ID: 1163488457

View in Genome Browser
Species Human (GRCh38)
Location 19:17603370-17603392
Sequence CACTTCCCCTTTGGGCTCTA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 164}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163488452_1163488457 -8 Left 1163488452 19:17603355-17603377 CCCCAGGTCACAGATCACTTCCC 0: 1
1: 0
2: 0
3: 23
4: 245
Right 1163488457 19:17603370-17603392 CACTTCCCCTTTGGGCTCTATGG 0: 1
1: 0
2: 0
3: 13
4: 164
1163488446_1163488457 21 Left 1163488446 19:17603326-17603348 CCATCCAAAAATCTTCCAGATCA 0: 1
1: 0
2: 1
3: 17
4: 281
Right 1163488457 19:17603370-17603392 CACTTCCCCTTTGGGCTCTATGG 0: 1
1: 0
2: 0
3: 13
4: 164
1163488450_1163488457 -2 Left 1163488450 19:17603349-17603371 CCCTCACCCCAGGTCACAGATCA 0: 1
1: 0
2: 2
3: 25
4: 353
Right 1163488457 19:17603370-17603392 CACTTCCCCTTTGGGCTCTATGG 0: 1
1: 0
2: 0
3: 13
4: 164
1163488454_1163488457 -10 Left 1163488454 19:17603357-17603379 CCAGGTCACAGATCACTTCCCCT 0: 1
1: 0
2: 0
3: 24
4: 182
Right 1163488457 19:17603370-17603392 CACTTCCCCTTTGGGCTCTATGG 0: 1
1: 0
2: 0
3: 13
4: 164
1163488453_1163488457 -9 Left 1163488453 19:17603356-17603378 CCCAGGTCACAGATCACTTCCCC 0: 1
1: 0
2: 0
3: 22
4: 236
Right 1163488457 19:17603370-17603392 CACTTCCCCTTTGGGCTCTATGG 0: 1
1: 0
2: 0
3: 13
4: 164
1163488449_1163488457 6 Left 1163488449 19:17603341-17603363 CCAGATCACCCTCACCCCAGGTC 0: 1
1: 1
2: 2
3: 35
4: 311
Right 1163488457 19:17603370-17603392 CACTTCCCCTTTGGGCTCTATGG 0: 1
1: 0
2: 0
3: 13
4: 164
1163488451_1163488457 -3 Left 1163488451 19:17603350-17603372 CCTCACCCCAGGTCACAGATCAC 0: 1
1: 0
2: 4
3: 28
4: 334
Right 1163488457 19:17603370-17603392 CACTTCCCCTTTGGGCTCTATGG 0: 1
1: 0
2: 0
3: 13
4: 164
1163488447_1163488457 17 Left 1163488447 19:17603330-17603352 CCAAAAATCTTCCAGATCACCCT 0: 1
1: 0
2: 0
3: 17
4: 164
Right 1163488457 19:17603370-17603392 CACTTCCCCTTTGGGCTCTATGG 0: 1
1: 0
2: 0
3: 13
4: 164
1163488445_1163488457 25 Left 1163488445 19:17603322-17603344 CCAGCCATCCAAAAATCTTCCAG 0: 1
1: 0
2: 1
3: 21
4: 349
Right 1163488457 19:17603370-17603392 CACTTCCCCTTTGGGCTCTATGG 0: 1
1: 0
2: 0
3: 13
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163488457 Original CRISPR CACTTCCCCTTTGGGCTCTA TGG Exonic
901849593 1:12007083-12007105 GCCCTCTCCTTTGGGCTCTATGG + Exonic
902998885 1:20250145-20250167 CACTTCCTCTGCAGGCTCTAGGG - Intergenic
905733309 1:40310989-40311011 CCCTTCCCCTGTGGGTTCTGGGG - Intronic
906735578 1:48123567-48123589 CAGATCCCCTTTGGACTCAAGGG + Intergenic
911816774 1:102362746-102362768 CACTTACCCATTCTGCTCTACGG + Intergenic
912861940 1:113221054-113221076 GACTTCACCTGTTGGCTCTAAGG + Intergenic
915167998 1:153959236-153959258 CCCTTCCCCCTTGGGCTCCTCGG + Exonic
918469773 1:184860042-184860064 TACTTTCCCTTTGTGGTCTACGG - Intronic
921214954 1:212928820-212928842 AAGTTCCCCTTTGGGCTCCCTGG - Intergenic
923083492 1:230683018-230683040 TACTTGCCCTTCGGGTTCTACGG - Intronic
