ID: 1163498484

View in Genome Browser
Species Human (GRCh38)
Location 19:17661363-17661385
Sequence CAGTTGAAGGAGAGAGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1056
Summary {0: 1, 1: 1, 2: 6, 3: 99, 4: 949}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163498476_1163498484 11 Left 1163498476 19:17661329-17661351 CCACCAGGATATGAGGAAGGAGT 0: 1
1: 0
2: 0
3: 21
4: 212
Right 1163498484 19:17661363-17661385 CAGTTGAAGGAGAGAGAAGGAGG 0: 1
1: 1
2: 6
3: 99
4: 949
1163498472_1163498484 28 Left 1163498472 19:17661312-17661334 CCTGGAGTTAGGTTTGTCCACCA 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1163498484 19:17661363-17661385 CAGTTGAAGGAGAGAGAAGGAGG 0: 1
1: 1
2: 6
3: 99
4: 949
1163498477_1163498484 8 Left 1163498477 19:17661332-17661354 CCAGGATATGAGGAAGGAGTGAA 0: 1
1: 0
2: 0
3: 26
4: 239
Right 1163498484 19:17661363-17661385 CAGTTGAAGGAGAGAGAAGGAGG 0: 1
1: 1
2: 6
3: 99
4: 949

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163498484 Original CRISPR CAGTTGAAGGAGAGAGAAGG AGG Intronic
900860444 1:5225321-5225343 CAGTTCAAGGAAAGAGAGAGAGG - Intergenic
900894591 1:5474380-5474402 CAGTAGAAGGCGAGAGAGGCAGG + Intergenic
901642493 1:10699699-10699721 CTTTGGAGGGAGAGAGAAGGAGG + Intronic
901773044 1:11540483-11540505 AAGAGGAAGGAGAGAGAAGCGGG - Intergenic
902324793 1:15692821-15692843 CACTTGAACCAGGGAGAAGGAGG - Intronic
902684342 1:18066282-18066304 CAGTTGATGCATAGAGAGGGAGG + Intergenic
903341032 1:22654368-22654390 CAGTTGGTGGGGAGAGAGGGTGG - Intronic
903363561 1:22792368-22792390 CAGTTGAGGGAGAAGGAGGGGGG + Intronic
903459461 1:23510240-23510262 CAGGCTAAGGAGAGAGAAGAAGG - Intronic
904351108 1:29907313-29907335 GAGATGAAGGGGAGAGGAGGAGG - Intergenic
904398452 1:30239572-30239594 CAGTTGAGGGGAAGAGAAGAAGG - Intergenic
904431733 1:30468753-30468775 CAGGGGAAGGGGAGAGAGGGTGG - Intergenic
904793522 1:33041848-33041870 CATTTGAAAGAGAAAAAAGGAGG - Intronic
905447516 1:38036689-38036711 GAGTTAAAGGAGAGGGCAGGGGG + Intergenic
905481994 1:38268046-38268068 TATTTGAAGGAGAGAGAGGGAGG - Intergenic
905603039 1:39270330-39270352 TAGTTGAGAGAGAGAGAGGGAGG + Intronic
906026799 1:42681337-42681359 GAGTGGAAGCAGGGAGAAGGTGG - Intergenic
906170202 1:43718589-43718611 CTGTTGAAGGAGGGAGAAGAAGG - Intronic
906835382 1:49078193-49078215 GAGTAGGAGGAGAGAGAAGCAGG + Intronic
907066661 1:51491027-51491049 AATGTGAAGTAGAGAGAAGGTGG + Intronic
907249286 1:53127489-53127511 AGGTTCCAGGAGAGAGAAGGAGG + Intronic
907362003 1:53925163-53925185 AAGTTGAAGGAGGAAGAAGAGGG - Intronic
907530272 1:55088656-55088678 CAGCTGAGGCAGAGTGAAGGAGG + Intronic
907590010 1:55657498-55657520 TACTTGAAGGAGAGTGAATGAGG - Intergenic
907633297 1:56106573-56106595 CAGTTGATGGTGAGGGCAGGTGG + Intergenic
907793383 1:57690443-57690465 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
907948637 1:59159149-59159171 CAGTAGTAGGAGATAGGAGGGGG + Intergenic
908302943 1:62780087-62780109 TAGTTGAGAGAGAGAGAAAGAGG + Intergenic
908333263 1:63093075-63093097 CAGGAGAGGGAGAGAGATGGGGG + Intergenic
908401568 1:63776299-63776321 CAGTTAAAGGAGACAGAATTGGG - Intronic
908667604 1:66510182-66510204 CAGTTTTGGGAGGGAGAAGGTGG - Intergenic
908809422 1:67964650-67964672 CAGGAGGAAGAGAGAGAAGGTGG - Intergenic
908814086 1:68013815-68013837 CAGTCAAAAGAGAGTGAAGGGGG - Intergenic
909056836 1:70831580-70831602 AAGAAGAAGGAGAGAGAAAGGGG + Intergenic
909510611 1:76448061-76448083 CAGTGCAAGCAGAGAGGAGGGGG + Intronic
909700123 1:78512889-78512911 CAAAAGCAGGAGAGAGAAGGGGG - Intronic
909819747 1:80047028-80047050 CAGTTCCAGGGGAGAGAAGCAGG - Intergenic
909833911 1:80230271-80230293 GAGCAGGAGGAGAGAGAAGGGGG + Intergenic
910293586 1:85622521-85622543 AAGATGAAGGAAAGGGAAGGAGG + Intergenic
910547982 1:88440797-88440819 GAGGAGAAGGAGAAAGAAGGAGG + Intergenic
910891393 1:92024104-92024126 CAGGAGCAAGAGAGAGAAGGGGG - Intergenic
911087133 1:93988499-93988521 AAGTTGAAGGTCAGAGAATGGGG - Intergenic
911120886 1:94295205-94295227 CAGTTATAGGTTAGAGAAGGTGG + Intergenic
912717052 1:111990096-111990118 CAGTGGAGGAAGAGAGGAGGAGG + Intergenic
913454039 1:119012818-119012840 AAGTTTAAGGAGAGAGGAGTAGG - Intergenic
913577994 1:120196845-120196867 CAGTGGGTGGAGAGAGAATGGGG + Intergenic
913630176 1:120701507-120701529 CAGTGGGTGGAGAGAGAATGGGG - Intergenic
913696779 1:121334219-121334241 GACTTGAAGTGGAGAGAAGGAGG - Intronic
913708626 1:121455453-121455475 AAGCTGAAGAAGAGAGAAGTTGG - Intergenic
914140781 1:144945841-144945863 GACTTGAAGTGGAGAGAAGGAGG + Intronic
914559910 1:148808265-148808287 CAGTGGGTGGAGAGAGAATGGGG + Intronic
914612923 1:149321950-149321972 CAGTGGGTGGAGAGAGAATGGGG - Intergenic
914815750 1:151060646-151060668 CAGCTGAAGAGGAGAGAAGGGGG + Intronic
914939690 1:152011985-152012007 CAGGAGAGAGAGAGAGAAGGGGG + Intergenic
915468455 1:156112091-156112113 AAGGTGCAGGAGAAAGAAGGAGG - Intronic
916108732 1:161448175-161448197 CGGAGGAAGGAGAGAGAAGGAGG + Intergenic
916110320 1:161455556-161455578 CGGAGGAAGGAGAGAGAAGGAGG + Intergenic
916111905 1:161462966-161462988 CGGAGGAAGGAGAGAGAAGGAGG + Intergenic
916113492 1:161470347-161470369 CGGAGGAAGGAGAGAGAAGGAGG + Intergenic
916431765 1:164736695-164736717 CAGATGGAGGAGAGAGATGTAGG + Intronic
916455718 1:164969460-164969482 CAGCTGAGGGTGAGAGGAGGAGG - Intergenic
