ID: 1163492274

View in Genome Browser
Species Human (GRCh38)
Location 19:17623783-17623805
Sequence CTGTGGGCACATTAGGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 304}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163492274_1163492286 22 Left 1163492274 19:17623783-17623805 CCCACTCCCTAATGTGCCCACAG 0: 1
1: 0
2: 0
3: 17
4: 304
Right 1163492286 19:17623828-17623850 AGGTTCTTGATGCCTCCCGGAGG 0: 1
1: 0
2: 0
3: 7
4: 71
1163492274_1163492282 2 Left 1163492274 19:17623783-17623805 CCCACTCCCTAATGTGCCCACAG 0: 1
1: 0
2: 0
3: 17
4: 304
Right 1163492282 19:17623808-17623830 CACATGCCATTGCTGTCCTCAGG 0: 1
1: 0
2: 1
3: 23
4: 207
1163492274_1163492287 23 Left 1163492274 19:17623783-17623805 CCCACTCCCTAATGTGCCCACAG 0: 1
1: 0
2: 0
3: 17
4: 304
Right 1163492287 19:17623829-17623851 GGTTCTTGATGCCTCCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 54
1163492274_1163492285 19 Left 1163492274 19:17623783-17623805 CCCACTCCCTAATGTGCCCACAG 0: 1
1: 0
2: 0
3: 17
4: 304
Right 1163492285 19:17623825-17623847 CTCAGGTTCTTGATGCCTCCCGG 0: 1
1: 0
2: 1
3: 21
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163492274 Original CRISPR CTGTGGGCACATTAGGGAGT GGG (reversed) Intronic
900394351 1:2447045-2447067 CTGGGAGCACATGAGGGGGTGGG - Intronic
901232374 1:7648458-7648480 GTGTGGGCACAGTAAGGAGTGGG + Intronic
902037713 1:13469705-13469727 CTGTAGGGACATTGGGGAGGAGG + Intergenic
902832735 1:19028301-19028323 CTGTGGGCACACTGAGGAGGGGG + Intergenic
903178721 1:21595015-21595037 CTTTGGGGACATTTGGGAGTAGG - Intergenic
904207701 1:28865488-28865510 CTTTGGGCACATTAGGGGGAAGG + Intergenic
905405618 1:37730482-37730504 CTGTGCACACATCAGGGAATTGG + Intronic
905509207 1:38505260-38505282 ATGTGGATACATTTGGGAGTCGG + Intergenic
906937541 1:50227142-50227164 CTGTCAGCAGATTAGAGAGTGGG + Intergenic
907021056 1:51067119-51067141 CTGTGTGCACCCTAGGGACTTGG - Intergenic
908729177 1:67208462-67208484 CTGTGTGCAGCTTAGGGACTTGG + Intronic
909808837 1:79905916-79905938 CTGTGGGCAGCCTAGGGACTTGG - Intergenic
910715514 1:90225450-90225472 CTGTGTGCAGCTTAGGGACTTGG + Intergenic
910774559 1:90862070-90862092 CTGTGTGCAGCTTAGGGACTTGG - Intergenic
911855741 1:102872607-102872629 CTGTGTGCAGCTTAGGGACTTGG - Intergenic
913531597 1:119737705-119737727 CAGAGGGCTCATTTGGGAGTAGG - Intronic
914941700 1:152028879-152028901 ATGTGCCCACATTAGGGAGATGG + Intergenic
915313305 1:155015314-155015336 CTGTGGGCACCTCAGGGACTAGG - Exonic
916571666 1:166033395-166033417 CTCTGGGCCCATCAGTGAGTTGG - Intergenic
916575978 1:166066836-166066858 ATGGGGGCACATGAGAGAGTTGG - Intronic
917598741 1:176554932-176554954 GTGTGGGCTTATTAGGCAGTAGG + Intronic
919554325 1:199031808-199031830 CTGTGTGCAGTTTAGGGACTTGG - Intergenic
919700713 1:200628477-200628499 TTGTGAGCACAGTCGGGAGTGGG - Intronic
921130759 1:212217588-212217610 CTATTGTCACATTAGGGGGTAGG + Intergenic
921773534 1:219071433-219071455 CTGTGTGCACCCTAGGGACTTGG + Intergenic
921991798 1:221374779-221374801 CTGTTGGCACAGAAGGAAGTGGG - Intergenic
