ID: 1163491627

View in Genome Browser
Species Human (GRCh38)
Location 19:17620268-17620290
Sequence CAAATATTTCCACAGTAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 1, 2: 1, 3: 31, 4: 325}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163491627_1163491633 25 Left 1163491627 19:17620268-17620290 CCCATTTACTGTGGAAATATTTG 0: 1
1: 1
2: 1
3: 31
4: 325
Right 1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG 0: 1
1: 0
2: 0
3: 7
4: 74
1163491627_1163491631 12 Left 1163491627 19:17620268-17620290 CCCATTTACTGTGGAAATATTTG 0: 1
1: 1
2: 1
3: 31
4: 325
Right 1163491631 19:17620303-17620325 TAGTCTACCAGCTGGCCATCTGG 0: 1
1: 0
2: 0
3: 4
4: 64
1163491627_1163491630 4 Left 1163491627 19:17620268-17620290 CCCATTTACTGTGGAAATATTTG 0: 1
1: 1
2: 1
3: 31
4: 325
Right 1163491630 19:17620295-17620317 TATGTTCATAGTCTACCAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163491627 Original CRISPR CAAATATTTCCACAGTAAAT GGG (reversed) Intronic
903567685 1:24280841-24280863 AATATTTTTCCACAGTAGATTGG + Intergenic
905307364 1:37028965-37028987 CTAATAATTGCACAATAAATTGG + Intronic
905781292 1:40712529-40712551 CAAATATTTATAAAGTAAACTGG + Intronic
908662230 1:66449330-66449352 CTAAAATTTCTACAATAAATAGG + Intergenic
910290573 1:85596537-85596559 TAAGTACTTCCACAGTAAAAGGG - Intergenic
911422767 1:97665182-97665204 CAAATATTTCTACAGTCAACAGG + Intronic
911648188 1:100357571-100357593 CAAATAATTACACAGTACAAAGG - Intronic
911668796 1:100585391-100585413 CAAAAATTTCCACAGTAAATGGG - Intergenic
912587092 1:110777067-110777089 CAAAGAATCCCACAGTAATTTGG - Intergenic
912616504 1:111105828-111105850 CAAATATTTCTATATAAAATAGG - Intergenic
914223362 1:145700039-145700061 CAAATATTCTCACAGAAAATGGG - Intronic
916839925 1:168589112-168589134 GAAACATGTCCACATTAAATGGG + Intergenic
917437366 1:175034957-175034979 CAAACATTGCCAAACTAAATGGG + Intergenic
919337457 1:196255629-196255651 CATATATGTTCACAATAAATAGG + Intronic
920796971 1:209148225-209148247 TAAATATTTGCAAAGTAATTAGG - Intergenic
921039817 1:211419244-211419266 TAAAAATTTCCACTGTAAATAGG - Intergenic
921241539 1:213189117-213189139 CAAATATTGCTAGAGTAACTGGG + Intronic
921612791 1:217232303-217232325 CAAAAATATTCACACTAAATGGG - Intergenic
921883797 1:220283122-220283144 AAATTATTTCTACAGTGAATTGG - Intergenic
922661141 1:227431446-227431468 CCAATGTTTCCATAATAAATAGG + Intergenic
922897538 1:229112132-229112154 CAAAGATTACCACAGAAAACAGG + Intergenic
923396621 1:233572105-233572127 TAAAAATTTCCACAGTGATTTGG + Intergenic
923476162 1:234333275-234333297 CAAGGATTTCCATAGAAAATGGG - Intergenic
924650787 1:245925382-245925404 CTAATATTTGTACAATAAATAGG + Intronic
924767610 1:247048040-247048062 TAAATTTTTCCTCAGAAAATGGG + Intronic
1063436280 10:6034988-6035010 CAAATTTTCCCACAGTCCATAGG - Intronic
1063469327 10:6271947-6271969 TAAATATTCCCTAAGTAAATAGG - Intergenic
1064067304 10:12193491-12193513 CAAATATTTCCACTGTTGAAAGG + Intronic
1064426957 10:15237902-15237924 TGAATATTTCCACTGTAAAAAGG + Intronic
1064552555 10:16519557-16519579 CGAATTTCTCCACAGTAAAGTGG + Intronic
1064616438 10:17163089-17163111 CAATTTTGTCCAAAGTAAATAGG + Intronic
1066650389 10:37649665-37649687 CAAATCTTTCAAAATTAAATGGG + Intergenic
1067181065 10:43986318-43986340 GAAAAATGTCCACAGTATATAGG - Intergenic