916493975 1:165328062-165328084 CAGTGGAAGGAGAGATAAGGAGG + Intronic
916506343 1:165431287-165431309 CATCTGAAGGAGAGAAAAGAGGG + Intronic
916527310 1:165622814-165622836 CAGATGAGAGAGAGAGAAGGAGG - Intergenic
916598925 1:166273444-166273466 CAGGAGAAGGTGAGAGAAGCAGG - Intergenic
916718629 1:167465629-167465651 CAGGTGAAGAAGAAAGAAAGGGG - Intronic
917156606 1:172006628-172006650 AAGTTGAAAGAGACAGAAGAAGG - Intronic
917162182 1:172070061-172070083 CAGCTCAAGCAGAGACAAGGTGG - Intronic
917205237 1:172564464-172564486 CAGGAGAAAGAGAGTGAAGGGGG - Intronic
917606149 1:176631929-176631951 CAGGTGGAGGAGAGAAGAGGGGG + Intronic
917691356 1:177472764-177472786 AAGTTGCTGGAGGGAGAAGGTGG + Intergenic
917714276 1:177718438-177718460 AAGTTGAAGGAGACTGAAGAGGG - Intergenic
917926249 1:179791389-179791411 CCTTGGAAGGAGAGAGCAGGGGG - Intronic
918094660 1:181324920-181324942 CAGATGCAGGAGATGGAAGGAGG - Intergenic
918132427 1:181641449-181641471 CATTCCAAGGAGAGAGAAAGAGG - Intronic
918462931 1:184795014-184795036 GACGTGAAGGAGGGAGAAGGTGG - Exonic
919140175 1:193560480-193560502 GAGTTGGAGAAGAGAGAAAGAGG - Intergenic
919321637 1:196048101-196048123 CAGTAGCAGGAGAAAGAAGAGGG + Intergenic
919512635 1:198485181-198485203 GATGTGAAGGAGAGAGAAAGGGG + Intergenic
919515440 1:198516317-198516339 CTGTTGAATGATGGAGAAGGGGG - Intergenic
919919109 1:202157863-202157885 AGGTAGAAGGAGAGAAAAGGAGG - Intronic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920273955 1:204790052-204790074 AAGTTGACAGAGAGAGATGGGGG + Intergenic
920298734 1:204975636-204975658 GAGGTGTAGGAGAGAGAAGCAGG - Intronic
920484110 1:206352573-206352595 GACTTGAAGTGGAGAGAAGGAGG - Intronic
920561342 1:206940940-206940962 CAGCTGAAACAGAGAGATGGGGG - Intronic
921273013 1:213489586-213489608 CAGTTGAATGAGAGAGATAGAGG + Intergenic
921305586 1:213793236-213793258 TGGATGGAGGAGAGAGAAGGAGG - Intergenic
921402627 1:214743045-214743067 GAGGAGAAGGAGAGAGATGGGGG + Intergenic
921631173 1:217435796-217435818 CAGTTTAAGATGAGAGAAAGTGG + Intronic
922295262 1:224244553-224244575 CACTTGAAGCAGAGAGGTGGAGG - Intronic
922356291 1:224779521-224779543 CAGGAGCAGGAGAGAGAGGGTGG + Intergenic
922389550 1:225125977-225125999 AAGAAGAAGGAGAGAGATGGGGG + Intronic
922458535 1:225796822-225796844 CCGTCGAAAGAGAGAGAGGGAGG + Intergenic
922552316 1:226504890-226504912 CAGTTTAAGGAGATAGAAGTGGG + Intergenic
923250366 1:232174885-232174907 CATTAAAAGGAGAGAAAAGGAGG - Intergenic
923621286 1:235581548-235581570 CAGGAGAAAGAGAGAGAAGGGGG - Intronic
923720809 1:236465167-236465189 GAGGTGATGGACAGAGAAGGGGG - Intronic
923827401 1:237515722-237515744 AAGGGGAAGGAGAAAGAAGGAGG - Intronic
923994050 1:239471632-239471654 CAGTGGGAGAGGAGAGAAGGGGG - Intronic
924180349 1:241434469-241434491 CAGTTGAGGGATAGTGAGGGAGG - Intergenic
924440768 1:244083398-244083420 CTGTTGAAAGAGAAAGAAGTGGG - Intergenic
1063502733 10:6569782-6569804 CAGTTGCAGAAAAGAGCAGGAGG + Intronic
1063517376 10:6710336-6710358 AAGCTGAGGGAGAGAGAAGAAGG + Intergenic
1063793420 10:9482091-9482113 CAGGAGAGGGAGAGAGATGGAGG - Intergenic
1064100325 10:12458065-12458087 CAGGTGGTGGAGAGTGAAGGTGG + Intronic
1064237457 10:13588647-13588669 GTGTTGAAGAAGAGAGAAGGAGG - Intronic
1064300340 10:14117646-14117668 CACCTGTGGGAGAGAGAAGGTGG + Intronic
1064714323 10:18161072-18161094 CAGTTGGAGGATAAAGAAGAGGG + Intronic
1065167089 10:22990989-22991011 CAGAGGAAGCAGAGAGGAGGAGG - Intronic
1065349610 10:24783652-24783674 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1065355828 10:24840594-24840616 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1065835417 10:29653303-29653325 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
1066078529 10:31906066-31906088 CAGATGGAGCAGAGAGAACGTGG - Intronic
1066700983 10:38127976-38127998 CAGTTGAAACTGAGAGAGGGTGG + Intergenic
1067084838 10:43232310-43232332 CAGGAGCAAGAGAGAGAAGGGGG - Intronic
1067346497 10:45442197-45442219 CAGGTGAAAGAGACAGAAAGAGG - Intronic
1067462823 10:46470429-46470451 AAGTGGAAGGAGAGAGAGGTTGG - Intergenic
1067624371 10:47914208-47914230 AAGTGGAAGGAGAGAGAGGTTGG + Intergenic
1067694693 10:48526325-48526347 GAGTTAAAGGAGAGGGAGGGAGG - Intronic
1068352724 10:55869596-55869618 CAGTTTGAGGTGAGAGAGGGAGG - Intergenic
1068846428 10:61680880-61680902 AAGGGGAAGGGGAGAGAAGGAGG + Intronic
1069142181 10:64840229-64840251 CAGTTGAAGGATGGTGAAGGTGG - Intergenic
1069453070 10:68532767-68532789 TACTTGGAGGGGAGAGAAGGAGG - Intergenic
1069484425 10:68812455-68812477 CAGTGAAAGGAGAGACAAGTGGG + Intergenic
1069635580 10:69922885-69922907 CAGGGGAAGGCTAGAGAAGGCGG - Intronic
1069827941 10:71265748-71265770 CAGTGGAAGCACAGGGAAGGTGG - Intronic
1070204481 10:74242952-74242974 CACTTGAAGGATGGTGAAGGTGG - Intronic
1070721657 10:78761257-78761279 CAGGAGAAGGAGCGAGAAGGTGG - Intergenic
1071901913 10:90129633-90129655 CAACTGAAGGAGAAAAAAGGGGG - Intergenic
1072245816 10:93542936-93542958 GATTTGCAGGAGAGGGAAGGAGG + Intergenic
1072331742 10:94360567-94360589 CAGTTGGAGGAGATAGGAGTAGG + Intronic
1072478570 10:95787185-95787207 GAGTTGAGGGAGAAAAAAGGGGG + Intronic
1073051147 10:100668173-100668195 CATCTCCAGGAGAGAGAAGGAGG + Intergenic
1073115377 10:101088775-101088797 AGGTGGGAGGAGAGAGAAGGAGG - Intergenic