923922556 1:238584068-238584090 CTACTGGAACATTAGGGAGTGGG + Intergenic
924352271 1:243127419-243127441 CATTGGGCAGAGTAGGGAGTTGG + Intronic
1063129032 10:3161658-3161680 CTGTGCGTGCATTAGGGAGGTGG + Intronic
1065248543 10:23785457-23785479 CTTTGGGCACTTTATGGAGAAGG + Intronic
1067245607 10:44539691-44539713 CTGTGGGCAACTAAGGGAGGAGG - Intergenic
1067402363 10:45988422-45988444 CTGTGGGGAGAAAAGGGAGTAGG + Intronic
1067792449 10:49298480-49298502 CTGTGGGCAGTTTGGGGAGCAGG + Intergenic
1067911422 10:50350579-50350601 CTGTGTGCAGACTAGGGACTTGG + Intronic
1068519499 10:58062998-58063020 CTGTGTGCACCCTAGGGACTCGG - Intergenic
1068856773 10:61805901-61805923 CTGTTGGCAGATTAGGTACTCGG - Intergenic
1069495695 10:68901402-68901424 CTGGGGGGACATTATGGAGCTGG + Exonic
1069961450 10:72081549-72081571 CTGTGGGCATAATATGGTGTGGG + Intronic
1073153410 10:101327686-101327708 CTGTGTGCAGACTAGGGATTTGG + Intergenic
1073512137 10:104049297-104049319 GAGTGGGCAGATTAGAGAGTAGG + Intronic
1073817590 10:107224502-107224524 CTGTGTGCACTCTAGGGATTTGG - Intergenic
1074525473 10:114259828-114259850 CAGTGGACACATTGGGGAGACGG - Intronic
1075038280 10:119087412-119087434 CTGTGGCCACATTAGGCTGCAGG - Intergenic
1075504627 10:123011015-123011037 CTGAGGCCACTTTAGGGAATTGG + Intronic
1075644884 10:124091021-124091043 CTGTGGGCACATAGGTGAGCTGG - Intronic
1077103539 11:832532-832554 CTGTGGGCAAATGCGGGAGAAGG - Intergenic
1077630944 11:3810644-3810666 CTGGGGGCACGTGAGGGAGCAGG + Intronic
1078712975 11:13813091-13813113 CTGTGTGCAGCTTAGGGATTTGG - Intergenic
1080151429 11:29056714-29056736 CTGTGTGCAGAATAGGGACTTGG + Intergenic
1080418948 11:32093456-32093478 CTGTGAGCACATTCAGGAGAAGG + Intronic
1080477479 11:32608953-32608975 CTGTGTGCAGCTTAGGGATTTGG - Intronic
1080785302 11:35469927-35469949 CTGTGATCATATTAGGAAGTAGG - Intronic
1082268262 11:50142811-50142833 CTGTGTGCAGCCTAGGGAGTTGG + Intergenic
1082287812 11:50335704-50335726 CTGTGTGCAGCCTAGGGAGTTGG - Intergenic
1083100590 11:60301679-60301701 CGGAGGGGACACTAGGGAGTTGG - Intronic
1084942390 11:72619970-72619992 CTGTGTGCACATTAGAAAGGAGG + Intronic
1090031682 11:123211730-123211752 CTCTTGGCACTTTAGGGACTGGG - Intergenic
1091124226 11:133081996-133082018 CTCTGGGCACACTCGGGAGCAGG - Intronic
1091769958 12:3145103-3145125 CTGTGTGCTCACAAGGGAGTGGG - Intronic
1093799126 12:23350686-23350708 CTGTGGGAACATTCAGGACTGGG - Intergenic
1093930345 12:24949447-24949469 CTTTGGGGACAGTAGGGAGGTGG - Intronic
1093973914 12:25400640-25400662 CTGTGTGCAGTCTAGGGAGTTGG + Intergenic
1094762555 12:33551245-33551267 CTGTGTGCACTCTAGGGACTTGG + Intergenic
1094781303 12:33795195-33795217 CTGCTGGCACATTTGGGGGTGGG - Intergenic
1095131612 12:38549198-38549220 CTGTGTGCAGTCTAGGGAGTTGG - Intergenic
1096052576 12:48624099-48624121 CTGTGAGCACCCTAGGGTGTAGG + Intergenic
1097318522 12:58199849-58199871 CATTGGGCACCTTAGAGAGTAGG + Intergenic
1101951288 12:109177922-109177944 CTGTGTGCACATGAGGGCCTGGG - Intronic
1102248910 12:111372482-111372504 CTGTGTGCATCCTAGGGAGTTGG - Intergenic
