ID: 1163494694

View in Genome Browser
Species Human (GRCh38)
Location 19:17639490-17639512
Sequence CTGGAGTCTCTCCGGGCTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163494689_1163494694 -4 Left 1163494689 19:17639471-17639493 CCACAGTGGATTTGAGGTCCTGG 0: 1
1: 0
2: 3
3: 15
4: 197
Right 1163494694 19:17639490-17639512 CTGGAGTCTCTCCGGGCTGCTGG 0: 1
1: 0
2: 2
3: 18
4: 189
1163494685_1163494694 25 Left 1163494685 19:17639442-17639464 CCGAAAGAAGGTGATGCTGGTGA 0: 1
1: 0
2: 3
3: 18
4: 233
Right 1163494694 19:17639490-17639512 CTGGAGTCTCTCCGGGCTGCTGG 0: 1
1: 0
2: 2
3: 18
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163494694 Original CRISPR CTGGAGTCTCTCCGGGCTGC TGG Exonic
900211021 1:1455954-1455976 CTGGGGTCTCACCTGCCTGCAGG + Intronic
900216847 1:1486273-1486295 CTGGGGTCTCACCTGCCTGCAGG + Intronic
900223928 1:1524002-1524024 CTGGGGTCTCACCTGCCTGCAGG + Intronic
900351004 1:2234535-2234557 CTGGAGTCTCTCGGGGTTGTGGG + Intronic
902337916 1:15764574-15764596 CTGGAGTCCCGCCTGCCTGCTGG - Exonic
904128743 1:28260252-28260274 CTGGAGGCTCTCCGAGCTTTGGG + Intronic
904970988 1:34419256-34419278 CTGGAGCCTCTCCAGGGAGCAGG + Intergenic
906136917 1:43506364-43506386 CTGGAGCCTGTCCAGGGTGCTGG - Intergenic
908355018 1:63320225-63320247 CTGGACTCCCTCCACGCTGCTGG - Intergenic
910099104 1:83557618-83557640 CTGGAGTCTGTGTTGGCTGCTGG - Intergenic
916488642 1:165281514-165281536 CTGGAGTCTCTTCAGTCTCCTGG - Intronic
916499757 1:165376563-165376585 CTTCAGTTTCTCCCGGCTGCTGG + Intergenic
916952435 1:169794709-169794731 TTGGAGTCACTTCCGGCTGCAGG + Intronic
918466684 1:184827802-184827824 CCGCAGTCTCACCAGGCTGCTGG + Intronic
920676486 1:208041908-208041930 CTGTAGTCTCCCTGGGCTGAGGG + Intronic
922569562 1:226625972-226625994 CTGGAGTCACTCCAGGCAGTGGG - Intergenic
924608533 1:245555451-245555473 CAGGAGTCTGTCCAGTCTGCTGG - Intronic
1064128679 10:12688218-12688240 CTGAAGTCTCTCCTGGGTACTGG + Intronic
1069999573 10:72366275-72366297 CTGGAGGTTCTGGGGGCTGCAGG + Intergenic
1070963441 10:80515316-80515338 CAGGCCTCTCTCCTGGCTGCAGG + Intronic
1071109310 10:82136428-82136450 CTGGACTCTCCCTGGGCTGAAGG - Intronic
1071492570 10:86145865-86145887 CTGAAGTCACGCCGGGCTTCAGG - Intronic
1073428865 10:103473131-103473153 CTGGAGTCTTTCCAGGCCGTGGG - Exonic
1074390321 10:113052157-113052179 CTGTAGCCTTTCGGGGCTGCAGG - Intronic
1074750075 10:116577319-116577341 CTGGACTCTTTCAGTGCTGCTGG + Intergenic
1076345837 10:129778411-129778433 CTGGAGTCTTTCCTGGCTCAAGG + Intergenic
1076567635 10:131409802-131409824 CTGGCCTCTCTCCCGGCTTCCGG - Intergenic