1073370320 10:102982520-102982542 AATTTGCAGGAGAGAGAAGCTGG + Intronic
1073667296 10:105547868-105547890 CAGGAGAAAGAGAGAGAAGAGGG - Intergenic
1073728810 10:106267460-106267482 CACTTGAAGGATGGTGAAGGTGG - Intergenic
1074156403 10:110804061-110804083 TTGTTGAAGGAAAGGGAAGGGGG - Intronic
1074185784 10:111098523-111098545 CAGGAGAAGGAGAGAGGATGAGG - Intergenic
1074534891 10:114321657-114321679 CAAAGGAAGGAAAGAGAAGGAGG + Intronic
1074717126 10:116229812-116229834 CAGTAAAAGGAAGGAGAAGGAGG - Intronic
1074768330 10:116716779-116716801 CACTTCATGGAGGGAGAAGGGGG - Intronic
1074960200 10:118437660-118437682 CATTTCAAGGAGAAAGAATGTGG - Intergenic
1075086306 10:119416510-119416532 ACCTTGAAGGAGAGAGAAGCTGG - Intronic
1076281145 10:129247330-129247352 CACTCGCAGGCGAGAGAAGGTGG - Intergenic
1076382197 10:130031664-130031686 CAGGAGAAAGAGAGAGAAGGGGG + Intergenic
1076939082 10:133589771-133589793 CAGGTGAAACACAGAGAAGGCGG - Intergenic
1077531341 11:3097045-3097067 CAGGAGAAGGAGAGGAAAGGGGG + Intronic
1077988397 11:7378557-7378579 CAGTTGATGGAGATGGAAGAGGG + Intronic
1078159767 11:8830637-8830659 CAGAGGAAGGAGAGAAGAGGTGG + Intronic
1078243268 11:9550059-9550081 CAGTAGAGGGAGAGAGACAGAGG - Intergenic
1078481658 11:11681609-11681631 CAGGTGAAAGAGAGAGAAGAAGG + Intergenic
1078646745 11:13147820-13147842 CAGGAGCAAGAGAGAGAAGGAGG + Intergenic
1079121138 11:17686037-17686059 CAGTAGGAGGAGAGAGACCGGGG + Intergenic
1079151000 11:17899004-17899026 CAGGAGCAGGAGAGAGAAGGAGG - Intronic
1079992027 11:27256270-27256292 CAGGAGAAAGAGAGAGAAGTAGG + Intergenic
1080079093 11:28193390-28193412 CAGGAGGAAGAGAGAGAAGGTGG + Intronic
1080101136 11:28460921-28460943 GAGTAGAATGAGAGAGAAAGAGG + Intergenic
1080193402 11:29578794-29578816 CAGTGGAATGAGAGAGGAAGTGG - Intergenic
1080445696 11:32335100-32335122 CTGTTGAAGGATGGTGAAGGTGG + Intergenic
1080574714 11:33587761-33587783 CAGAGGGAGGAGAGAGAAAGTGG + Intronic
1081248602 11:40800979-40801001 AAGTTGAAGGAAAGACAATGGGG - Intronic
1081417868 11:42837335-42837357 CAGGAGAGAGAGAGAGAAGGGGG + Intergenic
1081555590 11:44157758-44157780 CAGGGGAAGGAGAGAGAAAAGGG - Intronic
1081574462 11:44310492-44310514 CAGTGGAAGGAGAGAGGAGGAGG - Intergenic
1081659604 11:44879950-44879972 CAGTTGGAGGAGAGAGAGCTGGG - Intronic
1082173147 11:49030556-49030578 AAGTTTCAGGAGAGAGACGGAGG + Intronic
1082749119 11:56998943-56998965 CAGTTGGAGCACAGAGAAGAAGG + Intergenic
1083301676 11:61742815-61742837 CAGTGGAATGAGAGAGACAGAGG - Intronic
1083474011 11:62904032-62904054 CAGTTAAAGCAGAGAGAGGCCGG - Intergenic
1083673997 11:64315522-64315544 CAGTTGAGGGAGAGAGGGTGGGG + Intronic
1084349017 11:68580593-68580615 TAGTTGAAGAAGAGTGAAGGTGG + Intronic
1084544499 11:69807909-69807931 GAGGGGAAGGGGAGAGAAGGCGG - Intergenic
1084669595 11:70597239-70597261 CAGTGGGTGGAGAGAGAATGAGG - Intronic
1085459313 11:76683719-76683741 CAGTTGAGGGAGTGAGCAGAGGG + Intergenic
1085961921 11:81470852-81470874 GAGTTGGAGGAGAGGAAAGGGGG + Intergenic
1086101865 11:83109095-83109117 CAGTAGAGGTAGAGAGAAGTAGG + Intergenic
1086451384 11:86920417-86920439 CTAATGAAGAAGAGAGAAGGAGG + Intronic
1086588923 11:88488567-88488589 AAGTTGAAGGAGATGGAAGAAGG - Intergenic
1086589416 11:88494566-88494588 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1086692620 11:89805495-89805517 AAGTTTCAGGAGAGAGACGGAGG - Intronic
1086713180 11:90034165-90034187 AAGTTTCAGGAGAGAGACGGAGG + Intronic
1086794749 11:91085581-91085603 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
1087079546 11:94156583-94156605 CAGTTGAATGACAGAGATCGGGG + Intronic
1087194369 11:95290539-95290561 CTGTTGAAGGAGAGGGAAAATGG + Intergenic
1087290391 11:96314579-96314601 GAGTTGAAACAAAGAGAAGGAGG - Intronic
1087564702 11:99839462-99839484 AAGTTGAGGCAGAGGGAAGGAGG + Intronic
1088033383 11:105279798-105279820 TATTTGGAGGGGAGAGAAGGTGG + Intergenic
1089010404 11:115127535-115127557 CAGCTGAAGCACAGAGCAGGAGG - Intergenic
1089148182 11:116345564-116345586 CAGTAGGATGAGAGAGAAGAGGG - Intergenic
1089676176 11:120091407-120091429 GGGTAGAAGGAGAGGGAAGGTGG - Intergenic
1090084366 11:123638322-123638344 CAGCTGAAAGAAAGAGAATGAGG + Exonic
1090571228 11:128048820-128048842 CACTTGAAAGAGAGAGGTGGGGG + Intergenic
1090638749 11:128712213-128712235 CAGGAGCAAGAGAGAGAAGGAGG - Intronic
1090667340 11:128923496-128923518 CTCTGTAAGGAGAGAGAAGGTGG - Intergenic
1090953760 11:131496780-131496802 CATTTGAAGGAGATAGGGGGAGG - Intronic
1090960303 11:131550510-131550532 CAGGAGGAAGAGAGAGAAGGAGG - Intronic
1091549703 12:1528572-1528594 CAGTTGAACCCGGGAGAAGGAGG + Intergenic
1091626383 12:2124078-2124100 CAGTGGAAGGAGAGACCAGAGGG - Intronic
1091752764 12:3032966-3032988 CAGCTGATGGAGGGGGAAGGCGG - Intronic
1092305116 12:7292376-7292398 TAGGAGAAGGAGTGAGAAGGAGG + Intergenic
1092388890 12:8057776-8057798 AAGTGGAAGGAGAAAGAGGGTGG - Intergenic
1093227912 12:16507698-16507720 CAGGAGACAGAGAGAGAAGGGGG + Intronic
1093281644 12:17203476-17203498 CAAGAGAAAGAGAGAGAAGGTGG - Intergenic
1093425036 12:19019163-19019185 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1093592324 12:20917606-20917628 CAGTTGAAGGGTGGTGAAGGTGG + Intergenic
1093647257 12:21601248-21601270 CAGTTGAGGGAGAGGAGAGGAGG - Intronic
1094417772 12:30235525-30235547 AAGATTAAGGAGGGAGAAGGTGG - Intergenic
