ID: 1163491633 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:17620316-17620338 |
Sequence | GGCCATCTGGTCATTCCTAG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1163491628_1163491633 | 24 | Left | 1163491628 | 19:17620269-17620291 | CCATTTACTGTGGAAATATTTGG | No data | ||
Right | 1163491633 | 19:17620316-17620338 | GGCCATCTGGTCATTCCTAGAGG | No data | ||||
1163491627_1163491633 | 25 | Left | 1163491627 | 19:17620268-17620290 | CCCATTTACTGTGGAAATATTTG | No data | ||
Right | 1163491633 | 19:17620316-17620338 | GGCCATCTGGTCATTCCTAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1163491633 | Original CRISPR | GGCCATCTGGTCATTCCTAG AGG | Intronic | ||