonic
1125940575 15:43673794-43673816 GGGAACGAATGCAGGACCCCAGG - Intergenic
1126769932 15:52045611-52045633 TGTAGTGAAATCTGGAGCCCGGG + Intronic
1126999660 15:54487188-54487210 CGGAATGAATCCAGGATCCCTGG - Intronic
1127719362 15:61684655-61684677 GGGAGAGATTGCAGGAGCACAGG - Intergenic
1128674925 15:69601500-69601522 TGGAGTGAAGGAAAGAGCACTGG + Intergenic
1128682243 15:69660541-69660563 TGGAGTCAATGACGGAGACCTGG + Intergenic
1129156115 15:73719267-73719289 TGGTCTGAATGCAGGAACTCAGG - Intergenic
1130358230 15:83154959-83154981 TGGAAGGATTGCATGAGCCCAGG - Intronic
1130562528 15:84969786-84969808 GGGAGAGAATGCAGGATCCCAGG + Intergenic
1130754866 15:86752550-86752572 TAGGGAGAATGCAGGAGCACAGG + Intronic
1130911600 15:88274777-88274799 AGGCGTGACTGCAGGAGCCCTGG - Intergenic
1131500926 15:92965469-92965491 TGGCGTCAACCCAGGAGCCCAGG + Intronic
1132089395 15:98935666-98935688 TGGAGGGAATGCAGGAACAAAGG - Intronic
1132113015 15:99116024-99116046 TGGAGTCCATGGAGGAGCCACGG + Intronic
1132208046 15:99999845-99999867 TGGGGTGGAGGGAGGAGCCCAGG - Intronic
1133562298 16:6961329-6961351 TGGAGTGGACGCAGGGACCCAGG - Intronic
1134116359 16:11551737-11551759 TGGGCGGATTGCAGGAGCCCAGG + Intronic
1136020236 16:27435544-27435566 TGGAGGGATTGCTTGAGCCCAGG - Intronic
1136403086 16:30029018-30029040 TGGAGTGGATGCCGGATGCCTGG + Intronic
1136639691 16:31553054-31553076 TGGAGTGAGTGCAGGAGCAAAGG - Intergenic
1137386370 16:48046560-48046582 TGGATTGATTGCTTGAGCCCAGG + Intergenic
1137387541 16:48055444-48055466 TGGGGAGAATGCAGGAGGGCTGG + Intergenic
1138353616 16:56360523-56360545 TGATGTGAATCCAGGTGCCCAGG - Intergenic
1139839158 16:69864273-69864295 TGGGAGGATTGCAGGAGCCCAGG + Intronic
1140025580 16:71287659-71287681 TGGAGGGATTGCTTGAGCCCAGG - Intronic
1140543093 16:75777835-75777857 TGGGATGATTGCATGAGCCCAGG + Intergenic
1142625149 17:1187107-1187129 AGGAGTGGCTGCAGGAGCCGAGG + Intronic
1142698714 17:1647066-1647088 TGGAGGGACTGCAGGGCCCCCGG + Intronic
1142806302 17:2372833-2372855 TGTAGTGACTGCTGAAGCCCAGG - Intronic
1143070135 17:4284933-4284955 GGGATTGATTGCATGAGCCCAGG - Intronic
1143358982 17:6352117-6352139 TGGAGGGAATGCTTGAGGCCAGG - Intergenic
1143574411 17:7782060-7782082 GGGAGTAAAAGCAGGAACCCTGG + Intronic
1144482417 17:15638891-15638913 TGGAGTGAATTGCTGAGCCCTGG - Intronic
1144916266 17:18726141-18726163 TGGAGTGAATTGCTGAGCCCTGG + Intronic
1145038497 17:19558670-19558692 TGGAATGATTGCTTGAGCCCAGG - Intronic
1145190782 17:20841396-20841418 TGCAGTGGAGGCGGGAGCCCAGG - Intronic
1146916261 17:36680281-36680303 GGGAGTGGAGGAAGGAGCCCAGG + Intergenic
1147047987 17:37768906-37768928 TGAAGAGAGTGCAGGAGCACAGG + Intergenic
1147057641 17:37846532-37846554 TGGTGGGATTGCACGAGCCCAGG - Intergenic
1147293096 17:39459526-39459548 TGGATGGAATGCTTGAGCCCAGG + Intergenic
1147874307 17:43610173-43610195 CGGAGTGAGTGCTGGAGTCCAGG - Intergenic
1147879544 17:43645111-43645133 GGGAATGGCTGCAGGAGCCCGGG + Intronic
1148087210 17:45001380-45001402 TGAAGTGAAGACAGGAGACCTGG - Intergenic
1148857665 17:50587584-50587606 TGGAGGGAATACCGGGGCCCTGG + Intronic