1095158303 12:38885867-38885889 CAGGAGAGAGAGAGAGAAGGGGG - Intronic
1095936872 12:47693245-47693267 AAGGAGAAGGAGAGAGATGGGGG + Intronic
1096476883 12:51913904-51913926 CAGGTCGAGGATAGAGAAGGGGG + Intronic
1096542098 12:52313656-52313678 CAGTTGAGGGAGTGAGTAGAAGG + Intergenic
1096922595 12:55103577-55103599 CAGGAGAGAGAGAGAGAAGGCGG - Intergenic
1097886718 12:64736306-64736328 CAGTTCTAGGAGAGAGAACCAGG + Intronic
1098847374 12:75554396-75554418 CAGTTGAAGAAGAGATCAGCTGG + Intergenic
1098892038 12:76019056-76019078 GAGGAGAAGGAGAGAGAAGAGGG + Intergenic
1099383097 12:81979857-81979879 CAGGAGAAAGAGAGAGACGGTGG + Intergenic
1099494962 12:83335555-83335577 CAATTGAAGGATGGTGAAGGTGG + Intergenic
1099779044 12:87171228-87171250 GGGAGGAAGGAGAGAGAAGGAGG + Intergenic
1099845696 12:88025420-88025442 AGGTTTAAGGAGAGGGAAGGAGG + Intronic
1099861449 12:88229396-88229418 CAGTTAAATGAGAGAGAAAAAGG - Intergenic
1100759750 12:97794375-97794397 GAGGTGAAGGAAAGAAAAGGTGG + Intergenic
1100775405 12:97967987-97968009 CAGAAGCAGGAGAGACAAGGTGG - Intergenic
1100909841 12:99346793-99346815 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
1100985347 12:100198196-100198218 AAGAGGAATGAGAGAGAAGGTGG + Intergenic
1101429307 12:104613571-104613593 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
1101536613 12:105623677-105623699 CAGTTCAAGGGGAGGAAAGGTGG + Intergenic
1101629830 12:106482496-106482518 CAGGAGGAAGAGAGAGAAGGGGG + Intronic
1102283556 12:111637135-111637157 CACTTGAACCAGAGAGACGGTGG - Intergenic
1102538570 12:113601085-113601107 GAGTATAAGGAGAGAGGAGGGGG + Intergenic
1102727103 12:115075293-115075315 CATTTGAGGGAGAGAGAGGAGGG - Intergenic
1102983712 12:117262397-117262419 GGGTGGAAGGAGAGAGAGGGAGG + Intronic
1103444688 12:120986917-120986939 CAGGAGAGGGAGAGAGAAAGAGG + Intronic
1103453867 12:121049522-121049544 CAGGAGCAAGAGAGAGAAGGGGG - Intergenic
1103554277 12:121756624-121756646 CAGTTTAGGGAGAGAAATGGAGG - Intronic
1103928423 12:124436338-124436360 CAGCTGAGGGAGAGAGGAGGTGG + Intronic
1105298610 13:19113452-19113474 GAGAAGATGGAGAGAGAAGGCGG - Intergenic
1105308478 13:19185719-19185741 CACATGGTGGAGAGAGAAGGGGG - Intronic
1105352915 13:19632106-19632128 CAGTTAAAGGAAAAAGAGGGAGG - Intergenic
1105532132 13:21229809-21229831 TAGTTGAAGGACAGAGAATGTGG - Intergenic
1105814107 13:24017738-24017760 GATTTAAAGGAGAAAGAAGGAGG - Intronic
1106185093 13:27402487-27402509 CAAGTGCAGGAGTGAGAAGGAGG + Intergenic
1106417962 13:29561637-29561659 CTGTTCAAGGAGAGTGATGGAGG + Intronic
1107356339 13:39571550-39571572 TAGTTGAAGGATGGTGAAGGTGG - Intronic
1107376149 13:39806909-39806931 CAGATTAGAGAGAGAGAAGGTGG - Intergenic
1107697621 13:43015850-43015872 CAGTGGAAGGAGAGGGGAGGAGG - Intergenic
1107761800 13:43687606-43687628 AAGTTGCAGGAGAGAGAGGAGGG + Intronic
1107911110 13:45106588-45106610 CACTTGAAGGATGGTGAAGGTGG + Intergenic
1108981927 13:56524680-56524702 CAGGAGAAAGAGAGTGAAGGGGG + Intergenic
1109004992 13:56862350-56862372 CAGATGATGCAGAGGGAAGGAGG - Intergenic
1109339640 13:61039304-61039326 AATATGAAGGAGAGAGGAGGAGG + Intergenic
1109570061 13:64176519-64176541 TATTTGAAGGAGAGAGTAGAAGG + Intergenic
1109685368 13:65812928-65812950 CAATTGAAGGATGGTGAAGGTGG - Intergenic
1109716060 13:66224133-66224155 CATTTGAGAGAGAGAAAAGGAGG - Intergenic
1109930082 13:69205206-69205228 CTGTTGGAGGAGAGAGAGAGAGG + Intergenic
1110412875 13:75222699-75222721 GAGTTCAAGGTGAGATAAGGTGG - Intergenic
1110462345 13:75759080-75759102 CAGGTGAGAGAGAGCGAAGGGGG + Intronic
1110724107 13:78799763-78799785 CAGAAGAAGGAGTGAGATGGCGG + Intergenic
1110830569 13:80025967-80025989 CAGATGAAGGGGAGAAAAAGGGG - Intergenic
1110901710 13:80833301-80833323 CAGGAGAAGGAGAGAGAGTGGGG + Intergenic
1111104556 13:83628849-83628871 CAGGAGAAGGAGAGTGAGGGGGG - Intergenic
1111181824 13:84679058-84679080 CAATTGCAGGAGATGGAAGGTGG + Intergenic
1111327266 13:86715409-86715431 CAGTAGAAGAAAAGAGAAAGGGG + Intergenic
1111515907 13:89330608-89330630 CAGCAGCAAGAGAGAGAAGGAGG + Intergenic
1111640515 13:90963851-90963873 GAGGAGAAGGAGAGAGATGGGGG - Intergenic
1111803529 13:93009074-93009096 GAGGGCAAGGAGAGAGAAGGAGG + Intergenic
1111845829 13:93507286-93507308 GAGAGAAAGGAGAGAGAAGGTGG - Intronic
1112239429 13:97666493-97666515 CAGTAGACTGAGAGAGAAGATGG - Intergenic
1112472658 13:99702900-99702922 GAGGTGAAGGAGAGACAAAGGGG + Intronic
1112736655 13:102428213-102428235 CATTTTAAAGAGAGAGAATGTGG + Intergenic
1113134553 13:107075130-107075152 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1113134870 13:107078188-107078210 CAGGAGAGAGAGAGAGAAGGAGG - Intergenic
1113353640 13:109554892-109554914 CAGTCAAAGGAGAAAGAATGAGG + Intergenic
1113907743 13:113827835-113827857 GTGCTGAAGGGGAGAGAAGGCGG + Intronic
1114004955 14:18302366-18302388 CATCTGAAGGAGGGAGAAAGGGG - Intergenic
1114237356 14:20834626-20834648 CAGTTAAACGAGAGAGAAAAAGG + Intergenic
1114416601 14:22549034-22549056 CAGTTGCAGCAGAGAGATGATGG + Intergenic
1114626798 14:24135816-24135838 CAGGGGAAGAAGAGAGCAGGTGG + Intergenic
1114898580 14:27026488-27026510 CAGAGGAAGGAGAGAGAGAGCGG - Intergenic
1116211702 14:41954613-41954635 CAGGAGCAAGAGAGAGAAGGGGG + Intergenic
1116583258 14:46669729-46669751 CTGTTGAGAGAGAGAGGAGGGGG - Intergenic