1104191691 12:126487652-126487674 CTGAGGGCTCATGAGGGATTAGG + Intergenic
1104803885 12:131572586-131572608 CTATGGGCAGCTTTGGGAGTTGG + Intergenic
1104889777 12:132134680-132134702 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104889788 12:132134715-132134737 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104889812 12:132134785-132134807 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104889835 12:132134856-132134878 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104889870 12:132134962-132134984 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104889903 12:132135069-132135091 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104889914 12:132135104-132135126 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104889925 12:132135139-132135161 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104889948 12:132135208-132135230 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104889971 12:132135279-132135301 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104889994 12:132135348-132135370 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104890017 12:132135421-132135443 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104890028 12:132135457-132135479 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104890063 12:132135562-132135584 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104890074 12:132135597-132135619 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104890157 12:132135842-132135864 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104890192 12:132135945-132135967 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104890287 12:132136228-132136250 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104890310 12:132136300-132136322 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1104890321 12:132136335-132136357 CCGTGGGCACACTCGGGAGGTGG - Intergenic
1106430573 13:29676665-29676687 ATGTGGACACATTATGGTGTTGG - Intergenic
1107234645 13:38153638-38153660 CTGTGTGCAGTTTAGGGACTTGG - Intergenic
1107717229 13:43212353-43212375 CTCTGAGCACATTAAGGAGAGGG + Intergenic
1109721055 13:66277147-66277169 CTGTGTGCAGCTTAGGGATTTGG + Intergenic
1110543108 13:76727864-76727886 CTGTGTGCAGCTTAGGGACTTGG + Intergenic
1113737008 13:112686241-112686263 CTGGGGGGAAATAAGGGAGTGGG - Intergenic
1113892953 13:113746031-113746053 CTTTGGGCAAATTGGGGTGTGGG - Intergenic
1113940301 13:114015357-114015379 CTGTGGGCAGCCTCGGGAGTGGG - Intronic
1116281577 14:42914985-42915007 CTGTGTGCAGATTGGGGACTTGG - Intergenic
1116559518 14:46360114-46360136 CTGTGTGCAGTTTAGGGATTTGG - Intergenic
1119320605 14:73727923-73727945 CTTTGAGCACACTAGGGAGGTGG + Intronic
1121652425 14:95568940-95568962 GTGTGGTCACAGTGGGGAGTGGG + Intergenic
1124026248 15:25968888-25968910 CTCTGGGTACATTTGTGAGTGGG - Intergenic
1125825311 15:42671543-42671565 AGGTGGGCACATAAGGGAGAGGG + Intronic
1127371338 15:58344715-58344737 GTGAGGGCACCTAAGGGAGTGGG + Intronic
