ID: 1163493127

View in Genome Browser
Species Human (GRCh38)
Location 19:17628683-17628705
Sequence CGGTTAACACAGATGAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163493127 Original CRISPR CGGTTAACACAGATGAAACA TGG Intronic
906420770 1:45664986-45665008 CTGTTAAAAAAGATGAAAGATGG + Intronic
910465621 1:87496200-87496222 CTGTTAACACAGAAGAGACCAGG + Intergenic
910603756 1:89060071-89060093 GGGTTAACACAGATGCATAAAGG - Intronic
910637071 1:89420422-89420444 GGGTTAACACAGATGCATAAAGG + Intergenic
914360433 1:146931282-146931304 CTGTTAACACAGAAGAGACCAGG + Intergenic
914493314 1:148168616-148168638 CTGTTAACACAGAAGAGACCAGG - Intergenic
915904323 1:159866684-159866706 CCGTGAACACAGGTGACACAGGG + Intronic
917053166 1:170948215-170948237 AAATTAACACAGAAGAAACAGGG + Intronic
922386406 1:225088397-225088419 AAATTAACACAGATTAAACAGGG + Intronic
924932716 1:248745047-248745069 GGGTTAACACAGAAGGACCAGGG - Intronic
1068204761 10:53835986-53836008 CCTTTATCTCAGATGAAACAAGG + Intronic
1069231497 10:66014633-66014655 CGGTTATCACAGTGGAAACATGG - Intronic
1070012238 10:72487435-72487457 CTGTAACCACAGATGAAACATGG + Intronic
1076302846 10:129440961-129440983 GGGTTTACACAGATGCAAAATGG - Intergenic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1079346451 11:19656791-19656813 CGGTAGCCACAGAGGAAACAAGG + Intronic
1081730507 11:45368801-45368823 CTGTTAAGACAGATGAAAATGGG + Intergenic
1083755509 11:64789756-64789778 AGGAGATCACAGATGAAACAAGG - Exonic
1085822397 11:79806684-79806706 CGTTTAAGTCAGATGAAAGAAGG - Intergenic
1096311729 12:50526934-50526956 TGGTTAAGACAGAGGAAAAAAGG - Intronic
1098211641 12:68172399-68172421 TGGTCAACAGAGAAGAAACATGG - Intergenic
1098373875 12:69791226-69791248 CTGTAAACTCAGAAGAAACAAGG + Intronic
1106790608 13:33151959-33151981 CGTTAAACACAGAGGAAACAGGG + Intronic
1113000846 13:105634349-105634371 CAGTTAATGCAGATCAAACAGGG + Intergenic
1114334601 14:21675278-21675300 CTGTTAAAACAAATGAAATATGG + Intergenic
1117346013 14:54833493-54833515 AAGTTAACACACATGATACATGG - Intergenic
1118422303 14:65620245-65620267 CAGTCAACACAGTTGAAAAATGG - Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1140175865 16:72659047-72659069 CAGATTACACAGCTGAAACAAGG - Intergenic
1140423617 16:74842020-74842042 AAGAGAACACAGATGAAACAAGG + Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1148570001 17:48660651-48660673 CTGTTCACACAGATAAAACTAGG - Intergenic
1156860736 18:41833468-41833490 TGGTTAACAGAGAGGGAACATGG - Intergenic
1163493127 19:17628683-17628705 CGGTTAACACAGATGAAACATGG + Intronic
1167443556 19:49524402-49524424 CGGTTAGCACAGTGCAAACATGG + Intronic
928646782 2:33362624-33362646 AAGTTAACACAGATGGAAAATGG - Intronic
928763965 2:34619183-34619205 TGGTTAACAAAGATGATACTTGG + Intergenic
931945733 2:67304834-67304856 TGGGTAATACAGTTGAAACATGG + Intergenic
933369240 2:81394251-81394273 CAGTGATCACAGATGAAAAAGGG - Intergenic
947121574 2:226820849-226820871 CTATTAACACAGATCAAAAAGGG + Intergenic
947358701 2:229323887-229323909 CGGTTAACAATTATGAAAGATGG + Intergenic
1173941529 20:46915036-46915058 TGGTGAACACAGCAGAAACACGG - Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1174884629 20:54319681-54319703 CAGTTAACCCAGATGAAAACAGG + Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1177462646 21:21433109-21433131 GGGTCAACACAGATGAGACCAGG - Intronic