1116790905 14:49338925-49338947 CAGTTGAGGGAGGGAAAACGGGG - Intergenic
1117973082 14:61271396-61271418 GAGTTGAAGGCGTGAGAAGGTGG - Intronic
1118033497 14:61840926-61840948 CAATGGAAGGGGAGAGATGGAGG + Intergenic
1118165412 14:63331378-63331400 CATTTGAAGGATGGAGAAAGGGG + Intergenic
1118316643 14:64729895-64729917 AGGGTGAAGGAGAGAGAATGGGG - Intronic
1118538896 14:66801632-66801654 TAGCTCAAGGAGAGAGAGGGGGG - Intronic
1120547166 14:85826387-85826409 CAGTTGAAATAGAGACAAGGAGG + Intergenic
1120577987 14:86207768-86207790 CAGGAGAAAGAGAGCGAAGGGGG + Intergenic
1120972869 14:90223058-90223080 GAGTAGAAAGAGAGAAAAGGGGG + Intergenic
1121120553 14:91373194-91373216 CAGAGGGAGAAGAGAGAAGGTGG - Intronic
1121237799 14:92405662-92405684 CAGGAGAGAGAGAGAGAAGGGGG + Intronic
1121260009 14:92559165-92559187 CAGTCAAGGAAGAGAGAAGGGGG - Intronic
1121408536 14:93733951-93733973 CCCTTGGTGGAGAGAGAAGGAGG - Intronic
1121431554 14:93891720-93891742 CAGGTGAAGGAGAGGAGAGGGGG - Intergenic
1121481226 14:94276538-94276560 CAGGAGCAGGAGAGAGAAAGTGG + Intronic
1121728786 14:96172107-96172129 AAGTGGAAGGGGAGAGAATGTGG - Intergenic
1121799660 14:96764041-96764063 TGGTGGAAGGAGACAGAAGGAGG + Intergenic
1121894969 14:97638301-97638323 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1122249356 14:100427204-100427226 AAGCTGAAGAAGAGAGTAGGAGG - Intronic
1122443695 14:101753628-101753650 CAGGAGAGAGAGAGAGAAGGGGG - Intergenic
1123389413 15:19854600-19854622 CATCTGAAGGAGGGAGAAAGGGG - Intergenic
1124096213 15:26650962-26650984 CAGTTGAAGGATGGTGAAGCCGG - Intronic
1124177384 15:27439083-27439105 CATTAGAAGTAGAGAGGAGGAGG - Intronic
1124445111 15:29723388-29723410 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
1124507442 15:30290484-30290506 CAGTAGAAGAACAGAGAAGTAGG + Intergenic
1124588567 15:31033717-31033739 CAGTTATAGGAGAGAGAGGGTGG - Intronic
1124736113 15:32248175-32248197 CAGTAGAAGAACAGAGAAGTAGG - Intergenic
1124896130 15:33779085-33779107 CTGCTGAACTAGAGAGAAGGAGG - Intronic
1124918267 15:33998007-33998029 AAGTGGAAGGAGAGAGCAGAAGG - Intronic
1125450090 15:39798959-39798981 CACTTGAGGGAGAGAAAAGGGGG + Intergenic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1126551610 15:49937252-49937274 AGGGTGAATGAGAGAGAAGGTGG + Intronic
1126908735 15:53396485-53396507 CAGTAGCAGGAGATAAAAGGAGG - Intergenic
1126984102 15:54282756-54282778 CAATTGAAGGATGGTGAAGGTGG + Intronic
1127225745 15:56926620-56926642 CAGTTCAGAGAGAGAGAAGCTGG + Intronic
1127513055 15:59662493-59662515 CAGTTATAGGAGAGAGATGCTGG - Exonic
1127699367 15:61482892-61482914 TAGTTGAGGGACAGACAAGGGGG + Intergenic
1128549399 15:68588507-68588529 CTGTGGAAGGCGAGGGAAGGTGG + Intronic
1128916156 15:71564441-71564463 CAGTTGAAGAAGATTGGAGGTGG + Intronic
1129167830 15:73788768-73788790 CAATTGGAGTATAGAGAAGGTGG + Intergenic
1129194270 15:73954845-73954867 CAGTTGAAGGGGAGAGGGGATGG - Intergenic
1129229176 15:74187227-74187249 CAGTGGAGGGAGAGAGAGGTAGG - Intronic
1129262857 15:74378528-74378550 CGGGTGAAGGGGAGAGGAGGAGG - Intergenic
1129372828 15:75108816-75108838 CAGCTGAAGGAGAGATGGGGAGG + Intronic
1129424499 15:75454276-75454298 CAGTGGAAGACAAGAGAAGGCGG + Intronic
1129715519 15:77846342-77846364 CAGGAGGAAGAGAGAGAAGGAGG - Intergenic
1130577790 15:85107583-85107605 CAGTGGAAGGAGAGGGGAGGGGG + Intronic
1130688831 15:86062671-86062693 CAGGAGAAGGAAAGAGGAGGAGG - Intergenic
1131000137 15:88933354-88933376 CAGTTGAGGGATGAAGAAGGAGG - Intergenic
1131076554 15:89499014-89499036 CTCTGGAAGGAGCGAGAAGGAGG + Intergenic
1131327320 15:91460741-91460763 TAGATGAAGGGGACAGAAGGTGG + Intergenic
1131515862 15:93076257-93076279 GAGTGGAAAGGGAGAGAAGGTGG - Intronic
1131772702 15:95757598-95757620 AAGATGAAGGAAAGAGAAGAAGG + Intergenic
1132172961 15:99681797-99681819 CAGGTGCAGTAGTGAGAAGGGGG + Intronic
1133046053 16:3088978-3089000 AAGTGGAAGGAGAGGGAAGTGGG + Exonic
1133392492 16:5421472-5421494 CAGTTCCAGTAGAGAGAATGGGG + Intergenic
1133517595 16:6524800-6524822 CAGGTGATGGAGGAAGAAGGTGG - Intronic
1134321411 16:13167672-13167694 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
1134691156 16:16191769-16191791 GAGGGGAAGGAGAGAAAAGGAGG - Intronic
1135191212 16:20356314-20356336 CAGTTGAAGGAGGGTTACGGGGG - Intergenic
1135620297 16:23950000-23950022 CAATGCAAGGAGAGGGAAGGAGG - Intronic
1135884721 16:26295544-26295566 CAGTTGAAGGAGGGGTAGGGTGG + Intergenic
1136382202 16:29900919-29900941 AGGTAGAAGGAGAGAGAAAGGGG + Exonic
1137578750 16:49621010-49621032 CTGCTGAAGGAGAGAGAGGGAGG - Intronic
1137876299 16:51999605-51999627 CATTTCAAGGAGAAGGAAGGGGG - Intergenic
1138482802 16:57315139-57315161 CAGTTTAAGGAGAAAGGTGGGGG - Intergenic
1138833110 16:60400167-60400189 CAGATGAGGGAGAGAGGATGGGG - Intergenic
1138993920 16:62425159-62425181 TAGTTTAAGGAAAGAGAAGAGGG - Intergenic
1139030715 16:62877236-62877258 CAGGAGAAAGAGAGAGAATGGGG - Intergenic
1139044571 16:63040979-63041001 GAGATAGAGGAGAGAGAAGGGGG + Intergenic
1139487475 16:67266137-67266159 CAGTTCAGAGACAGAGAAGGAGG + Exonic
1140066530 16:71615999-71616021 CACTTGAACCAGGGAGAAGGAGG + Intergenic
1140178161 16:72685810-72685832 CACTTGAATGTGAGAGGAGGAGG + Intergenic
1140722926 16:77787728-77787750 CAGTTTAAGGAAAGAGATGCAGG - Intergenic
1141527065 16:84618324-84618346 AAGGAGAAGGAGAGAGAAGAGGG - Intergenic
