ID: 1163490898

View in Genome Browser
Species Human (GRCh38)
Location 19:17616723-17616745
Sequence CAGAGACCCAGCGCCCACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163490896_1163490898 2 Left 1163490896 19:17616698-17616720 CCAGGACTGGAAGGGAAGCTGAG 0: 1
1: 0
2: 2
3: 31
4: 324
Right 1163490898 19:17616723-17616745 CAGAGACCCAGCGCCCACGGAGG 0: 1
1: 0
2: 3
3: 19
4: 184
1163490891_1163490898 21 Left 1163490891 19:17616679-17616701 CCAGGGACACTAAAAGCAGCCAG No data
Right 1163490898 19:17616723-17616745 CAGAGACCCAGCGCCCACGGAGG 0: 1
1: 0
2: 3
3: 19
4: 184
1163490890_1163490898 30 Left 1163490890 19:17616670-17616692 CCAGGGACACCAGGGACACTAAA 0: 1
1: 1
2: 1
3: 9
4: 170
Right 1163490898 19:17616723-17616745 CAGAGACCCAGCGCCCACGGAGG 0: 1
1: 0
2: 3
3: 19
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163490898 Original CRISPR CAGAGACCCAGCGCCCACGG AGG Intronic
900266449 1:1759649-1759671 CAGAGACACAGAGCCCAGAGGGG + Intronic
900312839 1:2042798-2042820 CCCAGACGCAGCTCCCACGGTGG + Intergenic
900531654 1:3156773-3156795 CAGAGTCCCAGGGCCCACATGGG + Intronic
901053978 1:6440228-6440250 CGGAGACACAGCGCCCACCGTGG - Intronic
901251107 1:7781244-7781266 CAGAGACCCTGCGCTGAAGGTGG - Exonic
902420157 1:16272544-16272566 CAGTGACCCACCGGGCACGGTGG - Intronic
902480313 1:16708082-16708104 CGGAGACACAGCGCCCACCGTGG + Intergenic
902548700 1:17206456-17206478 GAGAGAACCAGCCCCCACAGCGG - Intronic
903668657 1:25022746-25022768 CAGAGGCCCAGAGCCCACGGTGG - Intergenic
904616364 1:31752377-31752399 GGGAGACCCAGCACACACGGTGG - Intronic
905536581 1:38727011-38727033 CAGAGACCCTGCGAACATGGAGG - Intergenic
906872798 1:49503041-49503063 CACAGACCCAGGGGCCAAGGAGG + Intronic
907918679 1:58893652-58893674 GAGAGACCCAGCCTCCACAGGGG + Intergenic
911551160 1:99282679-99282701 CAGAGACCCGACGTCCAAGGAGG - Intronic
912505054 1:110150623-110150645 CGGGGACCCAGGTCCCACGGCGG - Exonic
912538400 1:110393898-110393920 TAGAGACTCAGTGCCCAAGGGGG - Intergenic
912975258 1:114323900-114323922 CAGTGTCCCAGGGCCCACTGAGG - Intergenic
915184999 1:154098123-154098145 CAGAGAGCCAGTGCCCATGCTGG - Intronic
921097918 1:211902663-211902685 CAGAGAGCCAGTGCCCATGCTGG + Intergenic
922472863 1:225887652-225887674 CAGAGACCCAGCGCCGCTTGAGG + Intronic
1065972818 10:30818628-30818650 CAGAGACCCAGGACCCACCTAGG + Intergenic
1067098245 10:43316337-43316359 CAGAGACCCACCCCCCACCAGGG + Intergenic
1067444302 10:46331042-46331064 CAGTGTCCCACCGCCCACTGTGG + Intergenic
1072189619 10:93069106-93069128 CAGAGACCCGACGCACGCGGTGG + Intergenic