1076694275 10:132239644-132239666 CTGCAGTCACTGCGGGCGGCTGG - Intronic
1077159025 11:1104245-1104267 CTCCAGTCTCTCCTGGCTCCCGG + Intergenic
1077185906 11:1235246-1235268 CTGGAGTGTGCCCGGCCTGCAGG - Intronic
1078573063 11:12475956-12475978 CTGCACACTCTCCGGGGTGCTGG + Intronic
1078635294 11:13043999-13044021 CTGGAGTCTCCCAGGACTTCTGG - Intergenic
1079187121 11:18247735-18247757 CTCGAGTCTTTCAGAGCTGCTGG - Intronic
1079189682 11:18267142-18267164 CTCGAGTCTTTCAGAGCTGCTGG + Intronic
1083235063 11:61345857-61345879 CTGGATTCTCTGTGGGCAGCGGG + Exonic
1083268807 11:61560276-61560298 CTGGAGTCTCTCTGGGGCTCTGG + Intronic
1083430981 11:62613344-62613366 CTGGCTCCTCTCCTGGCTGCTGG + Exonic
1083445806 11:62707436-62707458 GTGGAGTCTGTACTGGCTGCGGG - Intronic
1084014594 11:66371232-66371254 CAGGAGTCTCACCGGGATGGCGG + Exonic
1084178021 11:67433501-67433523 CCTGAGTCTCTCTGGGCTGTGGG + Intronic
1084515270 11:69634579-69634601 CTGCTGGCCCTCCGGGCTGCGGG - Intergenic
1084891160 11:72237756-72237778 CTGGATGCTCTCCCGGATGCGGG - Exonic
1090441361 11:126728000-126728022 CTGGCTTCTCTCAGAGCTGCTGG - Intronic
1091312384 11:134583982-134584004 CTGCAGTCTCTGAGGGCAGCAGG + Intergenic
1096079957 12:48826711-48826733 CTGGAGTCTCTCAGGACTCTGGG - Intronic
1096513317 12:52143750-52143772 CTGGAGCCTCTCCCGGCAGCTGG + Intergenic
1105247368 13:18665801-18665823 CTGCAGGATCTCCAGGCTGCTGG - Intergenic
1105441208 13:20416456-20416478 CTGCCCTCTCTCCAGGCTGCTGG + Intronic
1105454221 13:20525703-20525725 CCGGCGTCTCCCCGGGCTCCAGG + Intronic
1107108759 13:36674004-36674026 CGGGAGTGGATCCGGGCTGCCGG - Exonic
1108508605 13:51135245-51135267 CTGGTCTCTCTCCAGGCTCCTGG - Intergenic
1112493815 13:99889819-99889841 CTGATGTCACTCAGGGCTGCCGG - Intronic
1113527501 13:110992172-110992194 CTGGAGGCTTCCAGGGCTGCGGG + Intergenic
1113612522 13:111657259-111657281 CTGGAGAGTCTCCTGGCTCCTGG + Intronic
1121618886 14:95332469-95332491 CTGGAACCTCTCTGGGCAGCGGG - Intergenic
1123029699 14:105445834-105445856 CTGGAGACTTTCCAGGCTGGTGG + Intronic
1126193142 15:45900028-45900050 GTGAAGTCTCTCCGGGCAGCAGG - Intergenic
1126392870 15:48178159-48178181 CCGGCGGCTCTGCGGGCTGCAGG + Exonic
1127800990 15:62477425-62477447 TTGGAGTCTCTTCTAGCTGCAGG + Intronic
1128223928 15:65988756-65988778 CTGGAGTCTCTCTGGGCTGGAGG + Intronic
1129320526 15:74772208-74772230 TTGGAGTCGCTGAGGGCTGCAGG + Intergenic
1130064251 15:80591674-80591696 CTTCAGTCTGACCGGGCTGCTGG - Exonic
1130097981 15:80870399-80870421 CTGTAGCCTCTCTGGGCAGCAGG + Intronic