1068103253 10:52581982-52582004 TAAATATCTCCTCAGAAAATTGG + Intergenic
1068566914 10:58586377-58586399 CAAATATTTAGAAAGTCAATTGG - Intronic
1069040748 10:63693529-63693551 TAAATATTGCCTCAGAAAATGGG - Intergenic
1069331340 10:67297188-67297210 CAAAGAGATTCACAGTAAATGGG - Intronic
1069443527 10:68451516-68451538 AAAATATTTTCCCAGTAGATAGG - Intronic
1069510782 10:69040926-69040948 CAAATGTTTCCAGAGGAAATTGG - Intergenic
1072528597 10:96297057-96297079 CAATTATTTAGACAGTGAATTGG - Intergenic
1073096973 10:100985731-100985753 CAACTATTTGCAGAGGAAATTGG + Intronic
1074928753 10:118101840-118101862 CAAATATCTGCAAAGGAAATTGG - Intergenic
1075435443 10:122437053-122437075 TAAATGTTTCCACAGGGAATAGG - Exonic
1076689690 10:132216502-132216524 CAAATTTCTCCTCAGAAAATGGG - Intronic
1079603236 11:22337127-22337149 CACATATTTCATCAGTATATTGG + Intergenic
1079938036 11:26642266-26642288 CAAATATTTGCTCATAAAATAGG - Intronic
1080194456 11:29592571-29592593 AAAATATCTGCACAGTAAATGGG + Intergenic
1080545030 11:33308491-33308513 CTATTATTTCCATAGAAAATTGG + Intronic
1080958469 11:37130058-37130080 CAAATTTCTCCCCAGAAAATGGG - Intergenic
1081164953 11:39797215-39797237 CAAATAATTCCACAAGAAATAGG - Intergenic
1081283547 11:41240960-41240982 CATGTCTTTCCACAGTAAAATGG - Intronic
1082810363 11:57475974-57475996 CCACTTTTTCCACAGCAAATAGG + Intronic
1083317141 11:61823003-61823025 GAAATAATTCAGCAGTAAATTGG - Intronic
1084289748 11:68154435-68154457 GTCATATTTCAACAGTAAATGGG + Intergenic
1084576445 11:69991561-69991583 GAACTATTTCCACAGAACATCGG - Intergenic
1085987072 11:81800579-81800601 CAAATTTCTCCTCAGGAAATGGG - Intergenic
1086415833 11:86588189-86588211 CAAATAGTTTCACAATTAATTGG + Intronic
1086591261 11:88516779-88516801 CCAAGAATTCCACAGGAAATGGG - Intronic
1087116208 11:94527702-94527724 AAAATATTTCCAAAGATAATAGG - Intergenic
1087554750 11:99702786-99702808 CCAATATTTCAACACTGAATAGG - Intronic
1093405809 12:18802530-18802552 CATTAATTTCCACAATAAATGGG - Intergenic
1093813393 12:23513865-23513887 CATATTTTTCCAGATTAAATTGG - Intergenic
1094060350 12:26308445-26308467 CAAATATTTCCCCATTTTATAGG - Intergenic
1095075533 12:37917914-37917936 CAAAAATTCCTACAGTAAACAGG - Intergenic
1095237154 12:39811105-39811127 CACATATTTCCAAAAGAAATAGG - Intronic
1096762215 12:53851394-53851416 CAAATATCTCCAAAGAAACTGGG + Intergenic
1096823520 12:54256159-54256181 CAAATATTTCCAGTGGAAATGGG + Intronic
1097878566 12:64666799-64666821 CAACTATTTGCACAGTATTTAGG + Intronic
1099545538 12:83975112-83975134 CACATACATCTACAGTAAATAGG + Intergenic
1099623805 12:85040730-85040752 CTAATATATCTACAGTATATTGG + Intronic
1099642265 12:85306137-85306159 GAGCTATTTACACAGTAAATAGG + Intergenic
1099678990 12:85800161-85800183 CATATTCTTCCACAATAAATTGG + Intergenic
1099925566 12:89012325-89012347 CAGATACTTCCACAGTAATTGGG + Intergenic
1100032282 12:90208321-90208343 AACAGATTTACACAGTAAATTGG + Intergenic
1100581635 12:95944752-95944774 ATAATATTTTCATAGTAAATTGG - Intronic
1101291010 12:103369357-103369379 CAAATATATCTACAATAGATTGG + Intronic
1102431168 12:112883897-112883919 CAAATACATCAACAGTAAACTGG - Intronic
1102431253 12:112885103-112885125 CAAATACATCAACAGTAAACTGG - Intronic
1102847555 12:116203267-116203289 CAAATGTTTACAAAATAAATAGG + Intronic