923778997 1:237005142-237005164 AACCACCCATTTGGGCTCTATGG + Intergenic
1063985760 10:11499727-11499749 CACTTTCTCTCAGGGCTCTAGGG - Intronic
1064861015 10:19825644-19825666 TACTTCCCTTTTAGGCTTTAGGG - Intronic
1065491153 10:26283061-26283083 CATTTCCCTTTTGGTCTGTAAGG - Intronic
1066024870 10:31345747-31345769 CAATACCCCCTTGGGATCTAGGG - Intronic
1066525505 10:36274850-36274872 CTCTTCCCCTTGTGGCTCTCAGG - Intergenic
1067237766 10:44466045-44466067 CACTTGCCCTTTGCTCTGTAGGG - Intergenic
1068251915 10:54453832-54453854 TACTTCCTCTGAGGGCTCTAGGG - Intronic
1069966922 10:72126960-72126982 CACTGCCCTATTGGGCTCCATGG + Intronic
1071132900 10:82416536-82416558 CAGGTCCCCTTTGGGCCCTAAGG + Intronic
1071211342 10:83345073-83345095 CAACTCCCCTTTAGGCTTTAAGG + Intergenic
1075204177 10:120432380-120432402 CACTTGCCCTCTGGGCTCCCTGG + Intergenic
1075211256 10:120493295-120493317 CTCTTCCCCTGTTGGGTCTAAGG + Intronic
1075326522 10:121536650-121536672 CACCTCCCCTTTGAGCTTTCTGG - Intronic
1078734415 11:14006988-14007010 CACTCCCTCTGGGGGCTCTAGGG + Intronic
1078973156 11:16438759-16438781 GACTTCTCCTTTGTGCCCTAGGG - Intronic
1079150954 11:17898586-17898608 CACTTCCCCTTTTGTTTCTCTGG - Intronic
1080685981 11:34515081-34515103 CTCTTCCTCTTTGGTTTCTAGGG + Intergenic
1080750269 11:35144278-35144300 CACTTCCCTTTCAGGCTCTTCGG - Intronic
1083725579 11:64626302-64626324 CCCTTCCCCTTTGGAGTCAAGGG - Intronic
1088110652 11:106257477-106257499 CACTTACTCTTTGGTGTCTAGGG + Intergenic
1088863041 11:113820261-113820283 TAGTTCTCCTTTGGGTTCTAAGG - Intronic
1089538296 11:119173955-119173977 CACCTCCTCTTTGTGCTCCATGG + Exonic
1092156697 12:6287125-6287147 CAGTTCACCTTTGCTCTCTAGGG - Intergenic
1092926912 12:13279780-13279802 AACTCCTCATTTGGGCTCTAGGG - Intergenic
1100138712 12:91589248-91589270 CACTTCCTCTTTTGGCTCAGAGG + Intergenic
1100242105 12:92720179-92720201 CACTTCCCCTGAAGGCTCTAGGG + Intergenic
1101599851 12:106199780-106199802 CAATGCCACTTTGGGCTCTCTGG - Intergenic
1101922051 12:108941040-108941062 CACTTTCCCTGTGGTCTATATGG + Intronic
1102415048 12:112754047-112754069 CACTCCTTCTGTGGGCTCTAGGG - Intronic
1106300813 13:28462981-28463003 CACTTCACATTAGGGCTCTGTGG - Intronic
1106830455 13:33575712-33575734 TGCTTCCCCTTTGGTCTCTGTGG + Intergenic
1107020145 13:35742984-35743006 AACTTCCCCTTTGCCCTCTGAGG + Intergenic
1107941737 13:45382285-45382307 CACTTCCCCCTCTGGCTCTTAGG - Intergenic
1108248619 13:48542608-48542630 CACTTGCCCTTTGCCCTCTCTGG + Intergenic
1108693546 13:52882004-52882026 CCCTTACCCTTTGGGCTTTGGGG + Intergenic
1111675753 13:91386576-91386598 CACTTATCCTTTGGTCTCTTTGG + Intergenic
1114155108 14:20093615-20093637 CACTTCCTCATGGGGCTGTATGG + Intergenic
1115517236 14:34198171-34198193 CCCTTGCCCTTTCAGCTCTAGGG - Intronic
1115589812 14:34853202-34853224 GACTTCTCCTGTAGGCTCTAAGG + Intronic
1116615218 14:47127880-47127902 ATCTTCCCCTTTTGGCTTTAAGG + Intronic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1117845284 14:59905394-59905416 GACTGACCCTATGGGCTCTATGG + Intergenic