1150416027 17:64989467-64989489 TGGAAAGAATGCTTGAGCCCAGG - Intergenic
1151166853 17:72211260-72211282 GGAAATGAATGCAGGTGCCCAGG - Intergenic
1151871595 17:76840476-76840498 AGCAGCAAATGCAGGAGCCCTGG - Intergenic
1153519281 18:5937030-5937052 AGGAGAGTATGCAGGAGCCGAGG + Intergenic
1154358209 18:13638789-13638811 TAGAGTGACTCCATGAGCCCTGG + Intronic
1156487718 18:37477217-37477239 TGGAGTTAATGGAGCAGCCTGGG + Intronic
1156574958 18:38304423-38304445 TGGACTTAATTCAGGAGGCCTGG + Intergenic
1158286087 18:55884742-55884764 TGGAGTGAGTCTAGGTGCCCAGG - Intergenic
1159174435 18:64814890-64814912 TGGAGTGCATTCAGAAGCACTGG + Intergenic
1159948104 18:74458262-74458284 TTCAGTGAATGCAGGAGCCCCGG - Intergenic
1160039791 18:75335164-75335186 TGGCATGACTGCAGGAGCCTGGG - Intergenic
1160073393 18:75648486-75648508 TGGAGTAATAGCAGGAACCCTGG + Intergenic
1160447616 18:78939786-78939808 CGGTGTGAATGCAGGAGAGCTGG - Intergenic
1160973781 19:1782365-1782387 TGGAGTGGCTGCTGGTGCCCGGG - Exonic
1160995423 19:1880027-1880049 TGCAGTGGAGGCGGGAGCCCAGG + Exonic
1161276240 19:3419379-3419401 TGGGGGGATTGCTGGAGCCCAGG + Intronic
1162219387 19:9163335-9163357 TTGAGTGTCTGCAGCAGCCCTGG + Exonic
1162928829 19:13945425-13945447 TGGAAGGATTGCATGAGCCCGGG + Intronic
1163485051 19:17580539-17580561 TGGAGTGAATGCAGGAGCCCAGG - Intronic
1163690561 19:18736211-18736233 TGGAATGAAGGCAGGAGGCCTGG - Intronic
1163891785 19:20023041-20023063 TGGAGCAAAGACAGGAGCCCTGG - Exonic
1164310999 19:24046220-24046242 TGGAGGGAAAGAAAGAGCCCTGG + Intronic
1164452172 19:28375945-28375967 TGGGAGGATTGCAGGAGCCCAGG + Intergenic
1165069550 19:33247708-33247730 TGGAGTGAAGGGAAGAGGCCGGG - Intergenic
1165853356 19:38864528-38864550 TGGAATGATTGCTTGAGCCCAGG - Intergenic
1166046124 19:40232170-40232192 TGGGGTGTGTGCAGGAGCTCAGG - Exonic
1167242890 19:48355670-48355692 AGGGGTGAATGCAGCAGGCCTGG + Intronic
1167420542 19:49400133-49400155 TGGAAAGACTGCACGAGCCCGGG + Intronic
1167447151 19:49544309-49544331 TGGAGTGAAGGAGGGAGCCACGG + Intronic
1167898980 19:52604186-52604208 TGGAGTGAGGGAAGGAGCCCTGG + Intronic
1168638713 19:58016172-58016194 TGGAGTGGATGAAGCAGCCGTGG + Intergenic
925082857 2:1083465-1083487 TGGTGTGAGGGCAGGAGCCAGGG - Intronic
926198756 2:10778740-10778762 TGGAGAGAAGGCAGGAGCTGGGG - Intronic
927087768 2:19688357-19688379 TGGAGTGCCAGCAGTAGCCCAGG + Intergenic
927313970 2:21660789-21660811 TAGAGTCAATGCAGGAGCTCAGG - Intergenic
927797515 2:26063028-26063050 TGGCTTGAATGCAGGAGGCAGGG + Intronic
927843280 2:26458335-26458357 AGCAGTGAATGCTGGAGCCAGGG + Intronic
927856773 2:26532676-26532698 GGGAGTGATCTCAGGAGCCCGGG + Intronic
928657980 2:33473036-33473058 TGGAGGGAATGCAGGAGTTAGGG + Intronic
932150020 2:69362352-69362374 TGGAGGGATTGCCTGAGCCCAGG - Intronic
932450102 2:71804148-71804170 TACAGTGAATGTTGGAGCCCTGG - Intergenic
937468274 2:122153924-122153946 TGGATTGAATGCAGTAGCTGAGG + Intergenic
937854669 2:126663682-126663704 TGCAGTGAATGCTGGGGCCCAGG - Intronic
938375178 2:130800164-130800186 TGCACTGAATGCTGCAGCCCTGG + Intergenic