1102890307 12:116553441-116553463 CAAACTTTTCCACAGTGAGTGGG - Intergenic
1104701599 12:130908685-130908707 CCAATATTTCCATAGGAAATAGG - Intergenic
1105415100 13:20205067-20205089 GAAGTATTTCATCAGTAAATAGG - Intergenic
1106676497 13:31964791-31964813 CAAATATTACAACTGGAAATAGG - Intergenic
1106700697 13:32225276-32225298 CAAATATATCCAAAATAAGTTGG + Intronic
1107259559 13:38474103-38474125 AAAATAATCCCACAGAAAATAGG - Intergenic
1108019679 13:46114190-46114212 GCAATAATTCCACAGAAAATTGG - Intergenic
1108869679 13:54968196-54968218 AAAATGTTTCTACAATAAATAGG - Intergenic
1109723179 13:66303007-66303029 CACATTTTTCCACAGTATAATGG - Exonic
1109917754 13:69014366-69014388 TAAATCTTTCCCCATTAAATAGG - Intergenic
1110843155 13:80165730-80165752 CAAATATTTCTTGAATAAATGGG - Intergenic
1111103867 13:83621151-83621173 TTATTATTTCCATAGTAAATTGG - Intergenic
1111227450 13:85292860-85292882 CAAAAATTTCAAAAGTATATTGG + Intergenic
1111607792 13:90563448-90563470 CTAACATTTCCACAGAAACTTGG + Intergenic
1112715417 13:102179356-102179378 CAAGTTTTTCCACTGTAAACTGG + Intronic
1113243003 13:108360743-108360765 CAAATATCTCCACTCTAATTTGG - Intergenic
1113420503 13:110167737-110167759 CGAATATTGCCACAGTATAAAGG - Intronic
1116637186 14:47412047-47412069 AAAATATTACCAAACTAAATGGG - Intronic
1116674071 14:47882562-47882584 CAAATACTTCCATAACAAATTGG - Intergenic
1118245637 14:64107777-64107799 CAGATATTTACAAAGAAAATAGG + Intronic
1118539265 14:66804339-66804361 CAAATACTTTGACAGGAAATAGG + Intronic
1118898835 14:69969796-69969818 CCAATATTTCCAAAGTTATTTGG + Intronic
1120622853 14:86787273-86787295 TAAATATTTTCACACAAAATTGG + Intergenic
1120622949 14:86788599-86788621 TAAATATTTTCACATAAAATTGG - Intergenic
1120688176 14:87563263-87563285 TAAATTTTTCCCCAGAAAATGGG - Intergenic
1120707725 14:87761740-87761762 TAAATATTTCCACTCCAAATGGG - Intergenic
1123156933 14:106235806-106235828 CAAATATTTACAGATGAAATAGG - Intergenic
1124079929 15:26483400-26483422 CAAATTTATCAACAGTAAGTGGG + Intergenic
1125175143 15:36812510-36812532 AAAACATTTCCACAGTACAGGGG + Intergenic
1129849652 15:78785660-78785682 CAAATATGTTAACACTAAATTGG + Intronic
1130058390 15:80550391-80550413 CAAATATTTCCACACTGGGTCGG - Intronic
1131695667 15:94875440-94875462 AATATATTTTAACAGTAAATAGG - Intergenic
1134373307 16:13646263-13646285 CAAATTTGTCCAGAGTAGATTGG - Intergenic
1135048678 16:19174590-19174612 CAAATATTTCCATAGCAAAATGG + Intronic
1135595032 16:23735311-23735333 AAAATCTTTCCTCATTAAATTGG + Intergenic
1135851130 16:25964935-25964957 TAAATATTTGCAGAATAAATGGG - Intronic
1137993650 16:53185524-53185546 CAAATTTCTCCCCAGAAAATGGG - Intronic
1139048422 16:63092169-63092191 CAAATATTTTCTCCTTAAATGGG + Intergenic
1139931319 16:70528958-70528980 CGAATACTTCCACAGTGAGTAGG - Exonic
1143364567 17:6397748-6397770 CAAGTATTTCCAGATTGAATGGG + Intronic
1143407723 17:6689029-6689051 CAAATATATCCATAGTAACAGGG - Intronic
1144486476 17:15669744-15669766 GATATACTGCCACAGTAAATTGG + Intronic
1144914542 17:18712546-18712568 GATATACTGCCACAGTAAATTGG - Intronic
1145805096 17:27721051-27721073 CAAATACTTACATAGGAAATGGG - Intergenic
1145985696 17:29044729-29044751 CAAATATTTCCACACAATCTGGG - Intronic
1146153278 17:30496194-30496216 CAAATACTTACACAGCAAATGGG - Intronic
