ID: 1163491633

View in Genome Browser
Species Human (GRCh38)
Location 19:17620316-17620338
Sequence GGCCATCTGGTCATTCCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163491628_1163491633 24 Left 1163491628 19:17620269-17620291 CCATTTACTGTGGAAATATTTGG No data
Right 1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG No data
1163491627_1163491633 25 Left 1163491627 19:17620268-17620290 CCCATTTACTGTGGAAATATTTG No data
Right 1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163491633 Original CRISPR GGCCATCTGGTCATTCCTAG AGG Intronic