1128239810 15:66094256-66094278 CTGTGTGAACATCAGGGAGGAGG - Intronic
1128718646 15:69929063-69929085 CTGTGTGCAGTTTAGGGACTTGG - Intergenic
1129760754 15:78128125-78128147 CTGTGGCCACACAAGGGACTGGG + Intronic
1130020810 15:80229773-80229795 CTTTGGGCAGACTAGGGAGAAGG + Intergenic
1131340500 15:91596262-91596284 CTGGTGGCTCATTAGTGAGTAGG - Intergenic
1131842850 15:96456135-96456157 CTGTTGGCAGATTAAGGAGATGG - Intergenic
1133091214 16:3405215-3405237 CAGTGAGCACGTTAGGGAGGAGG + Intronic
1133907993 16:10039128-10039150 CAGTGGGGACATTGGGGGGTGGG - Intronic
1135135303 16:19882809-19882831 CTGTAGGCAGATTTGGGGGTGGG - Intronic
1135995241 16:27243048-27243070 CTGTGGGCACAGCAGGGAGCTGG + Intronic
1136170968 16:28489230-28489252 CTGTGGGAAGATGAGGGGGTGGG - Intronic
1136662875 16:31780576-31780598 CTGTGGGGAATCTAGGGAGTTGG + Intronic
1137266307 16:46871699-46871721 CTGTGTGCAGACTAGGGACTTGG - Intergenic
1137690402 16:50422899-50422921 CAGAGGGCAAATTAGGGAGAGGG + Intergenic
1138761187 16:59546530-59546552 CTGTGGCATCATTAGGTAGTTGG - Intergenic
1139000489 16:62504556-62504578 CTGTCGGCAAATCAGGAAGTGGG + Intergenic
1139113432 16:63919891-63919913 CTGTGTGCAGCCTAGGGAGTTGG - Intergenic
1140869943 16:79096935-79096957 CTGTGGGCATATTGGGGAGGGGG + Intronic
1141248547 16:82333548-82333570 CCGTGAGCACATTGGGAAGTTGG + Intergenic
1141477143 16:84281599-84281621 CTTTAGGCACGTTAGGGAATTGG - Intergenic
1141634727 16:85308077-85308099 CTGTGGGCAAAGGAGGGACTTGG + Intergenic
1142218929 16:88843477-88843499 GTGTGGCCACATTTGGAAGTAGG + Intronic
1142489690 17:270195-270217 CTGTGAGTGCATTCGGGAGTGGG - Intronic
1143047159 17:4090974-4090996 CTGTGAGCACATGAGACAGTTGG + Intronic
1143164744 17:4892269-4892291 CTGAGGGCAGCCTAGGGAGTAGG + Intronic
1143627408 17:8118420-8118442 CTTGGGGGACATTGGGGAGTGGG - Intronic
1149902342 17:60492019-60492041 CTGTGTGCAGACTAGGGACTTGG + Intronic
1150642545 17:66959240-66959262 CTCTGTGCCCTTTAGGGAGTGGG + Intergenic
1152271353 17:79326735-79326757 CTGAGGCCACATTAGAGGGTGGG - Intronic
1152432898 17:80259760-80259782 CCGTGGGCACCGTGGGGAGTGGG + Intergenic
1153011970 18:547503-547525 CTGTGTGCACCCTAGGGACTTGG - Intergenic
1153310865 18:3675689-3675711 TAGAGGGCACATTATGGAGTGGG - Intronic
1156081395 18:33340606-33340628 CTGTGTGCAGCCTAGGGAGTTGG + Intronic
1160209289 18:76862623-76862645 CAGTGGGTCCACTAGGGAGTTGG + Intronic
1162665447 19:12206692-12206714 CTGTCTGCACACTAGGTAGTAGG + Intergenic
1162731100 19:12719452-12719474 TTGTGGGCTTATTAGGGAGCGGG - Intronic
1163492274 19:17623783-17623805 CTGTGGGCACATTAGGGAGTGGG - Intronic
1163991360 19:21001999-21002021 CTTTGAGCACTTTAGTGAGTAGG + Intergenic
1164629801 19:29754768-29754790 CTGTGAGCACAGTGGGGAGAGGG - Intergenic
1165324740 19:35107927-35107949 CTGTGGCCAAATTAAGGAGGTGG + Intergenic
1165394133 19:35555113-35555135 GTGTGGGCACAGGAGGGAGAGGG - Intronic
1165826657 19:38709555-38709577 CTGTGGGCACATCAGAGCTTTGG + Intronic
1165948425 19:39458923-39458945 CTGTGGGGAGATTTGGGAGTAGG + Intronic