1131670172 15:94611379-94611401 CTGTAGTCACTGCGTGCTGCTGG - Intergenic
1132314221 15:100879167-100879189 CTGGAGTCTCCCCGGGGCCCTGG - Intronic
1132554751 16:567590-567612 CTGGAGACTCCACGGGCTCCCGG + Exonic
1132671547 16:1104048-1104070 CAGGGGCCTCTCCGGGCTGCTGG + Intergenic
1138595936 16:58028954-58028976 CTGGAGACTCTCAGCCCTGCAGG - Intronic
1140406907 16:74717274-74717296 CTGCAGCCTCTCTGGGCTGGAGG + Intronic
1141542688 16:84738154-84738176 CTGCAGTCTCTCGGGTCTGGAGG + Intronic
1142312246 16:89320853-89320875 GTGGAGCCCCTCTGGGCTGCAGG - Intronic
1143499494 17:7330461-7330483 GTGGAGTCCCTAGGGGCTGCTGG + Intergenic
1143862967 17:9904742-9904764 CCGGGGTCGCTCCGGGCTGGGGG - Intronic
1146212919 17:30956166-30956188 TTGGAGGCTGTCAGGGCTGCAGG + Intronic
1147338045 17:39738761-39738783 CAGACGTCTCTGCGGGCTGCGGG + Exonic
1147834072 17:43317604-43317626 CTGTTGTCTCTCCTGGCTGCTGG + Intergenic
1148675460 17:49442288-49442310 CTGGGCTCTATCCGGGCTGCTGG + Intronic
1151444739 17:74155914-74155936 CCGGAGTCTGTCCGAGCAGCTGG + Intergenic
1151743667 17:76000648-76000670 CTGCAGCCTCTCAGGGCTTCTGG + Intronic
1152158387 17:78650211-78650233 GAGGAGGCTCTCTGGGCTGCTGG + Intergenic
1152300460 17:79492505-79492527 CTGGTCTCTCTCGTGGCTGCTGG - Intronic
1153487467 18:5614465-5614487 CTGGAGTCTCTCCGCAAAGCAGG + Intronic
1154441474 18:14393320-14393342 CTGCAGGATCTCCAGGCTGCTGG + Intergenic
1157747824 18:50151935-50151957 ATGTAGGCTCTCTGGGCTGCAGG - Intronic
1158842015 18:61397454-61397476 CTGGATACTCTCAGGGCTCCCGG + Intronic
1159770857 18:72543862-72543884 CTGGAGACTGGCGGGGCTGCGGG - Intronic
1159959863 18:74546987-74547009 CTGGAGTTTCTCCAGGATGCTGG + Intronic
1160345216 18:78127152-78127174 CTGGAGCCTCTGAGGGCTGGTGG - Intergenic
1160571281 18:79819215-79819237 CTGGTGTCTCTGCAGGCTGCCGG - Intergenic
1160874055 19:1289085-1289107 CTGGAGTCGCATCCGGCTGCAGG + Intronic
1160930332 19:1567197-1567219 CCGGAGCCTTTCCGGGCTGGAGG + Intronic
1161056485 19:2193180-2193202 CGGGAGACTGTCCTGGCTGCGGG + Intronic
1161333871 19:3700584-3700606 CTCGAGGCGCTCCTGGCTGCGGG - Intergenic
1161531462 19:4792432-4792454 CTGCAGGATCTCCAGGCTGCCGG - Exonic
1162463379 19:10826452-10826474 CTGGAGACTCTCAGGGCTCTGGG + Intronic
1162648197 19:12065147-12065169 ATGGAGAGGCTCCGGGCTGCGGG - Intronic
1162811073 19:13164562-13164584 GTGGAGTCTCTCCAGGCTGAAGG - Intergenic
1163202742 19:15780230-15780252 CTGGGGTGTCTCCAGGCTGCTGG - Intergenic
1163484380 19:17577339-17577361 CTGGGGACTCTCCGGGCTGCAGG + Exonic
1163494694 19:17639490-17639512 CTGGAGTCTCTCCGGGCTGCTGG + Exonic
