ID: 1163489001

View in Genome Browser
Species Human (GRCh38)
Location 19:17606048-17606070
Sequence CCGCGCCTGCGCCTTAGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 2, 3: 1, 4: 54}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163489001_1163489005 -5 Left 1163489001 19:17606048-17606070 CCCGCGCTAAGGCGCAGGCGCGG 0: 1
1: 0
2: 2
3: 1
4: 54
Right 1163489005 19:17606066-17606088 CGCGGCACCGCCCTCCTCGGCGG 0: 1
1: 1
2: 0
3: 11
4: 110
1163489001_1163489004 -8 Left 1163489001 19:17606048-17606070 CCCGCGCTAAGGCGCAGGCGCGG 0: 1
1: 0
2: 2
3: 1
4: 54
Right 1163489004 19:17606063-17606085 AGGCGCGGCACCGCCCTCCTCGG 0: 1
1: 0
2: 0
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163489001 Original CRISPR CCGCGCCTGCGCCTTAGCGC GGG (reversed) Exonic