1166003762 19:39893528-39893550 CTGTGGGCAGATGAAGGAGCAGG + Intronic
1166052956 19:40271543-40271565 CTGGTGGCAGATGAGGGAGTTGG - Intronic
1166230660 19:41424415-41424437 CTGTGGGGACATGGGGCAGTGGG - Intronic
1166749459 19:45158116-45158138 CTAGGGGCACAGTGGGGAGTGGG - Intronic
1168253409 19:55154207-55154229 CTGGGGGCACACGAGGGGGTGGG + Intronic
926870202 2:17407821-17407843 CTGTGTGCACCCTAGGGACTTGG + Intergenic
927786758 2:25980226-25980248 CTGGGGGCACATTTGGCAGGAGG + Intronic
929679511 2:43976402-43976424 CTGTTGATACATTAGAGAGTGGG - Intronic
932976205 2:76602565-76602587 CTGTGTGCAGCTTAGGGACTTGG - Intergenic
935203975 2:100881921-100881943 CTGCGAGCACATGAGGGAGGTGG - Intronic
935614623 2:105064380-105064402 CAGTGGGTACTTCAGGGAGTGGG + Intronic
935948931 2:108311696-108311718 CTGTGTGCACCCTAGGGACTTGG + Intergenic
936969612 2:118164620-118164642 CTGTGTGCAGCTTAGGGACTTGG + Intergenic
936984638 2:118297257-118297279 CTGTGTGCAGTTTAGGGACTTGG - Intergenic
937031554 2:118744939-118744961 CTGTGTGCAACTTAGGGATTTGG - Intergenic
937899754 2:127010908-127010930 CAGTGGGCAAGTGAGGGAGTTGG + Intergenic
938392138 2:130914927-130914949 CTGTGGGCACATGAGGGCACTGG + Intronic
938416201 2:131105534-131105556 CTCAGGGAAAATTAGGGAGTGGG - Intronic
941548650 2:166886562-166886584 CTGTTGGCACATTTGGGGTTTGG - Intergenic
942062508 2:172240703-172240725 CTGTGGGCCCAGGAGGGAGCAGG + Intergenic
942458262 2:176152243-176152265 CTGTGGGCGCAAAAGGGGGTGGG + Intronic
943042855 2:182823898-182823920 ATGTAGCCATATTAGGGAGTTGG - Intergenic
943491337 2:188559203-188559225 CTGTGTGTACCCTAGGGAGTTGG + Intronic
945829603 2:214767120-214767142 TTGTGGGCACATGATGGAGCTGG - Intronic
946204012 2:218090196-218090218 CTGTGGGCAGAGTAGGGTGTGGG + Exonic
946575586 2:221071929-221071951 CTGTGTGCACCTTTGGGACTTGG - Intergenic
948379563 2:237542884-237542906 GAGTGGGCACAGTAGTGAGTGGG + Intronic
948379622 2:237543124-237543146 GAGTGGGCACAGTAGTGAGTAGG + Intronic
948379649 2:237543228-237543250 GAGTGGGCACAGTAGTGAGTAGG + Intronic
948379935 2:237544278-237544300 GAGTGGGCACAGTAGTGAGTGGG + Intronic
948380108 2:237544920-237544942 GAGTGGGCACAGTAGTGAGTGGG + Intronic
1169116067 20:3066822-3066844 CTGTGGGGAAACTAGGGAGGAGG - Intergenic
1169320833 20:4632003-4632025 CTGTGTGCAAAATAGGGACTTGG + Intergenic
1169803175 20:9532384-9532406 CTGTGGGCACAAGAGGATGTTGG + Intergenic
1170313542 20:15017854-15017876 CTGTGTGCACCCTAGGGACTTGG - Intronic
1172101472 20:32486242-32486264 CTGTGGCCACTTTAAGGAGTGGG - Intronic
1172126337 20:32627213-32627235 CTGTGGGCAGGTCGGGGAGTGGG - Intergenic
1172380179 20:34483072-34483094 CTGTGTGCACTCTAGGGACTTGG - Intronic
1174262519 20:49306951-49306973 CTCCTGGCACATCAGGGAGTTGG - Intergenic
1174403395 20:50288462-50288484 CTCTGGGCACAGGAGGGAGATGG + Intergenic
1175008462 20:55710687-55710709 CTGTGTGCAGCCTAGGGAGTTGG + Intergenic
1175195404 20:57239869-57239891 CTGTGTGCACCCTAGGGACTTGG - Intronic
1175529776 20:59666463-59666485 CTGTGGGCACATTGAGCTGTGGG + Intronic
