ID: 1163490899

View in Genome Browser
Species Human (GRCh38)
Location 19:17616724-17616746
Sequence AGAGACCCAGCGCCCACGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163490896_1163490899 3 Left 1163490896 19:17616698-17616720 CCAGGACTGGAAGGGAAGCTGAG No data
Right 1163490899 19:17616724-17616746 AGAGACCCAGCGCCCACGGAGGG No data
1163490891_1163490899 22 Left 1163490891 19:17616679-17616701 CCAGGGACACTAAAAGCAGCCAG No data
Right 1163490899 19:17616724-17616746 AGAGACCCAGCGCCCACGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163490899 Original CRISPR AGAGACCCAGCGCCCACGGA GGG Intronic