1147508103 17:41040594-41040616 GAAATATTTCAACAGTTATTGGG - Exonic
1148259127 17:46164245-46164267 CAACTATATCTACGGTAAATGGG + Intronic
1149078416 17:52624938-52624960 CCAATATTTCCAAAGTTAATTGG + Intergenic
1149100251 17:52897460-52897482 CAAATATTTATACAAAAAATAGG - Intronic
1149137849 17:53391202-53391224 CAAATAATTCCAGAGTCAATTGG + Intergenic
1149526209 17:57357764-57357786 CAAAGATTTGATCAGTAAATAGG + Intronic
1150166033 17:62944388-62944410 CTAATTTCTCCAAAGTAAATTGG + Intergenic
1151401831 17:73860789-73860811 CACATTTTTAGACAGTAAATAGG + Intergenic
1152826653 17:82470437-82470459 AAAATGTATCCACAGTAAAATGG + Intronic
1154136166 18:11780505-11780527 AAAATATTTCAGCTGTAAATTGG + Intronic
1156194605 18:34759981-34760003 CAAATAATTCAACAGTACTTAGG - Intronic
1156901674 18:42307894-42307916 GAAATATTTCCAAACTAATTAGG - Intergenic
1157129595 18:44994061-44994083 CAAATATTTTCACAGTTGATAGG - Intronic
1158092578 18:53731813-53731835 CTAATAGTTCCACAGGCAATTGG - Intergenic
1158286060 18:55884476-55884498 AAAATATTTCTAGAGTTAATTGG - Intergenic
1163491627 19:17620268-17620290 CAAATATTTCCACAGTAAATGGG - Intronic
1164963850 19:32461932-32461954 AACATATTTCCACAGAAAACAGG - Intronic
1165247642 19:34506409-34506431 CAAGGCTTTCCAGAGTAAATAGG - Exonic
926544415 2:14221617-14221639 TAAATATTTTGACAGAAAATTGG + Intergenic
929073506 2:38058111-38058133 CAATTATTTCCAAAGAAAAAAGG - Intronic
929744657 2:44643625-44643647 AAAATATTTCCAAAGGAATTTGG + Intronic
930957798 2:57225013-57225035 CTAATATTTTAACAATAAATTGG - Intergenic
931130001 2:59324958-59324980 CAAATATTTTCTCAGTACATAGG + Intergenic
931307944 2:61050469-61050491 TGAATATTTCCCCAGAAAATTGG + Exonic
932318073 2:70799409-70799431 CAAATTTCTCCTCAGGAAATGGG + Intergenic
932472534 2:71970468-71970490 CAAATATTTGCAAAGCAGATGGG + Intergenic
932869133 2:75379456-75379478 CAAATATTTCTTCAGTCCATGGG - Intergenic
933221757 2:79698315-79698337 CCTATATTTAGACAGTAAATTGG + Intronic
933454290 2:82501900-82501922 TAAATTTCTCCACAGAAAATGGG - Intergenic
934749501 2:96783926-96783948 AAAATATTTCCACCACAAATTGG - Intronic
935075123 2:99734469-99734491 CAAATGTTTCAACACTAAATAGG + Intronic
935867013 2:107399537-107399559 CAAATATTCTTACAGTAAAGTGG + Intergenic
936446593 2:112600936-112600958 CAAACTTTTCCACAGTAACTAGG - Intergenic
936455040 2:112666479-112666501 CAAATATTACTACCATAAATGGG - Intergenic
939546910 2:143565983-143566005 GAAATGTTTCCAAAGTACATGGG - Intronic
940573020 2:155465741-155465763 AAAATATTTTCACGGTAAAACGG - Intergenic
941666702 2:168249403-168249425 CCATCATTTCTACAGTAAATCGG + Intergenic
942555071 2:177164293-177164315 CAAATATTTCTACTGTGAAGAGG - Intergenic
943166218 2:184329269-184329291 CAATTATTTGCCTAGTAAATAGG - Intergenic
943718409 2:191177328-191177350 CAAATATTGCCATAATGAATGGG - Intergenic
943728845 2:191280676-191280698 CAGATTTTTCCAAAGTAGATAGG + Intronic
944281650 2:197904661-197904683 CAACTATTTCCTCAGGAAGTGGG - Intronic
944965636 2:204928977-204928999 TAAATATTTCCACTCTAAAAAGG - Intronic
944985219 2:205168507-205168529 CAAATTATTCCAAAGCAAATGGG + Intronic
945730207 2:213523930-213523952 CAAATTTCTCCCCAGAAAATGGG - Intronic
946490136 2:220140765-220140787 CAAATATTTTCTCAGTCAGTGGG + Intergenic
946939672 2:224757960-224757982 CAAATTTCTCCTCAGAAAATGGG - Intergenic