939508242 2:143075418-143075440 TGGAGTGAACCCAGGAGGCGGGG - Intergenic
941004942 2:160238321-160238343 TGGACTGAATGCAGGACTCTAGG - Intronic
941633612 2:167911074-167911096 TGGGCTGATTGCATGAGCCCAGG - Intergenic
941835862 2:170019866-170019888 TGGAAGGAATGCTTGAGCCCAGG - Intronic
942005049 2:171689802-171689824 TGGAAGGATTGCTGGAGCCCAGG - Intronic
943094488 2:183412020-183412042 TGGTGGGCATGCAGGGGCCCAGG + Intergenic
943444601 2:187968326-187968348 TGTAATGAATGCAGGAGTACAGG + Intergenic
945384491 2:209180555-209180577 AGTAGTGAAGGCAGTAGCCCAGG + Intergenic
945977768 2:216283879-216283901 TGGTGGGGGTGCAGGAGCCCAGG - Intronic
946135546 2:217644018-217644040 TAGAGTGAATGGAGGAGTCCTGG + Intronic
946331774 2:219013608-219013630 GGGAGTGAGTTCTGGAGCCCTGG + Intronic
947524997 2:230872304-230872326 TGGAGATAATGCAAAAGCCCCGG - Intronic
947826541 2:233109342-233109364 TGAGGTGACTGCAGCAGCCCAGG - Intronic
948111329 2:235458429-235458451 TGGAGTGGGGGCAGGAGACCTGG - Intergenic
948162512 2:235836703-235836725 AAGAGTGGATGAAGGAGCCCTGG - Intronic
948547377 2:238742511-238742533 TGAAGTGAACCCAGGAGACCTGG - Intergenic
1168896652 20:1328372-1328394 AGGAGTGGGAGCAGGAGCCCAGG + Intronic
1170476389 20:16719028-16719050 TGGGGAGAATGCTTGAGCCCAGG + Intergenic
1170652733 20:18257463-18257485 GGGAGTCACTGCAGGTGCCCAGG + Intergenic
1170950471 20:20931463-20931485 AGGAGCGAATGCAGGAATCCAGG - Intergenic
1170987483 20:21271875-21271897 TGGAGAGAACCCAGGAACCCAGG + Intergenic
1171305782 20:24104668-24104690 TGGAGTCGTTGAAGGAGCCCAGG + Intergenic
1172575800 20:36007613-36007635 TGGAAGGATTGCATGAGCCCAGG - Intronic
1172888740 20:38248965-38248987 TGGAAGGATTGCTGGAGCCCAGG - Intronic
1173118391 20:40268199-40268221 TGGAGAGAATGCAGCTTCCCAGG + Intergenic
1173646232 20:44634795-44634817 TGGAGAGAATGAGGGATCCCGGG - Intronic
1173663867 20:44751991-44752013 TGGTGGGAAGGCAGGAGCCTGGG - Exonic
1173752754 20:45489723-45489745 GGGAGTGAATGGAGATGCCCTGG - Intergenic
1174665894 20:52257348-52257370 TGGGATGATTGCTGGAGCCCAGG + Intergenic
1175619530 20:60431576-60431598 TGGAGAGGAAGCAGGAGACCGGG - Intergenic
1177092754 21:16790066-16790088 TGGAAGGACTGCTGGAGCCCAGG - Intergenic
1177785834 21:25670390-25670412 TGCAGTGATCGCTGGAGCCCCGG + Intronic
1178427025 21:32487072-32487094 TGGAGCTATTTCAGGAGCCCAGG - Intronic
1179298753 21:40088098-40088120 TGGGGTGTAAACAGGAGCCCGGG + Intronic
1179576911 21:42313530-42313552 TGGAGTCAAAGCAGCAGCCCCGG + Exonic
1179926525 21:44538110-44538132 TGGGGTGACTGCAGCATCCCAGG + Intronic
1180291366 22:10853051-10853073 TGCAGTGAACACGGGAGCCCAGG - Intergenic
1180494171 22:15882473-15882495 TGCAGTGAACACGGGAGCCCAGG - Intergenic
1181334454 22:22117588-22117610 TGCAGTGGAGGCGGGAGCCCAGG + Intergenic
1181349838 22:22246952-22246974 TGGGGTGAATGCACGTTCCCAGG - Intergenic
1181495979 22:23287763-23287785 TGAATTGAATGCAGGAGGTCAGG + Intronic
1182087524 22:27571573-27571595 TGGTGAGAATGCAGATGCCCAGG - Intergenic
1182721778 22:32407980-32408002 TGGAAGGATTGCATGAGCCCAGG - Intronic