1175540211 20:59743508-59743530 TTGTGGGCACCTTAGGGTCTGGG - Intronic
1175858176 20:62133866-62133888 TTGTGGGCACCTTAGGGTTTGGG + Intronic
1177471324 21:21563999-21564021 CTGTGTGCACACTAGGGACTTGG + Intergenic
1179316451 21:40248086-40248108 CTGTGTGCAGCCTAGGGAGTTGG - Intronic
1179874911 21:44262545-44262567 CTGTTGGGGGATTAGGGAGTGGG + Intergenic
1182093619 22:27612207-27612229 CTGTGGGCACTGGAGGGAGTTGG + Intergenic
1182233066 22:28853724-28853746 GTGTGCGATCATTAGGGAGTGGG - Intergenic
1183965172 22:41437156-41437178 CTGTGTTCACATTGGGGAGATGG - Exonic
1184311903 22:43651231-43651253 CTGTGTGCAGACTAGGGACTTGG + Intronic
1184970928 22:48019374-48019396 CTGTGAGCACATTCAGCAGTTGG + Intergenic
949992903 3:9593662-9593684 ATGTAGGCAATTTAGGGAGTAGG + Intergenic
950635599 3:14312187-14312209 GTGGGGGCACACAAGGGAGTAGG + Intergenic
952029083 3:29119745-29119767 CTGTGTGCACCCTAGGGATTTGG + Intergenic
952543266 3:34390810-34390832 CTGTGTGGAGATTTGGGAGTGGG - Intergenic
953274153 3:41478438-41478460 CTGTGGGCTCAGAAGGGAGCTGG - Intronic
953383820 3:42493463-42493485 CTGTGGGCACAGTTGGGCCTAGG + Intronic
953472732 3:43180749-43180771 CTGTGTGCCCTTTAGGGCGTAGG + Intergenic
954591539 3:51787763-51787785 CTGTGTGCACCCTAGGGACTTGG + Intergenic
955277162 3:57557150-57557172 CTTTGGGCACAGCCGGGAGTTGG + Exonic
955615261 3:60800669-60800691 CTATGGGGAAATGAGGGAGTAGG + Intronic
955798299 3:62660694-62660716 CTGTGGGCATATGAGGGTGGGGG - Intronic
956311388 3:67884494-67884516 CTGTGGGCATGTTAGTTAGTAGG + Intergenic
957152024 3:76498291-76498313 CTGGGGGCGCAGTAGGGTGTGGG + Intronic
958060567 3:88474416-88474438 CTGTGTGCAGCCTAGGGAGTTGG - Intergenic
958860224 3:99437014-99437036 CTGTGTGCAGTTTAGGGACTTGG + Intergenic
961821747 3:129578812-129578834 CTGGGGGCATCTCAGGGAGTGGG - Intronic
963422115 3:145073510-145073532 CTGTGTGCAGCCTAGGGAGTTGG - Intergenic
963771464 3:149390659-149390681 CTGTGGGAACTTTAGGGACTTGG + Intergenic
963936628 3:151060492-151060514 CTGCAGCCACGTTAGGGAGTGGG - Intergenic
968295109 3:197570519-197570541 CTGTGTGCATCTTAGGGACTTGG + Intronic
968403012 4:315042-315064 CTGTGTGCAGTTTAGGGACTTGG - Intergenic
972190630 4:36587032-36587054 CTGTGTGCAGCTTAGGGACTTGG + Intergenic
972411291 4:38797709-38797731 TTGTGGGCACCTTACTGAGTTGG - Exonic
974322484 4:60369278-60369300 CTGTGTGCAGCTTAGGGAATTGG + Intergenic
975494249 4:75020514-75020536 CTGTGTGGACAACAGGGAGTAGG - Intronic
976003585 4:80401386-80401408 CTGTGTGCACACTAGGGACTTGG + Intronic
976635648 4:87284391-87284413 CTGTGTGCAGTTTAGGGACTTGG + Intergenic
976802492 4:89008238-89008260 CTGTGGGCACATTGGGGGCTAGG - Intronic
978153392 4:105463668-105463690 CTGTGTGCAGCCTAGGGAGTTGG + Intronic
978226214 4:106338392-106338414 CTGTGTGCAGCTTAGGGACTTGG + Intronic
978241176 4:106518232-106518254 CTGTGGATCCATTAGGTAGTGGG + Intergenic
978939043 4:114415382-114415404 CTGTGGGCACTCTAGGGACTTGG + Intergenic
979249673 4:118553106-118553128 CATTGGGCAGAGTAGGGAGTTGG - Intergenic
979390144 4:120118148-120118170 CTGTGTGCAGACTAGGGACTTGG - Intergenic