947686534 2:232090838-232090860 TAAATATTTCCTCAGCAAATAGG - Intronic
948155844 2:235780318-235780340 TATGTATTTCCACAGAAAATTGG + Intronic
948242620 2:236450212-236450234 AAAATATTTTCAAAGAAAATTGG - Intronic
1170354095 20:15473347-15473369 AAAATATTTGCACAGTGAAAGGG + Intronic
1172820121 20:37725215-37725237 CAAATATTTTGACATTAAAAAGG + Intronic
1173235650 20:41243219-41243241 CTAGTAATTCCACAGTGAATAGG + Intronic
1177034380 21:16023743-16023765 AAAATATTTACACAGTTTATAGG - Intergenic
1177075750 21:16570931-16570953 CAAATTTTTCCAAGGTATATGGG + Intergenic
1177251283 21:18594800-18594822 AAAAGAATTCCACAATAAATGGG - Intergenic
1177565436 21:22815440-22815462 CAAATATTAACAAATTAAATGGG - Intergenic
1177627675 21:23684782-23684804 AAATTATTTCCAGATTAAATTGG + Intergenic
1178603049 21:34011643-34011665 CAAATATTTAAATAATAAATCGG - Intergenic
1178749992 21:35293392-35293414 CAAATAACTCAAAAGTAAATTGG + Intronic
1179151381 21:38811782-38811804 GAAAGATTTCCAAAGGAAATAGG - Intronic
1179319118 21:40272761-40272783 CAAATATTTCTAAATTCAATAGG - Intronic
1181995144 22:26872555-26872577 CAAACATTTCCCCACAAAATAGG - Intergenic
1182818123 22:33187162-33187184 CAAATACTTCCTCAACAAATCGG - Intronic
1182986266 22:34720722-34720744 CAAATTCTTCCTCAGTAATTTGG - Intergenic
1184761982 22:46550109-46550131 CCAGTATTGCCACAGTAAAGGGG - Intergenic
949557999 3:5175369-5175391 CAAAAATTAACACAATAAATTGG - Intronic
949756704 3:7419944-7419966 GATATCTTTCCACAGTAAACAGG - Intronic
950039100 3:9908376-9908398 CAAGTATATCTCCAGTAAATTGG + Intronic
951081769 3:18458586-18458608 CAATTATTTCCAGAGGAAAGGGG - Intergenic
952116343 3:30186282-30186304 CAGTTATTCACACAGTAAATTGG - Intergenic
952947876 3:38492915-38492937 CTAAAATTACCACAGTAAAAAGG - Exonic
955452100 3:59079422-59079444 TAAATATTTCCACAGACAACAGG - Intergenic
956002465 3:64743952-64743974 CAAATATTTTTTGAGTAAATGGG - Intergenic
957438583 3:80212325-80212347 CAAGTATTTCCACAATAGAATGG + Intergenic
957465419 3:80583624-80583646 CAAAAATTTTCTCAGGAAATTGG - Intergenic
958589035 3:96130207-96130229 CAAATATTTCTACTGAAAATGGG + Intergenic
959491963 3:107001092-107001114 CCAGTTTTTCCACAGTAAAATGG + Intergenic
959847366 3:111049558-111049580 CCAATTTTTACACAGAAAATGGG + Intergenic
960348821 3:116568810-116568832 CTAATATTTTCACTCTAAATTGG + Intronic
961847258 3:129776428-129776450 CAAATAATGCCAAAGAAAATAGG + Intronic
962440981 3:135415921-135415943 CAAAAATCTCCAAAGAAAATAGG + Intergenic
962678362 3:137772362-137772384 CACATTTTTCTACAGTAATTGGG + Intergenic
964050120 3:152381442-152381464 AAAATATTTTAACTGTAAATAGG - Intronic
965397014 3:168172465-168172487 CAAATATTTACACTGGAAATAGG - Intergenic
966094504 3:176183590-176183612 CAACTATTTACACAGCATATAGG - Intergenic
967797334 3:193611878-193611900 AAAATTTTTCCACAAAAAATTGG - Intronic
970911567 4:21283090-21283112 CAAATATATTCATAGAAAATGGG - Intronic
970997269 4:22281901-22281923 AAAGTATTTCTACAGTTAATAGG - Intergenic
971818204 4:31517706-31517728 CACATCTTTACACAGTAAATAGG + Intergenic
973168749 4:47112275-47112297 GAAATATTTACACAGTAGCTGGG + Intronic
975863687 4:78704029-78704051 CCACTATTTACACACTAAATAGG + Intergenic
975905286 4:79203965-79203987 AAAATGTTTGCATAGTAAATGGG + Intergenic
977504007 4:97878811-97878833 CAAATTTCTCCTCAGAAAATGGG + Intronic
