ID: 1163487888

View in Genome Browser
Species Human (GRCh38)
Location 19:17599838-17599860
Sequence GCGGACAGGACGGGAGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163487888_1163487897 12 Left 1163487888 19:17599838-17599860 CCCGCAGCTCCCGTCCTGTCCGC No data
Right 1163487897 19:17599873-17599895 ATAACCCCAGACATAAGGAGGGG No data
1163487888_1163487896 11 Left 1163487888 19:17599838-17599860 CCCGCAGCTCCCGTCCTGTCCGC No data
Right 1163487896 19:17599872-17599894 AATAACCCCAGACATAAGGAGGG No data
1163487888_1163487894 7 Left 1163487888 19:17599838-17599860 CCCGCAGCTCCCGTCCTGTCCGC No data
Right 1163487894 19:17599868-17599890 TAGAAATAACCCCAGACATAAGG No data
1163487888_1163487895 10 Left 1163487888 19:17599838-17599860 CCCGCAGCTCCCGTCCTGTCCGC No data
Right 1163487895 19:17599871-17599893 AAATAACCCCAGACATAAGGAGG No data
1163487888_1163487901 20 Left 1163487888 19:17599838-17599860 CCCGCAGCTCCCGTCCTGTCCGC No data
Right 1163487901 19:17599881-17599903 AGACATAAGGAGGGGAATTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163487888 Original CRISPR GCGGACAGGACGGGAGCTGC GGG (reversed) Intergenic