1182784229 22:32893225-32893247 TGGAGTGAATGGATAAGTCCTGG - Intronic
1183151235 22:36039072-36039094 TGGAAGGATTGCATGAGCCCAGG + Intergenic
1183388172 22:37526910-37526932 GGGTGTGAATGCAGGTGCTCCGG - Intergenic
1184350034 22:43937415-43937437 GGGAGTGATGGCAGCAGCCCAGG - Intronic
1185070217 22:48651939-48651961 GGCAGTGACTGCAGGAGCCAGGG + Intronic
1185081326 22:48710891-48710913 TGGAGTGACTGCTGGTGGCCAGG + Intronic
1185232271 22:49690012-49690034 TGGAGCGGCTGCAGGGGCCCTGG - Intergenic
950240205 3:11362866-11362888 GGCCGTGATTGCAGGAGCCCTGG + Exonic
950484261 3:13263815-13263837 TGGAGTGGATCCTGGAGCGCCGG + Intergenic
950496971 3:13339710-13339732 TGCAGTCACTGCAGGGGCCCTGG - Intronic
952109823 3:30109431-30109453 GTGAGTGGATGCAGGAGCCGGGG - Intergenic
952268405 3:31808564-31808586 TGGGGGAAATGCAGGAGCCTGGG + Intronic
952352778 3:32556635-32556657 TGGAGGGATTGCTTGAGCCCAGG - Intronic
952413190 3:33067506-33067528 TGGAGGGATTGCTTGAGCCCAGG - Intronic
952849244 3:37714070-37714092 TGGAACAAATGCAGGAGCCATGG + Intronic
954107204 3:48415774-48415796 GGGAATGAATGCAGGGGCGCAGG + Intronic
954405239 3:50341759-50341781 TGGAGGGGATGCAGGAGGCATGG - Intronic
955121617 3:56065447-56065469 TGGAAGGATTGCTGGAGCCCAGG - Intronic
955197628 3:56819900-56819922 TGGAAGGAATGCTTGAGCCCAGG - Intronic
955216546 3:56989012-56989034 TTCAGTGGCTGCAGGAGCCCTGG - Intronic
956674264 3:71719919-71719941 TGGAGGGATTGCTTGAGCCCAGG + Intronic
959181768 3:102989234-102989256 TGGAAGGATTGCTGGAGCCCAGG - Intergenic
959649474 3:108737715-108737737 TGAATTGAATGCAGGTGCCAGGG + Intergenic
960409591 3:117306487-117306509 TGGGGTAAATTCATGAGCCCTGG + Intergenic
960663423 3:120086438-120086460 TGTAGTTTATGCAGAAGCCCAGG + Intronic
960918371 3:122720877-122720899 TGGAAGGATTGCATGAGCCCAGG + Intronic
961292289 3:125857496-125857518 TGGAGTGTAGGCAGGACCCGTGG - Intergenic
961894907 3:130158905-130158927 TGGAGTGTAGGCAGGACCCGTGG + Intergenic
962236716 3:133713208-133713230 TTGAATGGATGGAGGAGCCCAGG - Intergenic
962336704 3:134538643-134538665 TGGAAGGATTGCTGGAGCCCAGG - Intronic
962413342 3:135160840-135160862 TGGAGGGAGTAGAGGAGCCCTGG + Intronic
962929948 3:140026912-140026934 GAGAGTGACTGCAGGAGCTCTGG + Intronic
963740348 3:149073599-149073621 TGGAAGGACTGCTGGAGCCCAGG + Intronic
966730605 3:183147942-183147964 TGGAATGATTGCATGAACCCGGG - Intronic
966997356 3:185296149-185296171 TGGAAGGATTGCTGGAGCCCAGG + Intronic
968360572 3:198144183-198144205 TGGAGTGAGTGCATGAGTCCAGG + Intergenic
968605871 4:1535038-1535060 TGGACTGAAAGGAGGAGACCCGG + Intergenic
968704352 4:2071047-2071069 TGGCCTGAAAGCAGGACCCCGGG + Intergenic
969005007 4:4011953-4011975 TGGAGTGAAGGCAGGACCCCTGG + Intergenic
969616873 4:8258380-8258402 AGGTGGGAATGCTGGAGCCCTGG - Intergenic
969672702 4:8598510-8598532 TGGAGTGGGTGCAGGGGGCCAGG - Intronic
969683738 4:8657386-8657408 TGGAGAGAACGCAGGAGCACGGG + Intergenic
969747862 4:9088190-9088212 TGGAGTGTAGGCAGGACCCGCGG - Intergenic
969808902 4:9632723-9632745 TGGAGTGTAGGCAGGACCCGTGG - Intergenic