1073060251 10:100729646-100729668 CCGCGACCCAGCGCCAGCGGAGG - Intergenic
1073102058 10:101011661-101011683 CAGAGTCCCAGAGCCCAGGGAGG - Intronic
1076776844 10:132702760-132702782 CAGAGCCCCAGAGCACACTGTGG - Intronic
1076828819 10:132983892-132983914 CAGGGACCCAGAACCCACGCAGG - Intergenic
1077184374 11:1229737-1229759 CAGTGCCCCTGCACCCACGGCGG + Exonic
1077325648 11:1962887-1962909 CAGGGCCCCAGCGTCCACGGAGG - Intronic
1077430483 11:2513663-2513685 CAGAGAAACAGCGGCCAGGGTGG - Intronic
1077991376 11:7415184-7415206 CAGAGACCCAGACCCCCAGGTGG - Intronic
1078664252 11:13311345-13311367 AAGAGACCCAGAGGCCATGGAGG + Intronic
1081947213 11:47007925-47007947 CAGAGTCCCAGCCCCCAACGTGG + Intronic
1082983181 11:59142954-59142976 CACTGACCCCGTGCCCACGGCGG - Intronic
1084604871 11:70166552-70166574 CAGAGACCCAGCAGCCACTGGGG - Intronic
1084635514 11:70389775-70389797 TAGAGACCCAGCCCCCCAGGAGG - Intergenic
1086032280 11:82374534-82374556 CAGGGACACAGAGCCCACTGAGG + Intergenic
1202808628 11_KI270721v1_random:18066-18088 CAGGGCCCCAGCGTCCACGGAGG - Intergenic
1092257968 12:6937336-6937358 CAGGGGCCCAGGTCCCACGGTGG - Exonic
1092289266 12:7149473-7149495 CAGAGCCAAAGGGCCCACGGAGG - Intronic
1094018187 12:25885648-25885670 CAGAGAGCCAGTGCCCATGGCGG + Intergenic
1097648013 12:62260127-62260149 GAGAGAGCCAGAGCCCTCGGCGG + Intronic
1100848021 12:98679769-98679791 CAGAGAGCCAGAGCCCATGCTGG + Intronic
1101790064 12:107918156-107918178 CAGAGACCCAGCACCCAGGGAGG + Intergenic
1103008791 12:117441874-117441896 CATAGACCCAGACCCCACGTGGG + Intronic
1103568156 12:121827443-121827465 CAGAGATCCAGAGCCTAGGGTGG + Intronic
1103716712 12:122949450-122949472 CAGAGACCCTGCTCCCATGGGGG - Intronic
1104423757 12:128658005-128658027 CAGGGACGCAGCTCCCATGGAGG + Intronic
1104423766 12:128658042-128658064 CAGGGACGCAGCTCCCATGGAGG + Intronic
1104423775 12:128658079-128658101 CAGGGACGCAGCTCCCATGGAGG + Intronic
1104423784 12:128658116-128658138 CAGGGACGCAGCTCCCATGGAGG + Intronic
1104423793 12:128658153-128658175 CAGGGACGCAGCTCCCATGGAGG + Intronic
1104423802 12:128658190-128658212 CAGGGACGCAGCTCCCATGGAGG + Intronic
1104423811 12:128658227-128658249 CAGGGACGCAGCTCCCATGGAGG + Intronic
1104676502 12:130715263-130715285 CAGGGACCCAGAGGCCACGCAGG + Intronic
1104805653 12:131587697-131587719 CAGAGAGCCAGCCCCCATGCCGG + Intergenic
1104980522 12:132571373-132571395 CAGAGCCCCCGGGCCCAGGGAGG - Exonic
1108467168 13:50727900-50727922 CAGTGATCCAGCACCCACAGGGG - Intronic
1110648854 13:77919565-77919587 CAGAGACCCCGAGCAAACGGTGG - Exonic