1119717269 14:76867789-76867811 CACTTCCTCTTTGGGCTGCAAGG - Intronic
1120862657 14:89268782-89268804 CACCTCCCATTTGGAATCTATGG + Intronic
1121035385 14:90699082-90699104 CAGTTCCCCCTTGGGCCCCATGG + Intronic
1122033063 14:98927671-98927693 CACTACCCCCTTGGCCTTTAGGG - Intergenic
1124040834 15:26101781-26101803 AAGTTCCCCTTTGTGCTATAAGG + Intergenic
1126396893 15:48227755-48227777 CCCTTCCCCTTTGGTTTCTCTGG + Intronic
1127871033 15:63073830-63073852 GACTTCCCCTCTGGGTTCCAGGG + Intergenic
1128376586 15:67080839-67080861 CACTCCTGCTTTGGGCTCTCAGG + Intronic
1129258346 15:74347499-74347521 CACTGCCCCTTTAGCCTGTATGG + Intronic
1129890139 15:79066492-79066514 ACATTCCCCTTGGGGCTCTAAGG - Intronic
1130213838 15:81950236-81950258 CACTCACCCTTTGGGCCCTAGGG - Intergenic
1131874525 15:96790487-96790509 ATCATCCCCTTTGGGCTCTGTGG - Intergenic
1132206932 15:99992828-99992850 CACTGCCCCTTGGGGCTCACTGG - Intronic
1133107032 16:3518663-3518685 CATTTCTCCTGGGGGCTCTAAGG + Intronic
1133626587 16:7575596-7575618 CACTTCCTCTAGAGGCTCTAGGG - Intronic
1133852215 16:9516183-9516205 CACTTCCTCCAGGGGCTCTAGGG - Intergenic
1134847122 16:17449398-17449420 CACTTCCCCTATGGGCTGCGGGG + Intronic
1137978502 16:53050753-53050775 CCCTTTCCCTTTGGTCTCTTTGG + Intergenic
1139229803 16:65272744-65272766 CTGTACCCCTTTGAGCTCTAGGG - Intergenic
1140314479 16:73881527-73881549 CACTTTCTCTTTGGACTCCAAGG - Intergenic
1141151510 16:81567585-81567607 CACTTCCCATGTGGTCTCTTGGG - Intronic
1142075477 16:88115181-88115203 CGTTTCCCCTTTGTGCACTAAGG - Intronic
1144515196 17:15912572-15912594 CACTTCCCTCTTGGGCTGTCAGG + Intergenic
1145282553 17:21478405-21478427 CCCATCACCTTTGGGATCTATGG + Intergenic
1146016132 17:29235153-29235175 TACTTCCCCTTTGTCTTCTATGG - Intergenic
1149218700 17:54389448-54389470 AACATCCCCTCTGGGCTTTAGGG + Intergenic
1153000261 18:448587-448609 CACCTCCCCTTTGGACTCCACGG - Intronic
1160295446 18:77632933-77632955 CACTTCCCCTTTGTGCTGCTTGG + Intergenic
1160365266 18:78319285-78319307 TTCTTCCCATTTGGTCTCTAGGG + Intergenic
1163488457 19:17603370-17603392 CACTTCCCCTTTGGGCTCTATGG + Exonic
1164350999 19:27341477-27341499 CATTTCCCCTTAGGTCTCAATGG + Intergenic
928301031 2:30124016-30124038 CACTTTCCTTTTGAACTCTATGG - Intergenic
931230438 2:60370245-60370267 AACTTCCCCCTTGGACTCTCAGG + Intergenic
933102163 2:78274338-78274360 CTCTTTCTCTTTGGGCTCTTTGG - Intergenic
934135921 2:88996393-88996415 CTCTTCTCCTTTGGTGTCTAGGG - Intergenic
937614567 2:123906540-123906562 CATTTCCCCTTTTGGAACTAAGG + Intergenic
937709776 2:124966590-124966612 CACTTCTCATTTGTGATCTAAGG - Intergenic
941399400 2:165012172-165012194 CACTTCCCCTCTGGGCCCCAGGG - Intergenic
941654597 2:168129534-168129556 CACTTACCTTTTTGGCTCTTTGG + Exonic
942200538 2:173566484-173566506 CACCTCGTCTTTGGGCTCTTAGG + Intergenic
943768271 2:191686848-191686870 CACTTCCCCTTTTTACTGTAGGG + Exonic