970360004 4:15299610-15299632 TGAAATGAAAGCTGGAGCCCAGG - Intergenic
973613972 4:52660744-52660766 TGGGATGATTGCTGGAGCCCAGG - Intergenic
973631539 4:52825118-52825140 TGCTCTGCATGCAGGAGCCCTGG + Intergenic
973961889 4:56118669-56118691 TGGAGGGATTGCTTGAGCCCAGG + Intergenic
975356350 4:73409878-73409900 TGGAATGAATGCATGAACTCAGG - Intronic
975791820 4:77961365-77961387 TGGAATGATTGCTAGAGCCCAGG - Intergenic
977800011 4:101216776-101216798 TGGACTGATTGCGAGAGCCCAGG - Intronic
978025501 4:103868038-103868060 GTGAGTGAATGCATGACCCCAGG - Intergenic
978577607 4:110202049-110202071 TGGGCTGATTGCTGGAGCCCAGG + Intergenic
980541747 4:134204260-134204282 TGGAGGGACTGCTTGAGCCCAGG - Intergenic
980750890 4:137086446-137086468 TGGAAGGAATGCTTGAGCCCAGG - Intergenic
982812551 4:159844276-159844298 TGGAGGAAAAGCAGGAGCCTGGG - Intergenic
983428720 4:167620296-167620318 CGGGGTGAATGCAGGGGCACAGG + Intergenic
983635558 4:169894658-169894680 TGGAAGGATTGCACGAGCCCAGG + Intergenic
983682885 4:170373663-170373685 AGGGGTGAATGAAGGAGCCCTGG + Intergenic
984192387 4:176621264-176621286 TGGAAGGATTGCTGGAGCCCAGG - Intergenic
985565054 5:611535-611557 TGGAGTGAATCCAGACCCCCAGG - Intergenic
985587558 5:748806-748828 AGGGGTGGATGCTGGAGCCCTGG - Intronic
986034558 5:3925327-3925349 GGGACTGAATGCAGGAGCACTGG - Intergenic
986079618 5:4376319-4376341 TGGGCTGAATGCAGGATCCCAGG + Intergenic
986223422 5:5791084-5791106 TGGAAGGATTGCTGGAGCCCAGG + Intergenic
987324920 5:16804049-16804071 CAGAGTGAAGGCAGGAACCCTGG + Intronic
988535220 5:32061997-32062019 TGGATTGATTGCTTGAGCCCAGG - Intronic
990319620 5:54616953-54616975 TGATGTGATTGCAGGGGCCCTGG - Intergenic
990618305 5:57530787-57530809 TGCCCTGAAAGCAGGAGCCCTGG - Intergenic
992152586 5:73920017-73920039 TGAAATGAATGGAGGAGTCCAGG + Intronic
992373504 5:76169191-76169213 ATGATTTAATGCAGGAGCCCAGG + Intronic
994009949 5:94890089-94890111 TGGAAGGAATGCTTGAGCCCAGG - Intronic
994626987 5:102232452-102232474 GTGAGTGGATGCAGGAGCCAGGG + Intergenic
994802870 5:104401189-104401211 TCCTGTCAATGCAGGAGCCCTGG + Intergenic
995419209 5:111944398-111944420 TGGAGGGATTGCCTGAGCCCAGG - Intronic
996549272 5:124712688-124712710 TGGAGGGAAAGCAGGGACCCTGG - Intronic
997467085 5:134095388-134095410 TGGGGTGATTGCTTGAGCCCAGG + Intergenic
997690725 5:135825895-135825917 TGGTGTGACTGCACCAGCCCTGG - Intergenic
998737540 5:145159756-145159778 AGAAGTGAATGGAGGAGACCAGG - Intergenic
998757775 5:145399655-145399677 AGTAATTAATGCAGGAGCCCTGG - Intergenic
998886139 5:146696186-146696208 TGGCGTGAATCCAGGAGGCGGGG - Intronic
999062931 5:148654530-148654552 TGGAGGGCAGGAAGGAGCCCTGG + Intronic
1000287374 5:159838258-159838280 TGAAGTGCAGGCAGGAGCCAAGG - Intergenic
1001386360 5:171342781-171342803 GGGTCTGAATGCAGGCGCCCAGG - Intergenic
1001663491 5:173413655-173413677 TGCAGTTAATACAGGGGCCCTGG - Intergenic
1002147670 5:177198116-177198138 TGGAAGGAGTGCTGGAGCCCTGG - Intronic
1002364072 5:178696609-178696631 TGGAGTGAAGGCAGGAAACAAGG + Intergenic
1002821268 6:727178-727200 TGGAGAGACTGCTTGAGCCCAGG - Intergenic