1117343287 14:54809470-54809492 CAGGGTCCCAGAGCCCACAGAGG + Intergenic
1121239489 14:92418431-92418453 CAGAGAAGCAGAGCCCATGGAGG + Intronic
1122325896 14:100880486-100880508 CAGAGACCCAGCGCCAGCCCTGG - Intergenic
1122850093 14:104523343-104523365 AAGAGACCCAGAGCCCTCTGAGG + Intronic
1122968388 14:105142654-105142676 CCGGGACCCAGGGCCCTCGGTGG - Exonic
1123495289 15:20817252-20817274 CAGGGACCCACCTCCCACCGAGG - Intergenic
1123551778 15:21386345-21386367 CAGGGACCCACCTCCCACCGAGG - Intergenic
1127164722 15:56232433-56232455 CACAGACCCAGCGGCCTAGGAGG - Intronic
1127914185 15:63441874-63441896 CAGAGACCAGGCCCCCACTGAGG - Intergenic
1128129363 15:65215306-65215328 CAGAAACCCAGAGTCCAGGGTGG + Intergenic
1128672929 15:69587694-69587716 CAGAAACCAAGCCCCCATGGAGG - Intergenic
1129517604 15:76166180-76166202 CCGAGACCCACTGTCCACGGAGG - Intronic
1129814524 15:78540322-78540344 CCGCGACCCAGCTCCCACGAGGG + Intergenic
1131030629 15:89183608-89183630 CAGGGACCCAGGGCTCAGGGAGG - Intronic
1132141917 15:99403826-99403848 CACTGACCCAGAGCCCTCGGGGG - Intergenic
1202960123 15_KI270727v1_random:113587-113609 CAGGGACCCACCTCCCACCGAGG - Intergenic
1132585786 16:705338-705360 CCGAGGCCCAGCGGCCGCGGGGG + Intronic
1132700304 16:1219441-1219463 CAGTTTCCCAGGGCCCACGGCGG + Intronic
1133815705 16:9195805-9195827 AAGTGACCCAGCACCCATGGTGG - Intergenic
1134024646 16:10944644-10944666 GAGCGGCCCAGCGCCCGCGGCGG - Exonic
1136419318 16:30122473-30122495 TAGAGGCCCAGAGCACACGGTGG + Intronic
1138577330 16:57916337-57916359 GAGAGGCCCAGCCCCCAGGGAGG + Intronic
1138878395 16:60980048-60980070 CAGAGAGCCAGCACCCATGCAGG + Intergenic
1140888839 16:79268036-79268058 CAGAGACCCAGCTCCCCTAGAGG - Intergenic
1142584131 17:960142-960164 CAGAAACCCACCACCCACGGAGG + Intronic
1143509421 17:7387264-7387286 AGGAGACCCAGGGCCCAGGGTGG - Intronic
1146287234 17:31582170-31582192 CTGAGGCCCAGCGCCCACAGAGG + Intergenic
1146518881 17:33510896-33510918 CAGAGACCCAGCTCCTCCTGGGG + Intronic
1152267899 17:79306842-79306864 CAGAGGCCCAACGCCCAGGCTGG - Intronic
1152864096 17:82711979-82712001 CAGGGAGCCAGCGCCCCCAGTGG - Intergenic
1159088273 18:63818750-63818772 CAGAGACCCAGCTCCAACCTGGG - Intergenic
1160491719 18:79343714-79343736 CAGAGCACCAGAGCCCAGGGAGG - Intronic
1160709396 19:544157-544179 CTGAGGCCCAGCGCTCTCGGTGG + Intronic
1160930477 19:1567687-1567709 CAGCGACCCGGGGGCCACGGCGG + Exonic
1161124077 19:2546269-2546291 CAGAGACCCTGCACCCAGCGTGG + Intronic
1161781917 19:6298537-6298559 CAGAGAGCCAGTGCCCATGCCGG + Intergenic
1162525388 19:11203505-11203527 CAGAAACCCAGAGCCCAGGCAGG - Intronic
