ID: 1163494253

View in Genome Browser
Species Human (GRCh38)
Location 19:17636058-17636080
Sequence CCTCATAGTGTCCATCATTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163494253_1163494260 18 Left 1163494253 19:17636058-17636080 CCTCAATGATGGACACTATGAGG 0: 1
1: 0
2: 1
3: 7
4: 102
Right 1163494260 19:17636099-17636121 AAGTCGAGGTTCTTGATGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 75
1163494253_1163494257 4 Left 1163494253 19:17636058-17636080 CCTCAATGATGGACACTATGAGG 0: 1
1: 0
2: 1
3: 7
4: 102
Right 1163494257 19:17636085-17636107 TCAGCTTGGACCAGAAGTCGAGG 0: 1
1: 0
2: 1
3: 7
4: 112
1163494253_1163494259 17 Left 1163494253 19:17636058-17636080 CCTCAATGATGGACACTATGAGG 0: 1
1: 0
2: 1
3: 7
4: 102
Right 1163494259 19:17636098-17636120 GAAGTCGAGGTTCTTGATGCTGG 0: 1
1: 0
2: 0
3: 5
4: 95
1163494253_1163494256 -10 Left 1163494253 19:17636058-17636080 CCTCAATGATGGACACTATGAGG 0: 1
1: 0
2: 1
3: 7
4: 102
Right 1163494256 19:17636071-17636093 CACTATGAGGGTAATCAGCTTGG 0: 1
1: 0
2: 0
3: 2
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163494253 Original CRISPR CCTCATAGTGTCCATCATTG AGG (reversed) Exonic
902244989 1:15114927-15114949 CCTCAGAGTGACCGTCACTGTGG + Exonic
903283161 1:22261698-22261720 CCTCATAAGGCCCAACATTGTGG - Intergenic
907168666 1:52439497-52439519 CCTAACAGTGTCCATCCTTCTGG + Intronic
907796148 1:57719680-57719702 CCACATAGTGGCCTTCATAGTGG - Intronic
914924244 1:151870571-151870593 CCTCATTGTCTCCATCACAGAGG + Intergenic
921542519 1:216433592-216433614 CCTCATTTTTTCCATCCTTGTGG - Intergenic
921833328 1:219752322-219752344 CCTCTTAGTCTCCAGTATTGTGG - Intronic
924055674 1:240121931-240121953 ATTCACAGTGTCCATCATGGCGG - Intronic
924068504 1:240252258-240252280 TCTCTTATTGTTCATCATTGTGG + Intronic
1062802686 10:391754-391776 CCTTGTAGGGTCCATAATTGAGG - Intronic
1066230821 10:33431292-33431314 GCTTATAATGTCAATCATTGTGG + Intergenic
1068057471 10:52028764-52028786 ACACATAGTGTCCATGATTGTGG + Intronic
1068627993 10:59270074-59270096 CCTCATTCTGCCCATCTTTGTGG + Exonic
1072671154 10:97430497-97430519 CCCCATAGTGCCGCTCATTGAGG - Exonic
1073288011 10:102399989-102400011 CCTCATAGTCTCCCTCGCTGGGG - Intronic
1073904052 10:108256251-108256273 CCCCATGGTGGCCATCAATGAGG + Intergenic
1075722703 10:124596786-124596808 CCTCATATTCACCATCATGGTGG - Intronic
1080117472 11:28636965-28636987 CATCATAGTGTACATCTTTGTGG + Intergenic
1080527112 11:33133837-33133859 CCTCTTAGTCTCCTTCAATGTGG - Intronic
1080689685 11:34546020-34546042 CCACAGAGCGGCCATCATTGAGG + Intergenic
1080747226 11:35119077-35119099 CTTCATGGTGGCCATCCTTGTGG - Intergenic
1083847348 11:65343777-65343799 CTTCATAGTCTTCATCATCGAGG - Exonic
1083863076 11:65436135-65436157 CCTCATAGGGTCACTCATAGGGG + Intergenic
1086637637 11:89108456-89108478 CCTCATATTATGCATAATTGGGG + Intergenic
1091817627 12:3452113-3452135 CCTCTGTGTGTCCATCTTTGTGG - Intronic
1100337063 12:93641307-93641329 CCCCATAGTGCCGCTCATTGAGG + Intergenic