1002913997 6:1514345-1514367 TGCAGTGATAGCAGGAGACCTGG + Intergenic
1002956020 6:1865711-1865733 TGGAATGACTGGTGGAGCCCAGG - Intronic
1002960532 6:1910591-1910613 TGAAGTGATTGTAGGAGGCCAGG + Intronic
1003159905 6:3625882-3625904 TGGAGAGAATGCAGGCGACCAGG - Intergenic
1003395770 6:5750702-5750724 TGGTGTGAATGCAGGAGGCGGGG + Intronic
1003692729 6:8370525-8370547 CGGAAGGATTGCAGGAGCCCAGG + Intergenic
1003996925 6:11551079-11551101 TGCAGAGAATGCAGTAGTCCTGG - Intronic
1004348898 6:14873860-14873882 TGGAGGGATTGCCTGAGCCCAGG - Intergenic
1004424422 6:15497752-15497774 TGGAGTTAAAGCAGGGGCCGGGG + Intronic
1004480776 6:16017524-16017546 TGGAGGGGATGCAGAAGCCCGGG + Intergenic
1005081528 6:21961236-21961258 TGGAAGGATTGCTGGAGCCCAGG - Intergenic
1005147280 6:22706062-22706084 TGGAAGGAATGTAAGAGCCCAGG - Intergenic
1005868174 6:29953161-29953183 TGGAGGCAGTGCACGAGCCCTGG + Intergenic
1006238849 6:32660231-32660253 AGGAGTCAGTGCAGAAGCCCTGG + Exonic
1006247899 6:32756448-32756470 AGGAGTCAGTGCAGGAGTCCTGG + Exonic
1006402934 6:33828291-33828313 TGAAATGAGGGCAGGAGCCCTGG - Intergenic
1006465203 6:34189827-34189849 TGGACTCAATGCAGCCGCCCAGG + Intergenic
1006563623 6:34935312-34935334 TGGAAGGAATGCTTGAGCCCAGG - Intronic
1006936431 6:37721811-37721833 TTGAGTGTATCCAGGAGCACAGG + Intergenic
1007100985 6:39246489-39246511 TGGGGTGATTGCTTGAGCCCAGG + Intergenic
1007246083 6:40463903-40463925 TGGTGTGATGGCATGAGCCCAGG - Intronic
1007424091 6:41735585-41735607 TGGAGTGACAGCCGGAGCCCGGG - Intronic
1007977552 6:46116842-46116864 TGCAGTGGATGCAGGAGCAGTGG - Intergenic
1008627393 6:53331100-53331122 TGGAAGGACTGCTGGAGCCCAGG + Intronic
1015787466 6:136932464-136932486 AGGAGTGAATGCTAGAGCCAGGG - Intergenic
1015809935 6:137152118-137152140 TGGAAGGATTGCTGGAGCCCAGG + Intronic
1016013208 6:139159565-139159587 TGGACTGAATCTAGGAGACCTGG + Intronic
1016040652 6:139428791-139428813 TGGAGGGACTGCTTGAGCCCGGG - Intergenic
1017438250 6:154438247-154438269 GGGAGGGAATGTAGGAGCCAAGG - Intronic
1018106962 6:160497544-160497566 TGGAGTGAGAGCAGGAGACGAGG - Intergenic
1018129538 6:160715942-160715964 TGGAGTGCATCCAACAGCCCTGG + Intronic
1018397734 6:163392206-163392228 GGGAGGGAATGCGGAAGCCCAGG + Intergenic
1018588275 6:165386929-165386951 TGGCGTGAATCCAGGAGGCGGGG + Intronic
1018997950 6:168724644-168724666 TGGGGTGCATGCAGGAGTGCAGG - Intergenic
1018999987 6:168742055-168742077 TGAAGTGAACGCAGGAGTTCAGG - Intergenic
1019259431 7:72449-72471 TGGAGTGAGTGCATGGGTCCAGG - Intergenic
1020025304 7:4895505-4895527 TGGAGTTTAGCCAGGAGCCCAGG + Intergenic
1020660388 7:10974265-10974287 GGGAGAGGCTGCAGGAGCCCAGG - Exonic
1020924191 7:14303725-14303747 TGGAGTGAATGTTGCAGCACAGG - Intronic
1021289647 7:18827023-18827045 TGGGTTGAATGCTTGAGCCCAGG + Intronic
1022007055 7:26275894-26275916 TGGGATGATTGCATGAGCCCAGG + Intergenic
1022530429 7:31063581-31063603 TCAACTGAATGCAGGAGCCCTGG + Intronic
1023480544 7:40629098-40629120 GGGATGGAATGCAGGAACCCTGG + Intronic
1023928121 7:44685709-44685731 TGGGGGGACTGCATGAGCCCAGG - Intronic