943984013 2:194595666-194595688 CACGTCCCCATTGTTCTCTATGG + Intergenic
944856740 2:203775429-203775451 CTCTTGCCCTTTGGGCTTAAGGG + Intergenic
946817382 2:223593082-223593104 CTCTTCACCTTTTTGCTCTAAGG - Intergenic
949075911 2:242057792-242057814 CACCTCCACCTTTGGCTCTAAGG - Intergenic
1170691887 20:18623770-18623792 CACTTCCCCCATGTGTTCTATGG + Intronic
1171211951 20:23324076-23324098 GGCTTCTTCTTTGGGCTCTAGGG + Intergenic
1171984560 20:31650615-31650637 CACTTCCCCTTCGCTCTCTTGGG - Intergenic
1174034503 20:47660085-47660107 GAGTTCCCCTTTGGGCTCTGGGG + Intronic
1175183998 20:57167521-57167543 CACTTTCCCTTTTGGCCCTCTGG - Intergenic
1176207620 20:63898182-63898204 CACCTCACATCTGGGCTCTAAGG - Intronic
1178123931 21:29497298-29497320 CACTCCCTCTGAGGGCTCTAGGG + Intronic
1178374305 21:32054374-32054396 CACTTCCTCTGAGGGCTCTGGGG + Intergenic
1178704558 21:34862519-34862541 CACTCCCCCTGAGGGCTCTAGGG + Intronic
1182287835 22:29258740-29258762 CACCTCCCCTTGGCCCTCTAGGG - Intronic
1182306312 22:29371370-29371392 CTCAGCCCCTTTGGCCTCTATGG - Intronic
1182519969 22:30879637-30879659 CACTTCCCCTTGTGGCTCCATGG + Intronic
1184196572 22:42933607-42933629 CACTTCCCCTTTAGGCGCCACGG - Intronic
1184615412 22:45634726-45634748 CCCTTCACCTCTGTGCTCTAGGG + Intergenic
949511547 3:4771085-4771107 TACTTCCCCTGTGGACTCCAAGG - Intronic
950571446 3:13802740-13802762 TTCTTCCCCATTGGGCTCCAAGG - Intergenic
953367947 3:42362816-42362838 CATTTCCCCTTTGTAATCTATGG - Intergenic
954450132 3:50567280-50567302 CCCTTCCCCTTTGGACCCTGAGG - Intronic
956974575 3:74565246-74565268 CTCTTCTCCTGTAGGCTCTAAGG + Intergenic
957029961 3:75228930-75228952 CGCTTCCCCTGAAGGCTCTAGGG + Intergenic
958838175 3:99171324-99171346 CACTCCCCATCTGGGCTCTTGGG + Intergenic
958892300 3:99795271-99795293 AGCTTCCCCCTTGGGCCCTATGG - Exonic
961046610 3:123712745-123712767 CACTTCCTCATCGGTCTCTACGG + Intronic
967533478 3:190575921-190575943 CACTTCAATTTTGGCCTCTAAGG - Intronic
968314553 3:197712379-197712401 CATGTCCCCTCTGGGCTCTCAGG - Intronic
968811253 4:2800582-2800604 CACTTCACCTGGGGGCTCTGGGG + Intronic
972242961 4:37213762-37213784 CACTTCCTCTTCGAGCTCTAGGG + Intergenic
975403976 4:73968455-73968477 CACTTCCCATCAGGGCTCTCAGG + Intergenic
975717665 4:77220670-77220692 CACTGCCACTGTGGGCTCAATGG - Intronic
978349018 4:107801766-107801788 CATTTCCCCTTTGGGCTGGCTGG - Intergenic
984679988 4:182596333-182596355 CGATTCACCTTTGAGCTCTATGG - Intronic
986276013 5:6275713-6275735 CCCTTTCCCTTTTGGGTCTAGGG - Intergenic
987778366 5:22398623-22398645 TACCTCCTCTTTGGGTTCTAAGG + Intronic
991088454 5:62670632-62670654 CACTTCCCTTTTCCGCTGTAGGG - Intergenic
993039294 5:82794217-82794239 GACTTCCCCTTTGCCCTCTGGGG + Intergenic
997300615 5:132801246-132801268 CACTCCCTCTGAGGGCTCTAGGG + Intronic
1001953304 5:175830909-175830931 CACGTTTCCCTTGGGCTCTAAGG - Intronic
1002100132 5:176853496-176853518 CTCTTCCCCAGTGGGCTCCAGGG - Intronic
