ID: 1163491633

View in Genome Browser
Species Human (GRCh38)
Location 19:17620316-17620338
Sequence GGCCATCTGGTCATTCCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163491627_1163491633 25 Left 1163491627 19:17620268-17620290 CCCATTTACTGTGGAAATATTTG 0: 1
1: 1
2: 1
3: 31
4: 325
Right 1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG 0: 1
1: 0
2: 0
3: 7
4: 74
1163491628_1163491633 24 Left 1163491628 19:17620269-17620291 CCATTTACTGTGGAAATATTTGG 0: 1
1: 1
2: 1
3: 22
4: 264
Right 1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG 0: 1
1: 0
2: 0
3: 7
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163491633 Original CRISPR GGCCATCTGGTCATTCCTAG AGG Intronic
901733524 1:11297505-11297527 GTCCATTTGGTGATTCCGAGGGG + Intergenic
917961045 1:180144924-180144946 GGCAATGTGCTCATTCCTATAGG - Intergenic
922692401 1:227705199-227705221 GGCCATGTGGTGATTCCTCAAGG + Intergenic
1067541638 10:47159306-47159328 GCCCATCTGGGCATTCCCTGTGG - Intergenic
1069367235 10:67706582-67706604 GGACATCTGGTCAGTGCTGGGGG + Intergenic
1070544651 10:77442796-77442818 GGCCACCTGGTCATTCCTCTTGG - Intronic
1073095643 10:100978125-100978147 GGCCATAAGGTCATTCTCAGGGG + Intronic
1073720411 10:106162981-106163003 TGACATCTGGGCCTTCCTAGAGG - Intergenic
1076420367 10:130327199-130327221 GGCCATCTGTTCATTCCAGGAGG + Intergenic
1081711062 11:45215723-45215745 GGTCACCTGGTCATGGCTAGAGG - Intronic
1084553850 11:69864457-69864479 GGCTCTCTGCCCATTCCTAGAGG - Intergenic
1086127695 11:83366115-83366137 AGACATTTGTTCATTCCTAGTGG - Intergenic
1088812344 11:113400183-113400205 GGGCATCATGTCCTTCCTAGAGG + Exonic
1089296002 11:117468677-117468699 GGGCAGCTGGTCCTTCCTGGGGG - Intronic
1100759081 12:97786360-97786382 GCCCATCTGGTCATTCTTATAGG + Intergenic
1106179976 13:27362166-27362188 GGCCAGCGGGTCATGCCTTGGGG - Intergenic
1106200141 13:27529072-27529094 GGTCTTCTGGGCACTCCTAGAGG - Intergenic
1108735698 13:53281509-53281531 TGCCATGTGGTCATATCTAGAGG + Intergenic
1111685882 13:91500374-91500396 GGCCATCTGATATTTCCTACTGG + Intronic
1115179115 14:30601694-30601716 GGCCCTGTGGACATTGCTAGTGG + Intronic
1118363776 14:65077115-65077137 GTCCAGCTTGTCATTCCAAGTGG - Intronic
1118726103 14:68630146-68630168 GGCAAACTCGGCATTCCTAGGGG - Intronic
1122582688 14:102781155-102781177 GGCCATCTGGTCCCTCTTACAGG + Intronic
1127049038 15:55060983-55061005 TGCCATCTGGTGATTATTAGGGG + Intergenic
1130674749 15:85941799-85941821 GCCAATCAGGCCATTCCTAGGGG + Intergenic
1132590518 16:724449-724471 GGCCCTCCGGACATTCCTGGAGG - Exonic
1135044059 16:19140256-19140278 GGCCCTCTGGTCATTTCGAAGGG - Intronic
1136498984 16:30660187-30660209 GGCAACCTGGTCACCCCTAGAGG + Intronic
1136573865 16:31111981-31112003 GGCCATCTGGACATGCATAGTGG + Exonic
1141678773 16:85531737-85531759 GGCCATCCGGTCCATCCTGGGGG - Intergenic
1145932254 17:28694244-28694266 TGTCATCTGGTCCTGCCTAGAGG - Intronic
1155141705 18:23050134-23050156 GCCCATCTGGCCAATCCTGGAGG + Intergenic
1155264433 18:24077160-24077182 GCCCATCTGCTCCTTCCTACTGG + Intronic
1157370706 18:47108989-47109011 GGCCCTCTGGTCATTCACAATGG + Intronic
1162495138 19:11019314-11019336 CGCCATCTGCACATTCCTGGTGG - Intronic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1164432014 19:28197114-28197136 GCACAGCTGGTCATTCCTTGAGG - Intergenic