980484869 4:133443293-133443315 CTGTGGAGAAATTAGGGACTAGG + Intergenic
982019626 4:151190494-151190516 CTGTGTGCACTCTAGGGACTTGG + Intronic
985394280 4:189525524-189525546 CTGTGTGCACCCTAGGGACTTGG + Intergenic
985699362 5:1361238-1361260 CAGTGGGCTCATTGGGGGGTGGG + Intergenic
985992484 5:3574967-3574989 CTGGGGGCACCCTAGGGAGAGGG - Intergenic
986632277 5:9785137-9785159 CTGTGGGGAGATGAGAGAGTGGG - Intergenic
987773561 5:22336504-22336526 CTGTGTGCAATTTAGGGACTTGG + Intronic
988007830 5:25441360-25441382 CTTTGGTCTCATTAGGGACTGGG + Intergenic
988649393 5:33131696-33131718 CTGTGTGCAGACTAGGGACTTGG + Intergenic
988886384 5:35563066-35563088 CTGTGTGCACTGTAGGGACTTGG + Intergenic
988942927 5:36164095-36164117 CAGTGAGCACAATAGGGAGAGGG + Intronic
989623835 5:43410678-43410700 CTGTGGGGACAGGTGGGAGTAGG + Intronic
990373243 5:55142456-55142478 CTGTGGGCTCATGATGGTGTTGG - Intronic
991119455 5:62994341-62994363 CTGTGGGCAGTCTAGGGACTTGG - Intergenic
993724003 5:91348000-91348022 CTGTGTGCAGCTTAGGGACTTGG - Intergenic
996030951 5:118703383-118703405 TTGTGGGCAACCTAGGGAGTTGG - Intergenic
996179946 5:120406996-120407018 CTGTGTGCAGCTTAGGGACTTGG + Intergenic
996412008 5:123168867-123168889 GTGTGGGCACAGAAAGGAGTAGG - Intronic
999919748 5:156305283-156305305 CTGTGTGCAGCTTAGGGACTTGG + Intronic
1000876832 5:166649916-166649938 CTGTAAGCACTTTAGGGAATTGG + Intergenic
1001892088 5:175348127-175348149 CTGTGAGCATATTAGAGAGACGG + Intergenic
1004031073 6:11870110-11870132 CTGTGTTCACATTGGGGATTAGG - Intergenic
1004550969 6:16646757-16646779 CTGTGGGAACACAAAGGAGTGGG - Intronic
1005905021 6:30254983-30255005 CTGTGTGCAGCTTAGGGACTTGG - Intergenic
1008268728 6:49463781-49463803 ATGTGGGCACAAGAGTGAGTAGG - Intronic
1008951361 6:57163334-57163356 CTGTAAGCTCCTTAGGGAGTAGG + Intronic
1009480964 6:64157579-64157601 CTGTGGGCATCCTAGGGACTTGG + Intronic
1010167151 6:72929354-72929376 CTGTGGGAGGTTTAGGGAGTGGG - Intronic
1010835807 6:80586466-80586488 CTGTGTGCAGCTTAGGGACTTGG + Intergenic
1011950635 6:92959623-92959645 CTGTGTGCACCCTAGGGACTTGG - Intergenic
1012472779 6:99589681-99589703 CTGTGGGCAAATTCAGGGGTGGG + Intergenic
1013918137 6:115366637-115366659 CTGTGTGCAGCTTAGGGACTTGG + Intergenic
1013927894 6:115494667-115494689 CTGTGTGCAGACTAGGGACTTGG - Intergenic
1014273897 6:119365340-119365362 ATGAGGACACAATAGGGAGTTGG - Intergenic
1014576687 6:123082353-123082375 CTGTGTGCAAACTAGGGATTTGG - Intergenic
1015347952 6:132181228-132181250 CTTTGGGAAAATTAGGCAGTTGG + Intergenic
1016564872 6:145441286-145441308 CTGTGTGCAGTTTAGGGACTTGG - Intergenic
1016712067 6:147185380-147185402 CTGTGGGGACATTGATGAGTAGG + Intergenic
1017421264 6:154275295-154275317 CTGTGTCCTCATTAGGGAGCTGG - Intronic
1019014972 6:168873575-168873597 CCGTGGGCACAATCAGGAGTTGG - Intergenic
1019925241 7:4187179-4187201 CAGGGGGCACCTGAGGGAGTGGG + Intronic
1020727248 7:11831696-11831718 CTGGGGCCACATTAAGGAGCTGG - Intronic
1021960786 7:25871137-25871159 CTGTGGGGACATGAGGGCCTGGG + Intergenic