977662979 4:99612316-99612338 CACTTATTTCCACAACAAATAGG - Intronic
977999296 4:103537369-103537391 CAAATATTTCCTGACTAAATCGG - Intergenic
978053740 4:104237016-104237038 CAATTTTTTCAACAGTAAAATGG + Intergenic
978514281 4:109554887-109554909 CAAACTTTCCCACAGTATATAGG - Intergenic
978869685 4:113560539-113560561 TACATATTTCCTCTGTAAATGGG - Intronic
979125677 4:116969125-116969147 CAAAGTTTTCCCCAGAAAATGGG + Intergenic
979727242 4:123977093-123977115 GGAATATATCCCCAGTAAATTGG - Intergenic
982070997 4:151694230-151694252 GAAATTATTCCACAGGAAATTGG + Intronic
982251456 4:153411398-153411420 TAAAAATTTCTACATTAAATAGG + Intronic
982769571 4:159383965-159383987 TAAATATTGCAACAGGAAATTGG - Intergenic
982805778 4:159760725-159760747 AAAATAAGTGCACAGTAAATAGG - Intergenic
983523863 4:168739827-168739849 CAAAAATTCACGCAGTAAATAGG - Intronic
983673949 4:170269778-170269800 CACATATATACAGAGTAAATGGG + Intergenic
984049883 4:174852145-174852167 CAAATAAATCCAAAGTAAACAGG - Intronic
984062130 4:175002768-175002790 TAAATTTTTCCTCAGAAAATGGG - Intergenic
985319346 4:188692112-188692134 CAACTATTTCCCCACTAAAGGGG + Intergenic
985849508 5:2378449-2378471 CAAAAATTTCCACCGAACATGGG - Intergenic
985878085 5:2615860-2615882 CAAATTATTACACAGTTAATAGG + Intergenic
986891617 5:12315658-12315680 CAAATTTTGCTACAGAAAATGGG + Intergenic
987130577 5:14856418-14856440 CAACTTTTTCAACTGTAAATAGG - Intronic
987636272 5:20545823-20545845 TGAATAATTCCACAGAAAATGGG + Intronic
988125878 5:27036105-27036127 ACAATATTTCTACAGTATATGGG - Intronic
988858605 5:35253283-35253305 CAAATTTTTCCACAGAAAATGGG + Intergenic
988889736 5:35601911-35601933 CAAATATTCCCATTGAAAATGGG + Intergenic
988897131 5:35688923-35688945 CAAATATTTCCAAATGAGATTGG + Intronic
989762645 5:45036940-45036962 GAAATATTTTCATAGTCAATGGG - Intergenic
989999021 5:50871118-50871140 CAATTATTTCCACAGTAACATGG - Intergenic
991159826 5:63485115-63485137 AAAATATTTCCAAACAAAATGGG - Intergenic
991192545 5:63892191-63892213 AATATATTTCCATAATAAATTGG + Intergenic
991214209 5:64143345-64143367 CAAATATTTCAACCTTAAAAAGG + Intergenic
992194628 5:74327036-74327058 CAGCTATTTTCACAGTATATTGG + Intergenic
993703826 5:91148180-91148202 CAAATTTCTCCCCAGAAAATGGG - Intronic
994063984 5:95514040-95514062 CAAATGCTACCACAGTGAATGGG + Intronic
994458324 5:100043801-100043823 CAAATATTTCTTCAGTAAACAGG + Intergenic
994512024 5:100716333-100716355 CAATTTTTTCCAAAATAAATTGG + Intergenic
994765420 5:103909844-103909866 CATAAATTTCAAAAGTAAATTGG - Intergenic
994955102 5:106519664-106519686 CAAATATTTCCACTATTAACAGG + Intergenic
995084607 5:108092954-108092976 GAAATAATTACACAGAAAATTGG + Intronic
996587655 5:125108778-125108800 CAAGTATTTCTACAACAAATAGG - Intergenic
996975998 5:129435440-129435462 TCAATATTTCCATGGTAAATAGG + Intergenic
997536434 5:134625913-134625935 CAAATTTTACAACAGCAAATTGG - Intronic
998655072 5:144170057-144170079 CAAATATTTTTTCAGTAATTCGG + Intronic
998906425 5:146910010-146910032 CAAATATTTAAAAAGTAAACAGG - Intronic
1000918508 5:167110614-167110636 AAAATATTTCCAGAATACATTGG + Intergenic
1001045973 5:168371999-168372021 CATATATGTCCATAGTGAATTGG + Intronic
1001223516 5:169924291-169924313 CATATATTTTCAAAATAAATAGG + Intronic
1002038984 5:176496786-176496808 TAAATATTTTGACAATAAATGGG - Intronic