1024444539 7:49461521-49461543 TGGAGTGTATTCAGGATACCTGG - Intergenic
1027389627 7:77692039-77692061 TGGGGGGAATGCTTGAGCCCAGG + Intergenic
1029670823 7:102029527-102029549 GTGAGTGAATGAAGGAGGCCAGG + Intronic
1030198231 7:106874779-106874801 TGGACTGAAAGCAGGAGCGCTGG + Exonic
1031050036 7:116935627-116935649 TTGAGCAACTGCAGGAGCCCTGG + Intergenic
1032164227 7:129533108-129533130 TGGACTGGCTGCAGGAGCCATGG - Intergenic
1032172895 7:129600531-129600553 TTGAGTGTTTGCAGGGGCCCTGG - Intergenic
1032209578 7:129901260-129901282 TGGAGGGAGGACAGGAGCCCAGG + Intronic
1032694821 7:134325882-134325904 TGGTGTGAATGCATGAGGCTGGG + Intergenic
1034385145 7:150734718-150734740 TGGAGTGATTCAAGGACCCCTGG - Intronic
1034424287 7:151006610-151006632 TGGAGGGCATCCTGGAGCCCTGG - Intronic
1034738900 7:153455170-153455192 AACAGTGAATGCAGCAGCCCAGG - Intergenic
1034923495 7:155102527-155102549 TGGAGGGGATGCAGAAGCCTTGG - Intergenic
1035086188 7:156260338-156260360 TGCAGGGAGTGCAGGGGCCCAGG - Intergenic
1035174644 7:157041700-157041722 GGAGGTGACTGCAGGAGCCCAGG + Intergenic
1035256696 7:157633700-157633722 GGCAGTGAAGGCTGGAGCCCAGG + Intronic
1035373705 7:158394521-158394543 TGGTGAGAATGGAGCAGCCCTGG + Intronic
1035745387 8:1958942-1958964 TGCAGTGACTGTGGGAGCCCAGG - Intergenic
1036370924 8:8162385-8162407 TGGAGTGTAGGCAGGACCCGTGG - Intergenic
1036590134 8:10161664-10161686 TGGAGAGAATGCAGGAGACCCGG + Intronic
1036592000 8:10176791-10176813 GAGAGTGATGGCAGGAGCCCTGG - Intronic
1036879970 8:12503251-12503273 TGGAGTGTAGGCAGGACCCGTGG + Intergenic
1037494110 8:19422497-19422519 TGAAGTGAATGCAGGATCATAGG - Intronic
1037696537 8:21228758-21228780 TGGAGTGGCTGCAGGAGGGCTGG + Intergenic
1037818195 8:22122836-22122858 AGGAGTGCACGCAGGAGGCCGGG - Exonic
1037922994 8:22820964-22820986 TGGACTGATTGCTTGAGCCCAGG + Intronic
1039115348 8:34086255-34086277 TGGCGTGAACCCAGGAGCCCAGG + Intergenic
1039757440 8:40538675-40538697 GGGAGAGAATGCAGGAGCTAGGG - Intronic
1040045210 8:42955958-42955980 TGGATGGAATGCTTGAGCCCAGG - Intronic
1040072084 8:43196568-43196590 TGCAGGGAATGCAGAAGCCCAGG - Intronic
1040295881 8:46148865-46148887 TGGAGAGAATGCAGGAATGCCGG - Intergenic
1040465145 8:47688212-47688234 TGGTGTGAATCCAGGAGGCGGGG - Intronic
1041676531 8:60545502-60545524 AGGAGTGACTGCTTGAGCCCAGG - Intronic
1042095003 8:65204831-65204853 TGCAATGAACGCAGGAGTCCAGG - Intergenic
1042790752 8:72603108-72603130 TGGAGAGGATGCAGGAGACAAGG - Intronic
1042846062 8:73170537-73170559 TGAAGTGAATGCATGTGCCGTGG + Intergenic
1042973616 8:74438691-74438713 TGGAAGGATTGCTGGAGCCCAGG - Intronic
1044239324 8:89870249-89870271 TGGAGGGATTGCTTGAGCCCAGG - Intergenic
1044945987 8:97390708-97390730 TGGAATGATTGCTTGAGCCCAGG - Intergenic
1045543454 8:103107439-103107461 TGGATTGAGTCCAGGAGGCCAGG - Intergenic
1045993391 8:108336159-108336181 TGGAGGGATTGCTTGAGCCCAGG - Intronic
1047611303 8:126523460-126523482 GGCAGGGAATGCAGGAGCCCAGG + Intergenic
1048528619 8:135227463-135227485 TGGAGGGAATGGTGGAGACCTGG + Intergenic
1048802341 8:138206092-138206114 TGGAGGTGATGCTGGAGCCCTGG - Intronic