1141659718 16:85435428-85435450 CAGTCGAGGGAGAGGGAGGGAGG - Intergenic
1141866984 16:86757223-86757245 GACAGGAAGGAGAGAGAAGGGGG - Intergenic
1142048751 16:87944063-87944085 CACTTGAACGCGGGAGAAGGAGG - Intergenic
1142137525 16:88458473-88458495 CAGTTGGAGAAGAAAGGAGGAGG + Intronic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1143201853 17:5118693-5118715 CACTTGAAGGATGGTGAAGGTGG + Intronic
1143364930 17:6400891-6400913 AAGTTGGGGAAGAGAGAAGGTGG - Intronic
1143547933 17:7610741-7610763 CAGGTGAAGGCAAGAGCAGGTGG + Intronic
1143621638 17:8084316-8084338 CAGGTGGAGGAGGGAGAGGGTGG - Intronic
1143679247 17:8464120-8464142 CAGTGGAAGAAGTGAAAAGGGGG - Intronic
1143711756 17:8740603-8740625 CAGAGGTAGGAGAGAGAGGGAGG + Intronic
1143767613 17:9147987-9148009 CAGTTCCAGGAGACACAAGGGGG - Intronic
1143840043 17:9724760-9724782 CAGTTGAAGGAAAAAGAATATGG - Intronic
1144268978 17:13600336-13600358 ATGTTGAAGGAGAGAGTGGGAGG - Intronic
1144358410 17:14468167-14468189 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1144876154 17:18398533-18398555 CAGATAAAGGAGAAACAAGGTGG - Intergenic
1145156074 17:20545887-20545909 CAGATAAAGGAGAAACAAGGTGG + Intergenic
1145296952 17:21599687-21599709 CTCTTGAAGGAGAGAGAGGGTGG - Intergenic
1145357184 17:22169553-22169575 CTGTCAAAGGAGAGACAAGGTGG - Intergenic
1145367008 17:22273215-22273237 CTCTTGAAGGAGAGAGAGAGGGG + Intergenic
1146043994 17:29486884-29486906 CTGTTTAAGCAGAGAGAAGATGG + Intronic
1146175134 17:30661264-30661286 CAGGAGCAGGAGAGAGAATGGGG + Intergenic
1146745352 17:35323892-35323914 CAGATGAAGGATGGTGAAGGTGG + Intergenic
1147035952 17:37680998-37681020 CAGGAGGAGGAGAGAGAAGGGGG - Intergenic
1147037041 17:37689345-37689367 CAGGTGGAGGAGAGAGAAAACGG + Intronic
1147526590 17:41230404-41230426 AAGAGGAAGGAGAGAGAAGAAGG + Intronic
1147729171 17:42586889-42586911 CAGCTATGGGAGAGAGAAGGGGG + Exonic
1147925029 17:43940903-43940925 GAGTCGTAGGAGACAGAAGGTGG + Exonic
1148856714 17:50582971-50582993 CTGTTCAAGGCGAGAGAAGCTGG + Intronic
1149307528 17:55363483-55363505 CAGCTCAAGGAGAGAGAATTTGG + Intergenic
1149430128 17:56591034-56591056 GATTTGAAGGAGAGAAGAGGGGG + Intergenic
1149673036 17:58432576-58432598 TAGATGAGGGAGATAGAAGGTGG + Intronic
1149696728 17:58621975-58621997 CTGTTGAAGGAGGGAGTTGGAGG - Intronic
1150138535 17:62709584-62709606 TAGATGAAGGAGAGGGAAGGAGG + Intronic
1151018486 17:70584747-70584769 CGGTTGAAGGATGGTGAAGGTGG + Intergenic
1151354267 17:73549214-73549236 GAGTAGAAGGAGAGAGGAGTGGG + Intronic
1151799858 17:76372068-76372090 CACTTGAACCAGAGAGACGGAGG + Intronic
1152105043 17:78323923-78323945 CACAGGAAGGAGAGAGAAGAGGG - Intergenic
1152138100 17:78517787-78517809 CAGTTGTAAGAGAGAGAAGCTGG - Intronic
1152400800 17:80065139-80065161 AAGATGAAGGAGGGAGAAGGGGG - Intronic
1152442563 17:80317913-80317935 CACTTGAAGGATGGTGAAGGTGG + Intronic
1152800792 17:82329839-82329861 CAGGAGAGGGAGAGAGGAGGGGG - Intronic
1153139104 18:1952220-1952242 CAGATAAAAGAGAGAGAGGGAGG - Intergenic
1153566418 18:6422729-6422751 AAGGAGAAGGAGAGAGATGGGGG + Intergenic
1153641079 18:7157708-7157730 GAGCAGAGGGAGAGAGAAGGAGG + Intergenic
1153955199 18:10090155-10090177 GGGTTGAAAGAGACAGAAGGAGG + Intergenic
1154000876 18:10481522-10481544 CAGGGGCAGGAGAGAGAATGAGG + Intronic
1154067977 18:11127051-11127073 TAGTTGGAGGAGAGAGAAGGAGG + Intronic
1154139542 18:11810987-11811009 CTGGTGCAGAAGAGAGAAGGGGG - Intronic
1154227639 18:12521924-12521946 CAGGAGAGGGAGAGAGATGGGGG - Intronic
1154532468 18:15361513-15361535 CATCTGAAGGAGGGAGAAAGGGG + Intergenic
1155113539 18:22739951-22739973 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
1155159951 18:23187362-23187384 CAGTTGGAGAAGAGACAAGGAGG + Intronic
1155247090 18:23920828-23920850 CAGCTGAAGCTGAGAGCAGGGGG + Intronic
1155668330 18:28337921-28337943 CAGCAGACAGAGAGAGAAGGGGG + Intergenic
1155901218 18:31393493-31393515 CAGTAGCAGAAGAGAGAAGGGGG + Intronic
1156344412 18:36242716-36242738 TGGTGGCAGGAGAGAGAAGGGGG + Intronic
1156472869 18:37388431-37388453 GAGAAGAAGGAGAGAGAAGGAGG - Intronic
1156886932 18:42145769-42145791 CAGGAGAAAGAGAGAGAGGGTGG + Intergenic
1157024992 18:43831842-43831864 CAGTGGAGAGGGAGAGAAGGGGG - Intergenic
1157214701 18:45773176-45773198 AAGGAGAAGGAGAGGGAAGGAGG - Intergenic
1157332220 18:46712330-46712352 AAGATGAAGGAAGGAGAAGGAGG - Intronic
1157390299 18:47296534-47296556 CAGTGCAAGGAGAGAAATGGAGG + Intergenic
1157514682 18:48302371-48302393 CAGTAAAAAGGGAGAGAAGGTGG - Intronic
1158205261 18:54985656-54985678 CAGTAGAAGGAGAGAGATAATGG - Intergenic
1158249132 18:55467265-55467287 AAGTTCAAGGAGAGGGAAGATGG - Intronic
1158282112 18:55839638-55839660 CAGTTGGTGGGGAGTGAAGGAGG - Intergenic
1158410779 18:57203966-57203988 CAGTGGAAAGAGAGATAAGGGGG + Intergenic
1158482695 18:57836005-57836027 GATCTGAAGGAGAGAGTAGGGGG - Intergenic
1158588903 18:58763233-58763255 CGGGGGAAGGAGAGAGAAAGGGG + Intergenic
1158848591 18:61470890-61470912 TAGTGGAGGGAGAGAGAGGGAGG - Intronic
1158886217 18:61829626-61829648 CGGTTGAAGGGGAGTGAAGAGGG + Intronic
1158904917 18:62002438-62002460 CAGGAGCAAGAGAGAGAAGGGGG + Intergenic
1159597108 18:70393145-70393167 CACTTGAACCTGAGAGAAGGAGG - Intergenic
1160000802 18:75019825-75019847 CAGGAGAGAGAGAGAGAAGGGGG + Intronic