1002356479 5:178633527-178633549 CAAATCATTCCCCATTAAATAGG + Intergenic
1003599542 6:7504404-7504426 CAAATAATTCCTCTGAAAATAGG - Intergenic
1003689250 6:8336618-8336640 CAAGAAATTCCAGAGTAAATGGG - Intergenic
1004539681 6:16538109-16538131 GAAATATGTCCACTGAAAATAGG + Intronic
1005261265 6:24063388-24063410 CAAATATTTTACCAGAAAATAGG + Intergenic
1005314359 6:24589803-24589825 CAAATAATTCAATAGTAAACAGG + Intronic
1005350133 6:24926261-24926283 TAAATATTTACTCAGGAAATAGG + Intronic
1008977894 6:57449275-57449297 CAAATAATTTCTCATTAAATTGG + Intronic
1009166041 6:60342223-60342245 CAAATAATTTCTCATTAAATTGG + Intergenic
1009288754 6:61857194-61857216 TACATATTTCATCAGTAAATGGG + Intronic
1009856853 6:69275765-69275787 TAGATATTTTCACAGTACATGGG + Intronic
1009860429 6:69323373-69323395 CAGATATTTAAACCGTAAATTGG + Intronic
1009901067 6:69808202-69808224 TAAATTTTTCCTCAGAAAATGGG + Intergenic
1009962717 6:70543301-70543323 CAAATATTTCAAGAGTAGAATGG - Intronic
1010629379 6:78179355-78179377 CAAATATTCTCACTGTAAATGGG + Intergenic
1011857479 6:91712837-91712859 TAAAGATTTCCACAGTAATAAGG - Intergenic
1012056468 6:94418066-94418088 CAAATATTTCAACAATGAAAGGG + Intergenic
1012201332 6:96410079-96410101 CACATATCTCTACAGTCAATAGG - Intergenic
1012669396 6:102022771-102022793 CAAATATTTATAGAGCAAATGGG + Intronic
1013096974 6:106954193-106954215 AAAATATTTCCACTCAAAATAGG + Intergenic
1013648210 6:112166746-112166768 AAGATATTTCCACAGAAAAGTGG + Intronic
1013968496 6:115985615-115985637 CAGTTACTTCCACTGTAAATTGG + Intronic
1014595355 6:123330192-123330214 AAAATATTTCCACCTTATATTGG + Intronic
1014942270 6:127456673-127456695 CAAATCCTTCCACAAAAAATTGG - Intronic
1015471038 6:133606752-133606774 CAAAAATTCCCACAGGTAATAGG - Intergenic
1015639670 6:135317553-135317575 CAGATATGTACACAGTATATTGG - Intronic
1017585501 6:155917808-155917830 CAAATATTCCAACAGAAAAATGG + Intergenic
1019023394 6:168938033-168938055 AAAATATTTTCAGAGTAAGTGGG - Intergenic
1021093312 7:16508178-16508200 CATATATTTCTTCAGTATATTGG - Intronic
1021205600 7:17776092-17776114 CAAATATTTCCTATGTAAAACGG + Intergenic
1023066840 7:36386633-36386655 CAAATAATTGCACAGAAAAATGG + Intronic
1025706753 7:63873329-63873351 CAAATAAATACAAAGTAAATAGG - Intergenic
1026577994 7:71590608-71590630 CTACTATTTCCACAGAAAAAGGG + Intronic
1026664040 7:72326622-72326644 AAAATGTTTACACAGTAATTAGG + Intronic
1027977536 7:85178676-85178698 TAAATTTTTCCTCAGAAAATGGG - Intronic
1030556403 7:111030372-111030394 CATATGTTTTCACATTAAATGGG - Intronic
1030780002 7:113588711-113588733 TAAATATTTCCACAAATAATTGG - Intergenic
1031619309 7:123916801-123916823 TAAATATTTGGAGAGTAAATTGG - Intergenic
1031895184 7:127340114-127340136 CTAATATTTGCAGAGTAAAATGG + Intergenic
1032658619 7:133958407-133958429 CACATATTTCCACAGTATTTTGG + Intronic
1032956298 7:136975471-136975493 TAATTATTTTCACAGAAAATGGG + Intronic
1033112798 7:138597058-138597080 TCAATTTTTCCACAGTAACTGGG + Intronic
1033843246 7:145401136-145401158 CACACATTTCCATAGTGAATGGG - Intergenic
1034462781 7:151207312-151207334 CAAATTTTTCCAAATAAAATTGG + Intergenic
1035911904 8:3576515-3576537 TAATTATTTCCATAGTAAGTAGG - Intronic
1038832938 8:31083035-31083057 CAAATATTTAAACAGGAAGTAGG - Intronic