1049382711 8:142325443-142325465 AGGAGACAGTGCAGGAGCCCAGG + Intronic
1049529751 8:143148329-143148351 TGGGGTGGATGGAGGCGCCCAGG - Intergenic
1049720652 8:144113984-144114006 TGGACTGGACCCAGGAGCCCCGG + Exonic
1050431047 9:5562094-5562116 TGGACTGATTTCAGGAACCCAGG + Intronic
1050628179 9:7529653-7529675 AGGAGAGAAAGCAGGAGCCAAGG - Intergenic
1051596445 9:18828948-18828970 TGGAATGGAAGCAGCAGCCCAGG - Intronic
1052008722 9:23381637-23381659 TGGTGTGAATCCAGGAGGCGTGG - Intergenic
1052442966 9:28521647-28521669 TGGGGTGTATGCAGGTGCACTGG + Intronic
1052746766 9:32448985-32449007 TGGTGAGAATGCAGATGCCCTGG + Exonic
1053388962 9:37719713-37719735 GTGAGAAAATGCAGGAGCCCAGG + Intronic
1053471190 9:38347038-38347060 GGGAGTGTTTGCGGGAGCCCAGG + Intergenic
1054757048 9:68969281-68969303 TGGCGTGAACCCAGGAGCCGGGG + Intronic
1057023356 9:91718211-91718233 TGGAGGGAATCCAGGAGGCAGGG - Intronic
1057076727 9:92141892-92141914 TGGGCTGACTGCGGGAGCCCAGG + Intergenic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057468930 9:95340470-95340492 TGGAAGGATTGCTGGAGCCCAGG + Intergenic
1057563705 9:96149713-96149735 TGCAGGAAATGCAGCAGCCCCGG - Intergenic
1057611827 9:96551347-96551369 TGGAATGATTGCGTGAGCCCAGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1057803365 9:98203429-98203451 TGGAGTGATTACAGAAGCCGTGG + Intronic
1058634894 9:107028940-107028962 TGGAGTTGATGGTGGAGCCCAGG - Intergenic
1059130763 9:111746574-111746596 TGGAATGATTGCTTGAGCCCAGG + Intronic
1059158702 9:112013283-112013305 TGGAAGGATTGCTGGAGCCCAGG - Intergenic
1060406261 9:123374537-123374559 TGGAGTGGGTGCAGGACACCTGG - Intronic
1061008754 9:127943062-127943084 TGGAGTGCATGGAGGAGGCATGG + Exonic
1061266535 9:129508717-129508739 TGGCGTGAACCCAGGAGCACAGG + Intergenic
1061364680 9:130165773-130165795 TGGAGGGATTGCTTGAGCCCAGG + Intergenic
1061459566 9:130725889-130725911 TGGTGTGATTGCCTGAGCCCAGG + Intronic
1061939546 9:133876654-133876676 TGGAGGGAAGGCAGGACCGCGGG + Intronic
1062141021 9:134959288-134959310 TGGAGAGAAGGCAGGTGCCTCGG + Intergenic
1062721803 9:138048421-138048443 TGCAGGGAATTTAGGAGCCCAGG + Intronic
1185639727 X:1582546-1582568 TGGAAGGATTGCTGGAGCCCGGG - Intergenic
1186293718 X:8125900-8125922 TTGCAGGAATGCAGGAGCCCAGG - Intergenic
1188190230 X:27163448-27163470 AGGAGTGATTGATGGAGCCCAGG + Intergenic
1190741337 X:53290830-53290852 CTGACTGTATGCAGGAGCCCTGG - Intronic
1191229442 X:58082479-58082501 TGGAATGAATGCAGTTGCCAAGG - Intergenic
1192773945 X:74222509-74222531 TGGAATGACTGCTTGAGCCCAGG + Intergenic
1193466617 X:81855131-81855153 TGGGATGATTGCATGAGCCCAGG + Intergenic
1193810034 X:86040289-86040311 TTGAGTGGGTGCAGGAGCCGGGG - Intronic
1197996780 X:132385374-132385396 TGGAATGAATTCAGTAGCCCTGG - Intronic
1199756765 X:150872136-150872158 TGGAAGGATTGCTGGAGCCCGGG + Intronic
1200010893 X:153119963-153119985 TGGGGTGAAGGGAGGAGACCTGG - Intergenic
1200028706 X:153279959-153279981 TGGGGTGAAGGGAGGAGACCTGG + Intergenic
1200115480 X:153768035-153768057 TGGAGAGCAGGCAGGAGACCTGG - Intronic