ID: 1163489001

View in Genome Browser
Species Human (GRCh38)
Location 19:17606048-17606070
Sequence CCGCGCCTGCGCCTTAGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 2, 3: 1, 4: 54}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163489001_1163489005 -5 Left 1163489001 19:17606048-17606070 CCCGCGCTAAGGCGCAGGCGCGG 0: 1
1: 0
2: 2
3: 1
4: 54
Right 1163489005 19:17606066-17606088 CGCGGCACCGCCCTCCTCGGCGG 0: 1
1: 1
2: 0
3: 11
4: 110
1163489001_1163489004 -8 Left 1163489001 19:17606048-17606070 CCCGCGCTAAGGCGCAGGCGCGG 0: 1
1: 0
2: 2
3: 1
4: 54
Right 1163489004 19:17606063-17606085 AGGCGCGGCACCGCCCTCCTCGG 0: 1
1: 0
2: 0
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163489001 Original CRISPR CCGCGCCTGCGCCTTAGCGC GGG (reversed) Exonic
914673244 1:149887863-149887885 GCGCGACTTGGCCTTAGCGCGGG + Exonic
921325806 1:213985502-213985524 CCGCTCCTGCGCCCTAATGCGGG + Intronic
923001474 1:230009640-230009662 CCTCACCTGAGCCTTAGGGCAGG + Intergenic
1069720571 10:70547193-70547215 CAGCGCCTGGGCCTTAGGCCTGG + Intronic
1069849757 10:71397183-71397205 CCGCGGATGAGCCTTCGCGCCGG + Intronic
1070098190 10:73358861-73358883 CTGCGCCTGCGCCCTAGCGCCGG + Intergenic
1076373310 10:129968255-129968277 CCGCGCCTGCAGCTCAGCACTGG - Intergenic
1077044300 11:537674-537696 CCGCGCCCACGCCTCGGCGCAGG - Intronic
1084588833 11:70078751-70078773 GCGCACCTGCGCCTTGGCGAGGG + Intronic
1089511173 11:118998190-118998212 CTGCGCCGGCGCCATAGCCCGGG - Exonic
1100469054 12:94873827-94873849 CCGCGCCTCCGCCGCAGCCCGGG - Intergenic
1100490519 12:95073598-95073620 CAGCGCCTGCGCATTAGCAACGG + Exonic
1106087864 13:26558522-26558544 GCGCGCCTGGGCTTTAGCGAGGG + Intronic
1121421785 14:93821078-93821100 CCGCCCCTGCACCTTGGCTCAGG + Intergenic
1122179795 14:99946749-99946771 CCGCCCCAGCTCCCTAGCGCAGG - Intergenic
1122972123 14:105156635-105156657 TCGAGCCTGTGCCTAAGCGCAGG - Intronic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1128124970 15:65185421-65185443 GCGCGCCTGCGCCCTAGGCCCGG + Intergenic
1132370690 15:101295613-101295635 CCGGGCCTGGGCCTTGGCTCCGG + Intergenic
1132864003 16:2084809-2084831 CCTCGCCTGTGCCCTAGGGCTGG + Intronic
1136861558 16:33707264-33707286 CCGCGCCTGCGCCGCCGCCCTGG + Intergenic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1143155370 17:4833254-4833276 GCTCGCCTGCGCCTGCGCGCAGG + Intergenic
1143174618 17:4948985-4949007 CCGCGCCTGCGCCTGCGCCGGGG + Exonic
1150840230 17:68600501-68600523 CCGCGCCTCCTCCCTGGCGCGGG - Exonic
1151453002 17:74210858-74210880 CCGCACCTGGGCCTGAGGGCTGG - Intergenic
1157848920 18:51030024-51030046 CTGGGCCTGGGCCTCAGCGCGGG - Intronic
1160100685 18:75916852-75916874 CTGCGCCTGGGCCTCCGCGCAGG - Intergenic
1160967638 19:1753623-1753645 CCGCGCGCGCTCCTCAGCGCCGG - Exonic
1161001387 19:1912833-1912855 CCCCGCCTGCTCCTTCGCCCCGG + Exonic
1162810750 19:13163209-13163231 CCCCGCCTCCGCCTTCCCGCTGG - Intergenic
1163489001 19:17606048-17606070 CCGCGCCTGCGCCTTAGCGCGGG - Exonic
1165950036 19:39469194-39469216 CCGCCCCTGCTCCTTGGCCCAGG - Intronic
1167479366 19:49720095-49720117 CCCCGTCTGCGCCTGAGTGCAGG + Intergenic
1168685676 19:58347726-58347748 CCGCGCCTGCGCCTCAGCCCCGG + Intronic
927496760 2:23556294-23556316 CCACGCCTGCGCCTCCGCGAGGG - Intronic
938796126 2:134719208-134719230 CCGCGCCCGGGCCTTGGGGCGGG - Intergenic
1174246720 20:49187785-49187807 CCCCGCCTGCGCCCCAGCCCCGG + Intronic
1174374002 20:50113186-50113208 GCGCGCCTGCGCATCAGGGCCGG - Intronic
1175108228 20:56629219-56629241 CGGCGCCTGGGCCTCCGCGCCGG + Intergenic
1176015545 20:62929359-62929381 GCGCGCCTGGGCCTCGGCGCTGG + Intronic
1178914580 21:36699385-36699407 CAGCGCCTCCGCCTCCGCGCCGG + Exonic
955763813 3:62318988-62319010 CGACGCCGGGGCCTTAGCGCAGG - Intronic
963038300 3:141051146-141051168 CCGCGCCGCCGCCTTGGCACAGG + Intergenic
968372873 4:11579-11601 CCGCGCCTGCGCCTTGTCCTCGG - Intergenic
968506518 4:973573-973595 CCGCGCCTGCGCAGTGGGGCAGG - Intronic
968631768 4:1655568-1655590 CCAGGCCTGCGCCTGGGCGCGGG + Exonic
985462523 4:190120988-190121010 CCGCGCCTGCGCCTTGTCCTCGG + Intergenic
1008660823 6:53665793-53665815 CCGAGCCTGCGCTTTGGCCCGGG + Intergenic
1009437727 6:63636476-63636498 GCGCGCCCGCGCCTCAGCGGCGG - Intronic
1029472792 7:100765152-100765174 CAGGGCCGGCGCCTTAGTGCTGG + Intronic
1029537692 7:101165723-101165745 CCCGGCCTGCGCCTGCGCGCTGG + Intergenic
1037337095 8:17801715-17801737 CCCGGCCTGGGCCCTAGCGCTGG - Intergenic
1039905808 8:41785698-41785720 CCGGGCCTGGGCCTTCCCGCAGG + Intronic
1053239903 9:36487314-36487336 CGGCGCCTGCGGCCGAGCGCCGG - Intronic
1054333332 9:63781653-63781675 CCGCGCCTGCGCCGGCGCTCTGG - Intergenic
1057869752 9:98708825-98708847 CCGGGCCGGCGCCATTGCGCGGG - Exonic
1200128763 X:153830207-153830229 CCGCGCCCCCGCCGCAGCGCCGG + Intronic