ID: 1163491633 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:17620316-17620338 |
| Sequence | GGCCATCTGGTCATTCCTAG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1163491628_1163491633 | 24 | Left | 1163491628 | 19:17620269-17620291 | CCATTTACTGTGGAAATATTTGG | No data | ||
| Right | 1163491633 | 19:17620316-17620338 | GGCCATCTGGTCATTCCTAGAGG | No data | ||||
| 1163491627_1163491633 | 25 | Left | 1163491627 | 19:17620268-17620290 | CCCATTTACTGTGGAAATATTTG | No data | ||
| Right | 1163491633 | 19:17620316-17620338 | GGCCATCTGGTCATTCCTAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1163491633 | Original CRISPR | GGCCATCTGGTCATTCCTAG AGG | Intronic | ||