1002187393 5:177460702-177460724 CACTGTCCCTTTGGTTTCTAGGG - Exonic
1003418578 6:5935705-5935727 CACTCACCCTTTGGCCTCCATGG + Intergenic
1006461446 6:34161612-34161634 TGCTTCTCCTCTGGGCTCTAAGG - Intergenic
1007276310 6:40676687-40676709 ATCTTCCCCTCTGGGCTATAAGG + Intergenic
1008739044 6:54582564-54582586 CACCTCCCATTTGGGCTGTTTGG + Intergenic
1016618590 6:146080953-146080975 CACATCCCCCTTGGGCACTTGGG - Intronic
1018169598 6:161134155-161134177 CACATTCTCTTTCGGCTCTAAGG + Exonic
1022258899 7:28685313-28685335 CACTTCTCCCTTGGCCCCTATGG - Intronic
1026461231 7:70616928-70616950 CTCTTCACCTCTGGTCTCTAAGG - Intronic
1028077659 7:86535140-86535162 CACCTCCCTCTTGGGCTCTCAGG - Intergenic
1028517889 7:91698477-91698499 CCCTTCCCCATGTGGCTCTAAGG - Intronic
1029877223 7:103766952-103766974 CACGTGCCCTTTGGGCTTTGGGG + Intronic
1036400712 8:8405264-8405286 TGCTTCCCCTTTGGGGTCCAGGG + Intergenic
1037875034 8:22540407-22540429 CAGCTGCCCTTTGGGCTTTAAGG + Intronic
1037885827 8:22595773-22595795 AACTTCCCCTTGAGGCTCTAGGG + Intronic
1038762175 8:30394499-30394521 CACTTCCCCTCTGAGCACAAAGG - Intronic
1050638017 9:7633459-7633481 CACTTCCCTTCTGTGCTCTTTGG - Intergenic
1050894956 9:10874673-10874695 CACTGCCCCTTTGGGTTTAAGGG + Intergenic
1052748846 9:32468332-32468354 CACTTACCCTTTGACCTATAGGG - Intronic
1053492866 9:38523679-38523701 CCCTTCACCATTGGGCTCTATGG + Intergenic
1056765431 9:89441974-89441996 CTCTTCCCCATTGGACTGTAAGG + Intronic
1057053735 9:91946067-91946089 CAGTGACCCTTTGGGCTCTTAGG - Intronic
1057643020 9:96845542-96845564 CACTTCCCAGCTGGGCACTATGG - Intronic
1057673098 9:97112598-97112620 CCCTTCACCATTGGGCTCTGTGG + Intergenic
1057821209 9:98332473-98332495 AACTTCCCCTATGGGCACTGGGG + Intronic
1060547780 9:124470986-124471008 CACCTCCCCCTTGGGGTCTGCGG + Intronic
1060888906 9:127175937-127175959 CACTGGCCCTATGGGCTCTGTGG - Intronic
1060979228 9:127783207-127783229 CACTTCCCCTTGGGGCCTCAGGG - Intergenic
1062637992 9:137501507-137501529 CACTGCCCCTCTGGGCACCATGG - Intronic
1186192866 X:7083082-7083104 CACTCCCTCTGTAGGCTCTAGGG - Intronic
1186372473 X:8961226-8961248 CACTTCCCCTTTGTGGCCTGTGG + Intergenic
1187117664 X:16369847-16369869 CACTCCCTCTGAGGGCTCTAGGG + Intergenic
1189014757 X:37085746-37085768 CACTTCCCCTCTGAGCACAAAGG - Intergenic
1189752329 X:44235024-44235046 CACTTCCGCTGTGGCCTCTGAGG - Intronic
1193741826 X:85226288-85226310 CAGTTGCCATTTGGGCTTTAGGG - Intergenic
1195325940 X:103758527-103758549 CATTTCCTCTTTTGGCTATAAGG + Intergenic
1196341061 X:114598214-114598236 CACTTCCTCTCTGGGCTTTGGGG - Intronic
1199726483 X:150587799-150587821 CATTTCCAATTTGGCCTCTAGGG - Intronic
1200292108 X:154884813-154884835 CACTTTCCCATTGGCCTCGAGGG - Intronic
1200338946 X:155380550-155380572 CACTTTCCCATTGGCCTCGAGGG - Intergenic
1200347523 X:155460142-155460164 CACTTTCCCATTGGCCTCGAGGG + Intergenic
1201719705 Y:17083113-17083135 CACTTCCTGTTTTGGCTCTGTGG + Intergenic