1160072453 18:75640529-75640551 AAGTGGAAGGAAAGAGAAGAAGG - Intergenic
1161845625 19:6710473-6710495 CAGTTGAGAGACAGAGAGGGAGG + Intronic
1161935375 19:7368625-7368647 CAGATGCAGGAGAAAGAGGGAGG + Intronic
1162206949 19:9063361-9063383 CAGTTAAAGAAGAGAGACTGGGG + Intergenic
1162270215 19:9608239-9608261 GAGGGGAAGGAGAGAGATGGTGG + Exonic
1162604442 19:11695748-11695770 CAGTAGATTGAGAGATAAGGTGG - Intergenic
1162826629 19:13256338-13256360 TCTTTGAGGGAGAGAGAAGGAGG + Intronic
1163274217 19:16272856-16272878 TAGGGGGAGGAGAGAGAAGGCGG + Intergenic
1163498484 19:17661363-17661385 CAGTTGAAGGAGAGAGAAGGAGG + Intronic
1164439680 19:28264009-28264031 GTGTTGGAGGAGAGAGATGGTGG - Intergenic
1164480686 19:28609033-28609055 CAGTTGAAAGGGAAACAAGGTGG + Intergenic
1164490188 19:28703808-28703830 AAGAAGAGGGAGAGAGAAGGGGG + Intergenic
1164493087 19:28732142-28732164 AAGGAGAAGGAGAAAGAAGGAGG + Intergenic
1164517942 19:28952322-28952344 CAGTTAAAGGAGTGAGCAGTGGG - Intergenic
1164820024 19:31242811-31242833 CAGTTCTAGGAGAGAGAACCTGG + Intergenic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165150921 19:33759630-33759652 CAGTTGGAGGAGAGGGAATTAGG - Intronic
1165454580 19:35903328-35903350 CTGTGGAAAGAGAAAGAAGGTGG - Intronic
1166067059 19:40366139-40366161 AGGTTGGAGGAGGGAGAAGGGGG + Intronic
1166293503 19:41878006-41878028 GAGGTGAGGAAGAGAGAAGGAGG - Intronic
1166449329 19:42884674-42884696 CAGCTGAGGCAGAGAGAGGGAGG + Intronic
1166453744 19:42922909-42922931 CAGGTGAGGCAGAGAGAGGGAGG + Intronic
1166569642 19:43785301-43785323 CTGGTGAAGGAGAGTGAAGAGGG + Intergenic
1166832106 19:45645142-45645164 CTGCTGAGGGAGAGAAAAGGGGG + Intronic
1167697896 19:51025736-51025758 CAGGTGAGGGAGAGAGGAGAGGG - Intronic
1168236650 19:55067887-55067909 CAGATGAGGGGGAGAGAAAGAGG - Intronic
925116439 2:1382385-1382407 CTATGGAAGCAGAGAGAAGGGGG + Intronic
925202414 2:1979288-1979310 CCGTGGCAGCAGAGAGAAGGAGG + Intronic
925225741 2:2182883-2182905 GAGTTGCAGGGGAGAGAAGGAGG + Intronic
925248030 2:2402187-2402209 CAGGAGCAAGAGAGAGAAGGGGG + Intergenic
925289812 2:2739991-2740013 CACCTGCTGGAGAGAGAAGGAGG + Intergenic
925423082 2:3727248-3727270 CAGCTGAATCAGAGAGAAGGTGG - Intronic
925501085 2:4505632-4505654 CATTTTAAGCAGAAAGAAGGTGG - Intergenic
926003226 2:9351217-9351239 CACTTGAAAAAGAGAGAAGGAGG + Intronic
926127989 2:10283579-10283601 AGGTGAAAGGAGAGAGAAGGTGG - Intergenic
926531382 2:14050523-14050545 GTGTTGGAGGAGAGAGAATGGGG - Intergenic
926638353 2:15207709-15207731 AGGTGGCAGGAGAGAGAAGGGGG - Intronic
926880861 2:17542053-17542075 CAGTTGAAGGCAAGAAAAGCTGG + Intronic
927103605 2:19806482-19806504 AAGTTCAAGGGAAGAGAAGGTGG + Intergenic
927140775 2:20129508-20129530 CAGGTGAGGGAGACAGGAGGCGG - Intergenic
927175243 2:20401387-20401409 CAGATGAAGGGCAGAGAAGATGG - Intergenic
927256530 2:21044580-21044602 CTGGGGGAGGAGAGAGAAGGGGG + Intergenic
927912668 2:26912392-26912414 CAGCTGAAGGATGGAGAAAGCGG + Intronic
928057973 2:28077696-28077718 GAGTTGAGGGAGTGAGAGGGAGG - Intronic
928724939 2:34161525-34161547 CAGATGAAACAGAGAGAATGTGG + Intergenic
928727642 2:34193228-34193250 GATTTGAAGGAGAGAGAATCAGG - Intergenic
928996980 2:37303251-37303273 CACTTGAAGGATGGTGAAGGTGG - Intronic
929612140 2:43278856-43278878 CAGCAGAATGAGAGAAAAGGAGG - Intronic
929647866 2:43647839-43647861 CTGTTGCAGGAAAGAGAAGTTGG - Intronic
929651512 2:43684356-43684378 CAGTTAAAGGAGAGAAAGGAAGG - Intronic
929898422 2:45981460-45981482 AAGCAGAAGGAGAGAGAAGATGG - Intronic
930081909 2:47457472-47457494 CAGGAGCAAGAGAGAGAAGGGGG + Intronic
930542555 2:52725027-52725049 GTGTTGAAGCAGAGAGAAGGAGG - Intergenic
930877211 2:56232565-56232587 GGGTGGAAGGAGAGAGAATGAGG - Intronic
931247770 2:60505586-60505608 GAGCTGGAGGAAAGAGAAGGAGG - Intronic
931496155 2:62809353-62809375 CAGTTGGGGGAGAGGGGAGGAGG - Intronic
931690806 2:64833498-64833520 CAGTTGAGAAAGAGAGAGGGAGG + Intergenic
931917492 2:66973508-66973530 CAGTTTAAGGAGCTAGAAGTAGG - Intergenic
932061005 2:68497441-68497463 CAGGAGAAAGAGAGAGAAGGGGG - Intronic
933271874 2:80241359-80241381 CAGTTGAGGGAGGAAGGAGGAGG + Intronic
933504918 2:83164561-83164583 CAGTTGCAGGAGTTAGAGGGAGG + Intergenic
933771377 2:85746548-85746570 CACTTGAAGGAGACAGGAAGTGG - Intergenic
934096865 2:88614836-88614858 CAGATGTAGGAGTGAGAAAGGGG - Intronic
934614774 2:95764249-95764271 CAGTGGATGGAGGCAGAAGGCGG - Intergenic
934646129 2:96060245-96060267 CAGTGGATGGAGGCAGAAGGCGG + Intergenic
934839532 2:97616328-97616350 CAGTGGATGGAGGCAGAAGGCGG + Intergenic
935505603 2:103898374-103898396 AAGTAGAAAGAGAAAGAAGGAGG + Intergenic
936629504 2:114186519-114186541 CAGGAAAAGGAGAGAGAAGCAGG - Intergenic
937045716 2:118850362-118850384 CATTTGCAGGAGGGAGAAGAGGG - Intergenic
937217391 2:120321336-120321358 GAGAAGAAGGAGGGAGAAGGAGG - Intergenic
937770309 2:125713137-125713159 CAGTCAAAGGTAAGAGAAGGAGG + Intergenic
937905875 2:127052519-127052541 CAGTGGTAGGAGAGAGGATGTGG - Intronic
937955605 2:127420301-127420323 CAGTTGAGGGAGTGAGTGGGTGG - Intronic
938220310 2:129560657-129560679 CAGGGGACAGAGAGAGAAGGAGG - Intergenic
938249020 2:129799348-129799370 CAGTTTCAGGAAAGAGGAGGAGG - Intergenic
938531568 2:132192733-132192755 CATCTGAAGGAGGGAGAAAGGGG + Intronic
938561935 2:132480480-132480502 GGGTTGAAAGAGAGAGAAAGTGG + Intronic