1162731357 19:12721006-12721028 CAGAGACCCAGCGCTGACCCCGG - Intronic
1163490898 19:17616723-17616745 CAGAGACCCAGCGCCCACGGAGG + Intronic
1163645146 19:18485096-18485118 CAGGGACCCAACCCCCACAGAGG - Intronic
1164743327 19:30593273-30593295 CAGAGACCCACTGCCCACAAAGG - Intronic
1165320290 19:35080722-35080744 CAGAGGGGCAGTGCCCACGGTGG - Intergenic
1166983960 19:46648976-46648998 CCGCGGCCCAGCGCCCACGCTGG - Exonic
1168405633 19:56108807-56108829 GAGGCACCCAGAGCCCACGGGGG - Intronic
1202714352 1_KI270714v1_random:33984-34006 CGGAGACACAGCGCCCACCGTGG + Intergenic
925997334 2:9304107-9304129 CAGGGACCCAGGGCTCAGGGCGG - Intronic
926147344 2:10404799-10404821 CAGAGAGCCTGGGACCACGGTGG - Intronic
930740713 2:54830325-54830347 CACAGACCCTGCGCCAAGGGAGG + Intronic
934119868 2:88828525-88828547 CAGAGACCCAGAGCCCACCTGGG + Intergenic
934567001 2:95346657-95346679 CAGAGGCGCAGCGCCCGCGCCGG + Intronic
936163344 2:110101063-110101085 CAGAGACCCAGGGTCCACCTGGG + Intronic
938291164 2:130151342-130151364 CAGAGTCCCTGAGCACACGGGGG - Intergenic
938465377 2:131521617-131521639 CAGAGTCCCTGAGCACACGGGGG + Intergenic
938547970 2:132352656-132352678 CAAAGGCCCAGCGCCCGCGCAGG + Intergenic
942380464 2:175385828-175385850 CAGAGACCCAGAGGCCTAGGAGG + Intergenic
946248375 2:218399666-218399688 CAGAGACTCAGCCCCGCCGGCGG + Intronic
947112933 2:226739004-226739026 CAGAGACCCAGGGCCCTGTGAGG + Intronic
948832115 2:240603240-240603262 CAGAGCCCTAGCACCCAAGGGGG + Intronic
1168742155 20:201011-201033 TAGAGACCCAAAGCCCACAGTGG + Intergenic
1170944760 20:20881329-20881351 CAATGACCCAGGGCCCACAGAGG - Intergenic
1171019775 20:21574679-21574701 CAGAGCACCAGAGCCCAAGGAGG - Intergenic
1172626567 20:36350817-36350839 CAGAGGCCCACAGCCCACTGGGG - Intronic
1172835717 20:37871825-37871847 CAGAACCCCAGCTCCCACAGAGG - Intronic
1173736163 20:45363178-45363200 CAAAGCTCCAGCGACCACGGCGG - Exonic
1175920682 20:62449310-62449332 CAGAGACCCAGTGCCGGGGGAGG + Intergenic
1176138345 20:63534761-63534783 CAGTGACCCAGGCCCCAGGGAGG + Intronic
1176155604 20:63618656-63618678 CAGAGCCCCAGAGCCCTCTGGGG + Intronic
1176443345 21:6798558-6798580 CAGGGACCCACCTCCCACCGCGG + Intergenic
1176821513 21:13663605-13663627 CAGGGACCCACCTCCCACCGCGG + Intergenic
1179822411 21:43944335-43944357 CAGGCACCCAGGGCCCACGGGGG - Intronic
1180177783 21:46098604-46098626 GAGAGGCCCTGCGCCCCCGGAGG - Intronic
1181720785 22:24772952-24772974 CAGAGACCCAGCACCCAGGGAGG - Intronic
1181809118 22:25392706-25392728 CAGGGACCCACAGCCCAAGGGGG + Intronic
1183472292 22:38016147-38016169 CAGGGACTCAGCACCCACTGGGG + Intronic