1100553822 12:95672562-95672584 CCCCATAGTGCCGCTCATTGAGG - Intronic
1101241139 12:102841252-102841274 CCTCATAGAGGCCCTCATGGTGG - Intronic
1101361400 12:104031036-104031058 CCCCATAGTGCCGCTCATTGAGG - Intronic
1103707730 12:122887713-122887735 CCACATAGTTTTCATCATTTAGG - Intronic
1107930212 13:45300859-45300881 CCTGATTGTGTCCCTCCTTGGGG + Intergenic
1109623690 13:64945184-64945206 ACTCATAGTGTCCCTCTTTCTGG - Intergenic
1110617869 13:77561359-77561381 CCTCATGGTGGCCAACATTGTGG + Intronic
1111511682 13:89273116-89273138 CCTCAGAAATTCCATCATTGTGG + Intergenic
1115388143 14:32821686-32821708 CCTCATAGAGTTCAACATTGTGG - Exonic
1115489975 14:33949976-33949998 CCTAATACTGCCCTTCATTGTGG - Intronic
1119714941 14:76852531-76852553 CCTCATGGTCACCATCAATGAGG + Intronic
1133705064 16:8346707-8346729 CCTCATCATCTCCATCATTTGGG + Intergenic
1135116656 16:19729495-19729517 CCTTATAGTTTCCATCATGTTGG + Intronic
1139517082 16:67458473-67458495 CCTCTCAGTGGCCATCACTGAGG - Intronic
1158352357 18:56575605-56575627 CTACATAGTGGCCATCAATGGGG - Intergenic
1158859954 18:61582219-61582241 CCTGACAGTGTCCACCGTTGAGG - Intergenic
1159337225 18:67084215-67084237 CCTCATAGTGTTCTTCTTTAAGG + Intergenic
1160857601 19:1224402-1224424 CCTCATGGTGCCCATCCTTGGGG + Intronic
1163494253 19:17636058-17636080 CCTCATAGTGTCCATCATTGAGG - Exonic
1164849183 19:31466294-31466316 CCTCACAGAGTTCATCATTTAGG - Intergenic
1166002404 19:39885672-39885694 CCTCATAGTAGACACCATTGTGG + Exonic
1166005188 19:39901924-39901946 CCTCATAGTAGGCACCATTGTGG + Exonic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
1167881504 19:52462562-52462584 CCTCATCGTGGCTATGATTGCGG - Intronic
926768007 2:16339699-16339721 TCTCATATTGTTTATCATTGTGG - Intergenic
932459511 2:71873219-71873241 CCTCAGAGTCTCCATCATTGTGG + Intergenic
933478463 2:82822309-82822331 GATCATAGTTACCATCATTGTGG + Intergenic
933743825 2:85555566-85555588 CTTCATTGTGTACTTCATTGCGG - Exonic
935654291 2:105408730-105408752 CATCATAGTGGCAATCATGGTGG - Intronic
937972521 2:127561599-127561621 CCGCATAGTGTCCAGCACAGAGG - Intronic
940832540 2:158483543-158483565 CATCATAGAGACCATCAGTGTGG + Intronic
942147727 2:173042971-173042993 CTTCACTGTGTGCATCATTGAGG - Intronic
946466696 2:219918429-219918451 CCTCATGAGGTCCATCATTTTGG + Intergenic
1168784627 20:527535-527557 CTTCATAGTGTGCTTCATAGTGG - Intronic
1169532665 20:6502378-6502400 CCTCATCTTGTCCTTCATTCTGG - Intergenic
1174699005 20:52589035-52589057 CCTCATTGTGCCCGTAATTGGGG - Intergenic
1175040444 20:56044786-56044808 CCTCAAAGTCTGTATCATTGTGG - Intergenic
1180279417 22:10680058-10680080 GCTTATATTGTCCATCATAGGGG + Intergenic
1181443623 22:22951769-22951791 GCTCATAGTGTCCATAATGAGGG - Intergenic
949844180 3:8353323-8353345 CCTCCAAATGTCCATCATGGCGG + Intergenic
950711431 3:14815750-14815772 CCTCTGAGTCTCCATCATAGAGG + Intergenic
957595969 3:82266715-82266737 CCTCATAATTTGCCTCATTGTGG + Intergenic
958626511 3:96631781-96631803 CCTCACACTGGCCATAATTGAGG + Intergenic