1023387201 7:39670928-39670950 CTGTGGGACCAGTTGGGAGTAGG - Intronic
1024000431 7:45185752-45185774 GTGTGGGCAGATTGAGGAGTTGG + Intronic
1026809479 7:73450801-73450823 ATGTGGGTATATTAGGGAGTAGG - Intronic
1027624730 7:80531922-80531944 CTGTGGGCAGCCTAGGGACTTGG + Intronic
1031565620 7:123293885-123293907 CTAGGAGCACATTAGGGAGCAGG - Intergenic
1032919405 7:136528184-136528206 CTATGGGTATATTAGAGAGTGGG - Intergenic
1034859073 7:154580966-154580988 CTGAGGTCACATTAGGAAGGTGG - Intronic
1037354080 8:17998779-17998801 CTGTGGACCCATTAGGGACCTGG - Intronic
1037935923 8:22915065-22915087 CTGTGGGGATATTGGGGAGAGGG - Intronic
1038110879 8:24496072-24496094 CTGTGTGCAGTTTAGGGACTTGG + Intronic
1038852879 8:31297233-31297255 CTGTGAGAAAATTAAGGAGTTGG + Intergenic
1039642760 8:39241668-39241690 CTGTGTGCAGTTTAGGGACTTGG - Intronic
1040388162 8:46927938-46927960 CTGTAGCCACATGAGGGAGTGGG - Intergenic
1040397225 8:47011390-47011412 CTGTGTGCAGCCTAGGGAGTTGG - Intergenic
1042409709 8:68449782-68449804 CTGTGGACAGATCAGGGTGTTGG + Intronic
1042432830 8:68727806-68727828 CTGTGTGCAGCTTAGGGACTTGG - Intronic
1042533366 8:69835707-69835729 CTGCGGGCACAGAAGTGAGTTGG + Intergenic
1043510484 8:80945929-80945951 CTGTGTGCAGCTTAGGGATTTGG + Intergenic
1044282642 8:90374798-90374820 CTGTGTGCAGACTAGGGACTTGG - Intergenic
1046606076 8:116373605-116373627 CTGTGTGCAGCTTAGGGACTTGG - Intergenic
1046814750 8:118571580-118571602 CTGTGTGCAGCTTAGGGACTTGG + Intronic
1048829128 8:138459050-138459072 CTGTGGGCTGATTTGGGGGTGGG - Intronic
1050086534 9:1972094-1972116 CTGTGTGCAGTTTAGGGACTTGG + Intergenic
1051013514 9:12447858-12447880 CTGTGTGCAGCTTAGGGACTTGG + Intergenic
1051573133 9:18583223-18583245 CTGTGTGCACCCTAGGGACTTGG + Intronic
1052834515 9:33240574-33240596 CTGTGGGGACAGAAGGGAGCAGG + Intronic
1053117415 9:35517723-35517745 CAGTGGCCACATTAGGAAATAGG - Intronic
1056640810 9:88368851-88368873 CCGTGTGCACATTAGGAAGATGG + Intergenic
1057732467 9:97622183-97622205 CTGTGGGCAGTCTAGGGACTTGG + Intronic
1058204617 9:102087730-102087752 ATGTGGGTACAGGAGGGAGTGGG + Intergenic
1059057446 9:110999154-110999176 GTGTGGACATATTGGGGAGTTGG - Intronic
1186414363 X:9370415-9370437 CAGTGGGGACATGAGGGAGAAGG + Intergenic
1187397098 X:18928189-18928211 CTGTGGGTCCTTGAGGGAGTGGG + Intronic
1193221251 X:78929234-78929256 CTGTGTGCAGACTAGGGACTTGG - Intergenic
1194256894 X:91646029-91646051 CTGTGTGCAGCTTAGGGACTTGG + Intergenic
1194578497 X:95642110-95642132 CTGTGTGCAGCTTAGGGACTTGG - Intergenic
1194850204 X:98859867-98859889 CTGTGTGCAGTCTAGGGAGTTGG + Intergenic
1198919383 X:141708492-141708514 CTGTGTGCAGTTTAGGGACTTGG - Intergenic
1199569406 X:149252530-149252552 CTGTGTGCAGCTTAGGGACTTGG - Intergenic
1199679934 X:150217289-150217311 TGGTGGGCACATTAGTGAGGCGG + Intergenic
1200296412 X:154924903-154924925 CTGTGTGCAGCCTAGGGAGTCGG - Intronic
1200575613 Y:4885296-4885318 CTGTGTGCAGCTTAGGGACTTGG + Intergenic
1201634261 Y:16104818-16104840 CTGTGGGCCCATTCGTGGGTGGG - Intergenic