1184252270 22:43267657-43267679 CAGTGACACAGCGACCAGGGTGG + Intronic
1184472171 22:44702206-44702228 CACAGACCCGGCGCAAACGGAGG - Intronic
1184656367 22:45944027-45944049 CAGAGTCCCAGCCCCCACCTCGG + Intronic
1185043662 22:48518205-48518227 CAGACACCCAGATCCCACGTGGG - Intronic
1185309413 22:50145899-50145921 CAGAGACTCAGTGCTCAGGGAGG + Intronic
953495862 3:43386518-43386540 CAGAGACCCAGCACACAGTGAGG - Intronic
954124620 3:48521173-48521195 CAGGGACCCAGAGCCCAAGCAGG + Intronic
955303901 3:57810180-57810202 CAGAGAGCCAGCACCCATGCTGG + Intronic
957788078 3:84906140-84906162 CAGGGAGCCAGCCCCCACGCTGG + Intergenic
961451477 3:127004165-127004187 CAGCATCCCAGTGCCCACGGAGG - Intronic
961616155 3:128182817-128182839 CAGAGACCTGGCGACCACTGTGG + Intronic
965621208 3:170644021-170644043 AACAGACCCAGCTCCCAGGGTGG + Intronic
968814344 4:2814207-2814229 CAGAGACACAGCGCACATGAGGG + Intronic
969687060 4:8681596-8681618 CAGAGTCCCAGCGCCATGGGGGG + Intergenic
970507408 4:16745310-16745332 CAGAGACCCAGAGCCCAGGCGGG + Intronic
972355768 4:38278581-38278603 CAAAGACCCACCATCCACGGAGG + Intergenic
980729901 4:136811977-136811999 CAGACACCCCGAGCCTACGGGGG + Intergenic
985761004 5:1748686-1748708 CAGAAACTCAGCACCCAGGGAGG + Intergenic
987744046 5:21947792-21947814 CACAGACCCAGCGGCCTCTGAGG + Intronic
989349228 5:40465902-40465924 CTGAGAACAAGCGCCCAAGGTGG - Intergenic
993186961 5:84634517-84634539 CAGAGAGCCAGCACCCATGCTGG - Intergenic
1002714236 5:181216504-181216526 CAGAGTCCCAGTGGCCAAGGAGG + Intergenic
1002986340 6:2192668-2192690 CAGAGAGCCAGTGCCCATGCTGG + Intronic
1004234837 6:13865351-13865373 CAGAGGCACAGCGGCCACGGAGG + Intergenic
1004854322 6:19734056-19734078 ACGAGTCCCAGCACCCACGGTGG + Intergenic
1004889770 6:20089421-20089443 CTGAGCCCCAGAGCCCACAGTGG + Intergenic
1005832157 6:29680050-29680072 CAGAGATTCAGTCCCCACGGGGG - Intronic
1006211954 6:32403238-32403260 CTGACACCCAGAGCCCACAGAGG + Intronic
1008952065 6:57172340-57172362 CAGAGACCGAGCGCCTAATGTGG - Exonic
1012583177 6:100892883-100892905 CAGAGCCCAAGCCCCCAAGGCGG - Intergenic
1015261624 6:131244281-131244303 GAGAGAGCCAGGGCCCAAGGAGG - Intronic
1018674330 6:166205986-166206008 CAGTGACCCAGCAGCCGCGGTGG - Intergenic
1020169121 7:5831512-5831534 CAGAGACCCAGGGCCCACCCTGG - Intergenic
1025261791 7:57425048-57425070 CAGAGCCCCAGCGCGGACGCAGG + Intergenic
1026979876 7:74519883-74519905 CAGAGACCCAAGGTCCAAGGGGG - Intronic
1029371754 7:100154957-100154979 CAGAGACCCAACGCCCCCAGAGG - Exonic
1031836562 7:126686577-126686599 CAGAGAGCCAGCACCCACACTGG + Intronic