1039098790 8:33917691-33917713 CAAATTTTTCCAAGGTAAAATGG + Intergenic
1039848663 8:41343793-41343815 CAATTGTTTCCACAGTAATTGGG + Intergenic
1041904363 8:63015363-63015385 GAAATATTTCCAGTATAAATTGG + Exonic
1042212900 8:66399635-66399657 CAAACATTTGCTGAGTAAATGGG - Intergenic
1043023849 8:75041856-75041878 GAAATATTTTCACTGTATATAGG + Intergenic
1043161106 8:76849144-76849166 TAAAGATTTACACAGTAAAGGGG - Intronic
1044364032 8:91322451-91322473 CAAATATTTGACCAGTAAGTTGG + Intronic
1045157631 8:99494738-99494760 CTAATATTTTCAAAATAAATTGG - Intronic
1046026449 8:108729981-108730003 CGAATACTTCCAAAGTAACTAGG + Intronic
1047129034 8:121997672-121997694 CAAATATTTCCATAGTTGTTTGG + Intergenic
1047606443 8:126479364-126479386 CATATGTTTCCAGAGTAAAAGGG + Intergenic
1048009394 8:130443756-130443778 CAAACACTTCGACAGGAAATCGG + Intergenic
1051159122 9:14185828-14185850 CAAATATTTCTTCAGGAAGTTGG - Intronic
1051552191 9:18342288-18342310 AAAATATTTAGACAGTATATAGG + Intergenic
1051775363 9:20626380-20626402 CAAAAATTTCCATAAGAAATGGG - Intergenic
1052137420 9:24930738-24930760 CAAAAATTTCAACAGAAAAAGGG - Intergenic
1052583124 9:30387562-30387584 CAAATATTTCAGCAGGAAACTGG - Intergenic
1054547801 9:66359062-66359084 AAAATATTTCCATAGAAAAGTGG - Intergenic
1055034486 9:71803740-71803762 CAGCTATTTACACAGTAACTTGG - Intronic
1055126751 9:72727562-72727584 AAAATATTCCCACAGTAAAGGGG + Intronic
1056748092 9:89322617-89322639 CTAAAATTTTCACAGTATATTGG - Intronic
1058165679 9:101616106-101616128 CAAATATTCCCTGAGTAAATAGG - Intronic
1186316908 X:8380762-8380784 CAAATACTTCCAAAGCAATTGGG - Intergenic
1187206684 X:17188273-17188295 GAAATATTTCTACCGTAAATGGG - Intergenic
1188637188 X:32448955-32448977 CAAATATTTCAATATTAACTAGG + Intronic
1191184736 X:57597306-57597328 CAAATATTTCCAGAGCAAAGAGG - Exonic
1191227925 X:58065306-58065328 AAAACATTTCCACAGTGAAGGGG + Intergenic
1192457080 X:71285034-71285056 CACATATTTCCAAATTATATTGG + Intronic
1192957428 X:76087651-76087673 CCAATACTTCCAAAGTAAAATGG + Intergenic
1193408564 X:81135187-81135209 TAAATATTTTCACATTATATGGG - Intronic
1194511520 X:94801730-94801752 CAAATATTTTCTTAGTCAATGGG + Intergenic
1194519801 X:94904444-94904466 CATATATTTTAAAAGTAAATGGG - Intergenic
1195091298 X:101462225-101462247 CAAAGATTTTCACTGAAAATAGG - Intronic
1196166726 X:112543329-112543351 CAAATATATTCAGAGAAAATGGG + Intergenic
1198651646 X:138869642-138869664 CAAATTCCTCCACAGCAAATAGG - Intronic
1198941412 X:141960808-141960830 CAAATACTTCCTCACTCAATTGG - Intergenic
1199115410 X:143986134-143986156 AAAATATTTTCACATAAAATTGG - Intergenic
1200986840 Y:9309921-9309943 CAAATATATACATAATAAATAGG - Intergenic
1202118841 Y:21503893-21503915 CAAATATATACATAATAAATAGG + Intergenic
1202121293 Y:21527433-21527455 CAAATATATACATAATAAATAGG + Intronic
1202123745 Y:21550973-21550995 CAAATATATACATAATAAATAGG + Intergenic
1202155263 Y:21878407-21878429 CAAATATATACATAATAAATAGG - Intergenic
1202157710 Y:21901949-21901971 CAAATATATACATAATAAATAGG - Intronic
1202184158 Y:22166874-22166896 CAAATATATACATAATAAATAGG - Intergenic
1202207201 Y:22419527-22419549 CAAATATATACATAATAAATAGG + Intergenic
1202282958 Y:23209508-23209530 CAAATTTCTCAACAGAAAATGGG - Intergenic
1202434632 Y:24823893-24823915 CAAATTTCTCAACAGAAAATGGG - Intergenic