1163845785 19:19637534-19637556 GCTGAGTCTCTTCGGGCTGCGGG - Exonic
1165139423 19:33689923-33689945 CTGGAGTCACAGAGGGCTGCTGG + Intronic
1165433880 19:35786656-35786678 CCGGAGTCCCTCCAGGCAGCGGG - Intronic
1167667440 19:50830998-50831020 CTGGAGTCTGTCTGTGCTGTTGG + Intronic
1167706237 19:51082794-51082816 CTGCAGGCTCTGCGGGCGGCAGG + Exonic
1168434960 19:56309650-56309672 CTGGAGTCACTCAGAGTTGCAGG - Intronic
925912477 2:8582818-8582840 CTGTAGTTTCTCTGGGCTCCTGG - Intergenic
926116525 2:10217226-10217248 CTGGAATCTCCCAGGCCTGCGGG + Intergenic
927198521 2:20564368-20564390 CTGGGCTCCCTCAGGGCTGCTGG + Intronic
927492277 2:23528538-23528560 CTGGAGGCTCTCTGGGCTCAGGG - Intronic
927687180 2:25179168-25179190 GTGGGGGCTCTCCGGGCCGCAGG - Intergenic
935080165 2:99785097-99785119 CTGCATTCTCTCCTGGCTACCGG - Intronic
936373530 2:111922183-111922205 CTGGAGTCCCTCCATGCTGTGGG - Intronic
937318438 2:120946832-120946854 CTGGCGTGTTTCAGGGCTGCTGG + Intronic
938248747 2:129797862-129797884 CTGCTGTCTCCCCGAGCTGCTGG - Intergenic
943645887 2:190408054-190408076 CAGGTGTCCCTCCGGGCCGCCGG + Intergenic
945043799 2:205764385-205764407 CTGGAGCCTCTCATGTCTGCCGG - Intronic
947597266 2:231421002-231421024 CAGGAGTGTGTCCAGGCTGCTGG - Intergenic
948154100 2:235767403-235767425 GTGGAGGCTCTGCGGGCTGGGGG + Intronic
948611907 2:239175327-239175349 CTGGCGTGTCCCCGGGGTGCAGG - Intronic
949018045 2:241724652-241724674 CTGCAGTCTGTGGGGGCTGCAGG - Intronic
949074522 2:242046689-242046711 CTGGCGTCTCTCTCCGCTGCGGG - Intergenic
949074541 2:242046765-242046787 CTGGCGTCTCTCTCCGCTGCGGG - Intergenic
1175129075 20:56775782-56775804 CTGGACTCTCTCTGGACTGATGG + Intergenic
1175183946 20:57167240-57167262 CTGGAATCTCCCAGGGCTGCTGG - Intergenic
1175285639 20:57834908-57834930 CTGGAGGCTCTGCTGGCTGCAGG + Intergenic
1176167184 20:63680465-63680487 CTGGCTTCTCTCCTGGCTGCTGG + Intronic
1176454586 21:6897855-6897877 CTGCAGGATCTCCAGGCTGCTGG - Intergenic
1176832759 21:13762903-13762925 CTGCAGGATCTCCAGGCTGCTGG - Intergenic
1176994096 21:15533972-15533994 CTGGAGTCTCTCTGTGGTGAAGG + Intergenic
1178847370 21:36184762-36184784 TGGGAGGCTCTGCGGGCTGCGGG + Intronic
1180048251 21:45319615-45319637 CTGGGGTTTCCCAGGGCTGCGGG - Intergenic
1180064860 21:45407089-45407111 CTGAGTTCTCTCCGGGCTGGGGG - Intronic
1180075256 21:45458667-45458689 CTGGAGCCTCCCGGGGCTCCAGG - Intronic
1180085099 21:45504851-45504873 CTGGAGTCTTTCAGGACTGATGG - Intronic
1180877713 22:19182540-19182562 CTGGAGGCTCTGCAGGCGGCAGG + Intronic
1181139107 22:20791001-20791023 CCTGCGCCTCTCCGGGCTGCTGG - Intronic