1168642850 19:58041306-58041328 GGCCAGCAGGTCCCTCCTAGAGG + Intronic
936851981 2:116910932-116910954 GGTCATCTGGTCTTACCTACTGG + Intergenic
947874501 2:233459394-233459416 TGCCATCTGCTCTTTTCTAGGGG + Intronic
1174337251 20:49871742-49871764 GGCCATCTGGACAATCCCAGAGG - Intronic
1180197473 21:46206443-46206465 GGGCATCAGGTCAGACCTAGGGG - Intronic
1181243921 22:21492590-21492612 GGCCATGTGGTCAGGCCAAGCGG - Intergenic
1181445893 22:22973920-22973942 AGCCATCTGGTCACTTCCAGAGG + Intergenic
1185146702 22:49141123-49141145 GGGCCTCTGGTCAGCCCTAGGGG + Intergenic
949878324 3:8641627-8641649 GCCCATCTGGTCTTTCCCACAGG - Intronic
949918150 3:8981064-8981086 GGCCATGTGGCCAGTCCCAGAGG + Exonic
959577243 3:107947647-107947669 GGTCATATGGTCATTGCTGGGGG + Intergenic
961319181 3:126061170-126061192 GGCCAGATGGTCATTCTTACAGG + Intronic
961388114 3:126535954-126535976 GGTGATCTGGCCTTTCCTAGAGG + Intronic
961610929 3:128137939-128137961 AGCCATATGGTCATTTCAAGTGG + Intronic
964838823 3:160971381-160971403 GGTCATCTGAGCATTTCTAGTGG - Intronic
965523679 3:169694442-169694464 GGCCATCTAGTATTTCTTAGAGG + Intergenic
968556095 4:1247271-1247293 TGGCATCTGGTCACTCCTGGGGG - Intronic
973589009 4:52421254-52421276 GGCCATCTGGTCTTACCTCCAGG - Intergenic
975078118 4:70238809-70238831 GGCCATCTGGTGACTCCTATAGG - Intergenic
976624823 4:87168258-87168280 GGCCTTCAGGTCCTTCCTTGAGG + Intronic
984600264 4:181718754-181718776 GGCCCTCTGGACATTCCTGAAGG + Intergenic
986685111 5:10269710-10269732 GCCCATCTGGTTATTCCTTCAGG + Intergenic
989089872 5:37719147-37719169 GGCCATCTGGGAATTTCCAGTGG + Intronic
990519923 5:56569465-56569487 ATCCATCTGGTTATTGCTAGTGG + Intronic
1002700944 5:181124480-181124502 GGCCACCTTGTCATGGCTAGGGG + Exonic
1003816851 6:9851280-9851302 GCCTGTCTGGTCATTCCCAGAGG + Intronic
1005298903 6:24451941-24451963 GGCCAGCCAGTCATTCCGAGAGG + Intronic
1005392674 6:25349631-25349653 GGCCATGTGATCATCCCTGGTGG - Intronic
1019351437 7:555928-555950 GGGCATCTGGTCATGCATTGAGG - Intronic
1020619055 7:10496612-10496634 GGACATCTGTTCATTCCCATAGG + Intergenic
1022862282 7:34379969-34379991 GGCCATTTGAACATTTCTAGAGG - Intergenic
1034647899 7:152664761-152664783 GGCCACCTGGACATTCCTTGGGG - Intronic
1036683056 8:10890017-10890039 CGCCTCCTGCTCATTCCTAGCGG - Intergenic
1039895603 8:41714481-41714503 GGCCATCGGGTCTTTCCAAAAGG + Intronic
1048580121 8:135723747-135723769 GGTCATCTGATCTTTCCTAATGG + Intergenic
1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG + Exonic
1055594261 9:77849536-77849558 GGTCATCTGGTCATCCGTACTGG + Intronic
1057727353 9:97577333-97577355 TGCCTTCTGGTCATTCTCAGAGG + Intronic
1059043528 9:110840475-110840497 TGCCATTTGGTTATTCCTATAGG - Intergenic
1059967290 9:119627725-119627747 GGCCATGTGCACAGTCCTAGGGG - Intergenic
1061951719 9:133939997-133940019 GGCCATCTGCCCAGTCCTCGTGG + Intronic
1185842974 X:3410433-3410455 GGCCATCTGGGAATTCCAGGGGG - Intergenic
1189255770 X:39637802-39637824 GTCCATTTGTTCATTCCTGGGGG + Intergenic
1190177314 X:48161625-48161647 GGCCAGCTGGTCCTTCCTGTTGG - Intergenic
1201232216 Y:11876142-11876164 GGCCATCTGGGAATTCCAGGGGG + Intergenic