1179659465 21:42865201-42865223 GGGTAAACACAGAGAAAACAAGG + Intronic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
951407636 3:22320255-22320277 TGATTAACAGAGATGAACCAAGG + Intronic
952120860 3:30242652-30242674 TGGGTAACAGAGATGAAAAAGGG + Intergenic
953487912 3:43319722-43319744 ATGTTAACAGAGATGAACCAAGG + Intronic
955575525 3:60358653-60358675 CTGATAACACAGATACAACATGG + Intronic
957087025 3:75690320-75690342 CAATTCACACAGATGAAAAATGG + Intergenic
966986023 3:185181074-185181096 GGGTTGATACAGATGTAACAGGG - Intergenic
971279088 4:25226504-25226526 GAGTTAATACAGACGAAACAAGG - Intronic
972185633 4:36524459-36524481 TGGTTTATACAGAAGAAACAGGG - Intergenic
972953719 4:44362744-44362766 CCTTTAACACAGAAGAAACTAGG - Intronic
976680362 4:87749047-87749069 CGTTTAAGACTGATGGAACATGG + Intergenic
983004174 4:162462567-162462589 CAGTTAAGACAGTTGAAGCAGGG - Intergenic
984194862 4:176646980-176647002 AGGTTCACACAGATGATATAGGG + Intergenic
989668268 5:43882539-43882561 TGGTAAACACACATGAAAAAGGG + Intergenic
990455890 5:55987546-55987568 AGGATAACAAAGATGATACAGGG + Intronic
1001774527 5:174319095-174319117 CAGATGACAAAGATGAAACAGGG - Intergenic
1002890660 6:1328541-1328563 AGGTTACAACAGATGACACATGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1006098926 6:31673587-31673609 AGGTAAACACAGATTAAAGAGGG + Intronic
1010260518 6:73810468-73810490 CAGTTACCACAGATGAAAAGTGG - Intronic
1010808945 6:80275956-80275978 AGGTTAAAAAAGATAAAACAGGG + Intronic
1017790651 6:157795644-157795666 AGGGGAACATAGATGAAACATGG + Intronic
1022252853 7:28626384-28626406 GGGTTAACACACATAAAACTTGG - Intronic
1022431846 7:30331818-30331840 ATGTTAACACAAATGGAACACGG - Intronic
1022564546 7:31384867-31384889 GGGGTAACACAGATGAGACAGGG - Intergenic
1023620444 7:42066471-42066493 AGGTTAACACAAATTAAATATGG + Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1027591704 7:80126813-80126835 CAGTTAACACAAATGAAAAATGG + Intergenic
1029336818 7:99907409-99907431 CGATTAAAAAAGATGAAACTGGG - Intronic
1036372551 8:8173634-8173656 TCTTTAACACAGATGAAAAATGG + Intergenic
1036878352 8:12492007-12492029 TCTTTAACACAGATGAAAAATGG - Intergenic
1037373739 8:18206580-18206602 CGGCCAACACACATGAAAAAAGG - Intronic
1038660810 8:29495078-29495100 CTGATAACACAGTTGAAAGAAGG + Intergenic
1043115113 8:76241265-76241287 TTGTAACCACAGATGAAACATGG - Intergenic
1043550816 8:81370621-81370643 AGGTTAACAAAGATTACACAAGG + Intergenic
1049300675 8:141867804-141867826 TGGTTCACACAGAGGACACAGGG + Intergenic
1049962011 9:746113-746135 CAGCTATCAGAGATGAAACAGGG - Intergenic
1050007149 9:1144014-1144036 AGGTCAACCCAGATAAAACATGG + Intergenic
1050642026 9:7678508-7678530 AGGCTGACAAAGATGAAACAAGG - Intergenic
1050784124 9:9377718-9377740 ATGTTGGCACAGATGAAACAAGG + Intronic
1053366881 9:37529085-37529107 AGGTTAACAAAGATGAAGGAGGG + Intronic
1053397402 9:37787108-37787130 GGGTCAAGGCAGATGAAACAGGG + Intronic
1056853630 9:90105764-90105786 GTGTTCACACAGATGAAATAAGG - Intergenic
1187787107 X:22904185-22904207 TGATTAATGCAGATGAAACATGG + Intergenic
1188306754 X:28568599-28568621 CAGTGAAGACAGATGAATCAGGG - Intergenic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1189294063 X:39906457-39906479 CGTGAAACACAGATCAAACACGG + Intergenic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic
1197111836 X:122784334-122784356 CAGTTATCAGACATGAAACATGG + Intergenic
1201076015 Y:10188615-10188637 CAGTGAAAACCGATGAAACAGGG - Intergenic