1182586665 22:31347308-31347330 CCGGCGTCTCACAGGGCTGCGGG - Intergenic
1183232314 22:36590721-36590743 CTGGAGTGTTTCCGAGCTGGAGG - Intronic
1183240316 22:36652948-36652970 CTGGAGTCCCCCCGGGCTGTAGG + Intronic
1184660284 22:45962478-45962500 CTGGAATCTTGCCTGGCTGCTGG - Intronic
1185173702 22:49307441-49307463 CTGGGGTCTCCCCTGGCTTCTGG + Intergenic
950007351 3:9699934-9699956 CTGAAGTCTCTCCTGGCAACTGG - Intronic
953183196 3:40615526-40615548 CTGGACTATGTCAGGGCTGCAGG - Intergenic
961223400 3:125217893-125217915 CTGGAGCCTCCGCGGGCGGCTGG - Intergenic
965400915 3:168211148-168211170 CTGAAGTCTATCTGGGCAGCTGG - Intergenic
966904720 3:184513842-184513864 CCGGAGTCCCCCTGGGCTGCTGG + Intronic
966997341 3:185296044-185296066 CTGGAGTCTCACTGTGTTGCTGG - Intronic
968889905 4:3363424-3363446 CTGGGGTCTCTCGGGGAGGCTGG - Intronic
969394389 4:6910634-6910656 CAGGAGTCTCTCTAGGCTGTGGG + Intronic
973907657 4:55547039-55547061 CGGGAGTCTCTTCGGGCGTCCGG - Intronic
975415812 4:74103154-74103176 CAGGAGATTCTCTGGGCTGCTGG - Intergenic
981348404 4:143700585-143700607 CTTGAGTCGCCCCGCGCTGCAGG - Exonic
985947723 5:3199906-3199928 GGGGAGTCTCTGGGGGCTGCAGG + Intergenic
985958259 5:3280704-3280726 CTGGAGCCACTCCTGGGTGCAGG - Intergenic
986987111 5:13512528-13512550 TAGGAGTCTCTCTGGGCTTCAGG - Intergenic
987933000 5:24426975-24426997 CTGGATTCTGTCAGGGCTGGAGG - Intergenic
988307797 5:29515986-29516008 CTGGCTTGTCTCAGGGCTGCTGG + Intergenic
992256620 5:74927606-74927628 CTGAAGTCTCTTCAGACTGCTGG + Intergenic
996900491 5:128537884-128537906 CTGGAGTCGCTCGGGGCTTTAGG - Exonic
997591631 5:135076738-135076760 CTGGTGTCTATCCTGGCTGTGGG + Intronic
998193006 5:140042822-140042844 GCGGCGGCTCTCCGGGCTGCGGG + Exonic
999198833 5:149801830-149801852 CTGCAGCCTCTCTGGGTTGCTGG - Intronic
1001640791 5:173242781-173242803 CTGGAGCCTCTCAGGCCAGCAGG + Intergenic
1002199722 5:177520939-177520961 CTGAAGGCTGTCCTGGCTGCAGG + Intronic
1002843754 6:927490-927512 CTGCAGTCTCTCCAGCCAGCGGG - Intergenic
1005379518 6:25218640-25218662 GTGGGGTCCCTGCGGGCTGCAGG - Intergenic
1006599237 6:35214527-35214549 CTGGGGGCTGTCCTGGCTGCTGG + Intronic
1007072771 6:39048954-39048976 CGGGTGGCTCTGCGGGCTGCAGG + Intronic
1007271575 6:40641367-40641389 CTGGAGTCCCTTCTGGCTGTGGG + Intergenic
1016823590 6:148367900-148367922 GTGGAGTCGTTCAGGGCTGCGGG + Intronic
1017793861 6:157823779-157823801 CGGGGGCCTCCCCGGGCTGCGGG - Intronic
1018694754 6:166382760-166382782 CGGGAGCCCCTCCGGGTTGCGGG + Intronic