1032785555 7:135196957-135196979 CAGAGACCCAAGGGCCACTGGGG + Intronic
1034987241 7:155523880-155523902 AAGAGACCCAGACCACACGGGGG + Intronic
1035249484 7:157587819-157587841 CAGGGAGCCAGTTCCCACGGTGG + Intronic
1035271463 7:157722433-157722455 CTGGGACCCAGCGCCCATGTCGG + Intronic
1038581655 8:28753427-28753449 CAGGGAGCCAGCGCTCACAGTGG - Exonic
1041225086 8:55689759-55689781 CACAGAGGCAGCGCCCAGGGAGG + Intergenic
1041281883 8:56218900-56218922 CAGAGGCCCAGCGGGCACGAGGG - Intergenic
1042200617 8:66276692-66276714 CAGAGACCCAGCATCCTCTGTGG - Intergenic
1042784987 8:72537033-72537055 CAGAGCCCCGGCGTCCCCGGCGG + Intergenic
1046793555 8:118346887-118346909 CAGAGACTCAGTGGCCAAGGTGG + Intronic
1047940406 8:129823398-129823420 CAGAGACCCAGAGGCCTAGGAGG + Intergenic
1048669038 8:136695838-136695860 CACAGACCCAGAGGCCAAGGAGG + Intergenic
1049182825 8:141231660-141231682 CAGAGACCCAGGGACCATGGGGG + Intronic
1049293824 8:141819042-141819064 CTGAGGCTCAGGGCCCACGGGGG - Intergenic
1049313073 8:141943664-141943686 CAGAGACCCACGGGCCACAGGGG - Intergenic
1051610072 9:18952972-18952994 CAATGACCCATCGCCCACAGCGG + Intronic
1054169993 9:61829625-61829647 CACAGACCCAGAGGCCTCGGGGG - Intergenic
1054667545 9:67751190-67751212 CACAGACCCAGAGGCCTCGGGGG + Intergenic
1055933561 9:81584354-81584376 CAGAGGCCCTGCTCCCTCGGAGG + Intronic
1057222099 9:93262930-93262952 CAGAGACCCAGAGCCCAGCCAGG - Intronic
1057468673 9:95338459-95338481 CAGAGAACCAGCACCCATGCTGG + Intergenic
1057510726 9:95677819-95677841 CAGGGAGCCAGCGCCCATGCTGG - Intergenic
1059257677 9:112945795-112945817 CAGATACCTGGCGCCCCCGGTGG - Intergenic
1059283121 9:113151317-113151339 CAGTTACCGAGCGCCCGCGGTGG + Intronic
1060052227 9:120385642-120385664 CAGAGACCCGGCTCCCCAGGTGG - Intergenic
1061285868 9:129622065-129622087 CAGAGTCCCAGTGCCCCAGGTGG - Intronic
1061861951 9:133472761-133472783 CTGAGACCCAGCGCCCAGGAGGG + Intronic
1203525856 Un_GL000213v1:85969-85991 CAGGGACCCACCTCCCACCGCGG - Intergenic
1192174003 X:68874601-68874623 CAGAGAACCAGGGCCTAGGGGGG + Intergenic
1192549924 X:72045509-72045531 CTGAGCCCCAGAGGCCACGGGGG - Intergenic
1194316234 X:92380199-92380221 CAGGGATCCAGTGCCCACGCTGG + Intronic
1194412879 X:93578172-93578194 CAGGAACCCAGCGCCCTCAGTGG - Intergenic
1195111604 X:101656500-101656522 CCGAGACCCAGCGCAGAGGGAGG - Exonic
1195178903 X:102338322-102338344 CAGAGAGCCAGCACCCATGCTGG - Intergenic
1200392308 X:155956395-155956417 CAGAGAGCCAGCACCCATGCCGG - Intergenic
1200624278 Y:5491772-5491794 CAGGGATCCAGTGCCCACGCTGG + Intronic