960157231 3:114308445-114308467 CCTCATAATGGCCAGCATTTTGG + Exonic
962046504 3:131765574-131765596 CCTCATAGTGTCTAAGATGGGGG - Intronic
964096894 3:152942383-152942405 CCTCATAGTGGACAATATTGCGG + Intergenic
973748397 4:53987041-53987063 CCCCTTTGTGTTCATCATTGTGG + Intronic
975479013 4:74857111-74857133 CCTCACAGTGACCATCATGGTGG - Intergenic
978324094 4:107531779-107531801 CCTCATACTGTCTTTCTTTGTGG - Intergenic
980380169 4:132003563-132003585 CCTCCTAGTCTCCAGCACTGTGG - Intergenic
983115681 4:163813214-163813236 CCTTATACTATCCATCATAGAGG + Intronic
987805962 5:22769083-22769105 CCTCTTAGTAACCATCACTGGGG - Intronic
991290306 5:65027374-65027396 CCTCAGAGTTTCCAGCCTTGGGG - Intergenic
993067524 5:83117963-83117985 CCTCATAGCTTCCTTCACTGGGG - Intronic
1000863860 5:166488886-166488908 CCTCAGGGTCTCCATGATTGTGG + Intergenic
1003014980 6:2461224-2461246 CCTCATAGTCTCACTCACTGAGG + Intergenic
1004367450 6:15024005-15024027 CTTCATAGTGTGCTTCACTGAGG + Intergenic
1011749163 6:90438170-90438192 CCTTATATTTTACATCATTGAGG - Intergenic
1011969404 6:93203549-93203571 AGTCATAGAGTCCATCATTCTGG - Intergenic
1014343002 6:120231940-120231962 TCTCATATTGTTTATCATTGTGG - Intergenic
1016743018 6:147548304-147548326 CCTCAGAGAGACCATCATTTCGG + Intronic
1021657247 7:22884115-22884137 CCTCATAGTGGCCATCCTATTGG - Intergenic
1024597327 7:50949673-50949695 TCTCTTAATGTTCATCATTGTGG - Intergenic
1026322784 7:69282189-69282211 CCTCACAGGGTCCATGACTGTGG - Intergenic
1028626463 7:92882668-92882690 TCTCTTATTGTTCATCATTGTGG - Intergenic
1028753254 7:94406441-94406463 TCTCATAGTCCCCATCCTTGAGG - Intronic
1037778796 8:21853515-21853537 CCCCTTGGTGTCCATCAATGAGG - Intergenic
1039417646 8:37409401-37409423 CCTCATATTAACCATCATGGAGG - Intergenic
1044299625 8:90568469-90568491 TCTCACAGTGTCCAGCATTGTGG + Intergenic
1050782249 9:9351882-9351904 CCTCATATAGTCCATCAAGGTGG - Intronic
1053103324 9:35389917-35389939 ACTCATCGTGTCAATCATAGAGG + Exonic
1056512200 9:87316671-87316693 CCTCAGAGGCTCCATCCTTGGGG + Intergenic
1203654883 Un_KI270752v1:14192-14214 CCTCATTTTCTCCATCATTTTGG + Intergenic
1186283096 X:8015540-8015562 CCTCATAATGTCCCTCACAGTGG + Intergenic
1188284529 X:28311884-28311906 CCTCTTAATGTGCATGATTGAGG + Intergenic
1188669055 X:32860801-32860823 CGTCATAGTGGCCATTCTTGAGG - Intronic
1193135780 X:77969359-77969381 CCCCATAGTGCCGCTCATTGAGG + Exonic
1193492991 X:82172546-82172568 CTTGAAAGTGTCCATAATTGGGG - Intergenic
1193783099 X:85727493-85727515 CCTCTTATTGTTTATCATTGTGG + Intergenic
1194024996 X:88740153-88740175 CTTCATTGTGTCCATGTTTGAGG - Intergenic
1194696989 X:97064728-97064750 CCTCATAGAGTTCTTCCTTGTGG - Intronic
1199733252 X:150658494-150658516 CCTCATAGTTACCATTTTTGTGG - Intronic
1201440858 Y:14006629-14006651 CCTCATAATGTCCCTCACAGTGG + Intergenic
1201443713 Y:14036079-14036101 CCTCATAATGTCCCTCACAGTGG - Intergenic
1201947400 Y:19526701-19526723 CCTCCTAGTGTCTATCCCTGTGG - Intergenic