1019093070 6:169556102-169556124 CTGGAGTCTCTCTCGCTTGCTGG + Intronic
1019266409 7:119743-119765 CTGGAGGCTTTCCGTGCAGCTGG - Intergenic
1019291839 7:254298-254320 CAGGGGTCTCTCCTGGCTGCAGG - Intronic
1019343499 7:519224-519246 CAGGAGGCTCCCCGCGCTGCGGG - Exonic
1019478280 7:1254584-1254606 CTGCAGTTTCCTCGGGCTGCAGG - Intergenic
1022444568 7:30459624-30459646 CTGGAGCCTTTCCAGGCAGCAGG - Intronic
1023835091 7:44063199-44063221 CTGGAGTCACACTGGGCTGAGGG - Intronic
1023852135 7:44156522-44156544 CTGTATTCTCTGTGGGCTGCAGG + Intronic
1026111616 7:67462951-67462973 CTGGGGTTTCCCGGGGCTGCTGG + Intergenic
1026547912 7:71340100-71340122 CTTGAGTCTCTAGGGGCTTCTGG - Intronic
1028268558 7:88759218-88759240 CGGGGGGCTCTCGGGGCTGCAGG - Intergenic
1028500714 7:91516152-91516174 CTGGAGTTTCTTCAGGCAGCTGG + Intergenic
1030189154 7:106793461-106793483 CTGGAGCATCTCGGGGCTGCAGG + Intergenic
1032198213 7:129801485-129801507 CAGGGGTCTCTCCTGGCTGGTGG - Intergenic
1033223695 7:139544789-139544811 CTGGTTTCTCTCCTGGCTGCCGG + Exonic
1033846504 7:145439564-145439586 CTGCAGTCTCTCCAGTCTTCAGG + Intergenic
1034158713 7:148976609-148976631 CTGGAGCCTCTCCACACTGCAGG - Intergenic
1034212842 7:149380319-149380341 CTGCAGTTTCTCTTGGCTGCAGG - Intergenic
1034691296 7:153016129-153016151 CTGGAGGATCTCCTGGCTTCAGG + Intergenic
1034691529 7:153018027-153018049 CTGGAGGATCTCCTGGCTTCAGG + Intergenic
1034977549 7:155457344-155457366 CGGGGGTCTCTCCGGGTTCCTGG + Intergenic
1037727828 8:21497884-21497906 CAGGATTCTCTCCTGGCTTCTGG - Intergenic
1039365692 8:36925840-36925862 CTGGAGCATCTCCTGGCTGAGGG + Intronic
1039561201 8:38513886-38513908 CTGGAGACTCTCCGGGTTTGCGG - Intronic
1039920782 8:41892966-41892988 CTGGGGTCTCACCGTGTTGCAGG + Intronic
1040600930 8:48883284-48883306 GTGGAGGCTCTGCTGGCTGCTGG + Intergenic
1041171047 8:55142072-55142094 CTGGTGACTTTCTGGGCTGCTGG + Intronic
1048253481 8:132886754-132886776 CTGGAGTCTCTTTGGGTTGGTGG - Exonic
1049031863 8:140043954-140043976 CTGGAGTCTGACCTGGCTGTAGG - Intronic
1049250352 8:141585322-141585344 CTGCAGTCTCTCGGGGCTTGGGG - Intergenic
1049676188 8:143890336-143890358 CTGGAGCCGCTCCTGGCTGCTGG - Intergenic
1059451089 9:114371892-114371914 CTGGGGTCTCTCCAGCCTTCGGG + Intronic
1061709309 9:132476783-132476805 CAGGCCTCTCTCCCGGCTGCTGG - Intronic
1061892674 9:133631006-133631028 CTGGAATCTCTCTGAGCTTCTGG - Intergenic
1203786697 EBV:132270-132292 CTGGAAACTCTCCGGGTAGCCGG - Intergenic
1186157319 X:6739009-6739031 CTAGAGGCACTCAGGGCTGCAGG - Intergenic
1198585271 X:138113881-138113903 CTGGGGTCTCTAAAGGCTGCTGG - Intergenic