938569228 2:132546886-132546908 CAAATGAAGGGGAGGGAAGGAGG + Intronic
938600046 2:132828435-132828457 CAGGAGCAAGAGAGAGAAGGGGG - Intronic
938676727 2:133643480-133643502 CAGATGAAGGGGCTAGAAGGAGG - Intergenic
938744014 2:134260011-134260033 CAGTGGAAAGAGAGAGGTGGAGG + Intronic
939437450 2:142196737-142196759 AAGTTCAAAGAGAGAGAAGTTGG - Intergenic
939462383 2:142513574-142513596 CAAATGAAGGAGAGATAAAGTGG + Intergenic
939475436 2:142680701-142680723 CAGTTGCAGGAGAAAGGAAGGGG - Intergenic
939687314 2:145215141-145215163 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
939692045 2:145275473-145275495 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
939978423 2:148748177-148748199 CAGAAGAAAGAGAGAGAAGGGGG - Intronic
941204902 2:162559802-162559824 CACTGGAAAGAGAGAGGAGGTGG + Intronic
941231373 2:162915923-162915945 GAGTTGGAGGAGAGGAAAGGGGG - Intergenic
941472323 2:165903317-165903339 CATGTGAAGGAAAGAGAATGAGG + Intronic
941894620 2:170616561-170616583 CATTTAAATCAGAGAGAAGGGGG - Intronic
942020148 2:171859675-171859697 GAGTGGAAGGAAAGAGAATGGGG + Intronic
942308734 2:174634446-174634468 CAGTTCAAGGAAAGAGAATTAGG + Intronic
943041716 2:182812333-182812355 AAGTTGAAGGAGAGAAAACTAGG - Intergenic
944207176 2:197169098-197169120 TGGCTGAAGGAGAGTGAAGGAGG - Intronic
944290085 2:197995285-197995307 GAGTGGAAGAAGAGAAAAGGAGG - Intronic
944601304 2:201306228-201306250 CAAAAGAAAGAGAGAGAAGGGGG + Intronic
944908226 2:204284127-204284149 CAGTGAAAGGAAAGAGAATGAGG + Intergenic
945163670 2:206919843-206919865 CACTTGAAGCTGAGAGATGGAGG - Intergenic
945239736 2:207665551-207665573 CAGTAGCAAGAGAGAGAAAGGGG - Intergenic
945630599 2:212270755-212270777 CTGTTCAGGGAGAGAGAAAGCGG + Intronic
945656529 2:212631240-212631262 CAGGTGGAGGAAAGAGAAGATGG + Intergenic
945808437 2:214518610-214518632 CTGTTGAAGGACAAGGAAGGGGG - Intronic
946112635 2:217433585-217433607 CACTGGAAGGGGAGAAAAGGAGG - Intronic
946677093 2:222171707-222171729 CAGCTGAGGAGGAGAGAAGGAGG - Intergenic
946811546 2:223530836-223530858 CACTTGAAGGATGGTGAAGGTGG - Intergenic
946911365 2:224464503-224464525 CAGGAGAAAGAGAGAGAAGGGGG + Intergenic
946964944 2:225027608-225027630 CAGGAGAAGGAGAGAGAGGGAGG - Intronic
947554015 2:231073094-231073116 AAGGAGAAGGAGAGAGATGGGGG + Intronic
947622611 2:231600452-231600474 CAGTTAATAGAGACAGAAGGAGG + Intergenic
947632639 2:231663866-231663888 CTGCTGAGGGAGAGACAAGGAGG - Intergenic
947936381 2:234008347-234008369 CAGCTGAAAGAAAGAGAAGAGGG - Intronic
948197844 2:236108353-236108375 CAGAGGAAGGAGAGAAAAGAGGG - Intronic
948428248 2:237902074-237902096 CAGGTGGAGGAGGGAGAATGGGG + Intronic
948658728 2:239493347-239493369 CAGAAGGAAGAGAGAGAAGGAGG + Intergenic
948668391 2:239550790-239550812 AAGTTGAAGGTGTTAGAAGGTGG - Intergenic
948693930 2:239723256-239723278 CAGTTCTAGGACAGAGCAGGAGG - Intergenic
949077519 2:242070574-242070596 CAGCTGAAAGAGTGAGAAGCAGG - Intergenic
1169163783 20:3406101-3406123 CAAATAAAGGATAGAGAAGGTGG - Intronic
1169603425 20:7288543-7288565 CAGTTGAAGGACCGGGAAGTAGG + Intergenic
1169838484 20:9907307-9907329 CAGTAGAAGGAAAGATAATGAGG + Intergenic
1169928505 20:10807727-10807749 ATGATGAAGGAGAGAGAAGTTGG - Intergenic
1169928630 20:10808502-10808524 ATGATGAAGGAGAGAGAAGTTGG + Intergenic
1170098744 20:12675455-12675477 CAGTGGGAGGAGAGACAAGCAGG + Intergenic
1170412191 20:16103896-16103918 ATGTTGAAGGATAGAGAAGAGGG + Intergenic
1170942877 20:20863581-20863603 CTGTGGAAGCAGAGAGAGGGCGG + Intergenic
1171148014 20:22802734-22802756 GAAGAGAAGGAGAGAGAAGGAGG + Intergenic
1171169275 20:23001157-23001179 CACTTGTAGGAGGCAGAAGGTGG + Intergenic
1171823417 20:29875136-29875158 CGATTGAAAGACAGAGAAGGGGG - Intergenic
1172283367 20:33723624-33723646 CAGCTGAAGGAGAAGGAAAGAGG + Intergenic
1172361624 20:34316624-34316646 CCGTAGGAGCAGAGAGAAGGAGG + Intergenic
1172970752 20:38871501-38871523 GGGAAGAAGGAGAGAGAAGGGGG + Intronic
1173436115 20:43033719-43033741 CAGATGAAGCACAGAGAAGATGG + Intronic
1174293004 20:49522136-49522158 CAGCTGAAGCAGAGTGAGGGAGG - Intronic
1174662534 20:52226673-52226695 AAGAAGAAGGAGAGAGAAGGTGG - Intergenic
1174891332 20:54398381-54398403 CAGTTGAAGGGTGGTGAAGGTGG - Intergenic
1174925126 20:54750788-54750810 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1175027998 20:55923340-55923362 CAGGTGAGAGAGAGTGAAGGAGG - Intergenic
1175759493 20:61551471-61551493 CAATTGAATGAGAGAGATGAGGG - Intronic
1176735845 21:10546346-10546368 AAGGAGAAGGAGAGAGATGGGGG - Intronic
1176764892 21:13006697-13006719 CATCTGAAGGAGGGAGAAAGGGG - Intergenic
1177402625 21:20624996-20625018 CAGGAGAAAGAGAGTGAAGGGGG + Intergenic
1177515541 21:22147128-22147150 CAGGAGAAAGAGAGAGAAGGTGG - Intergenic
1177967348 21:27744478-27744500 CGGTTGAAGGATGGTGAAGGTGG + Intergenic
1178267911 21:31161381-31161403 CAGTCACAGGAGAGAGGAGGCGG + Intronic
1178694185 21:34779040-34779062 CAGGTGATGTAGGGAGAAGGTGG + Intergenic
1178865294 21:36321724-36321746 GAGAGGAAGGAGAGAGAAGTGGG - Intronic
1179239838 21:39580336-39580358 CAGGTAGAAGAGAGAGAAGGGGG - Intronic
1179598733 21:42461395-42461417 CAGGAGGAAGAGAGAGAAGGAGG - Intergenic
1179929397 21:44557510-44557532 CAGAGGAAGGAGAGAGGGGGAGG + Intronic
1179969755 21:44828583-44828605 CAGAAGAAGAAGAGAGAATGAGG + Intergenic
1180429467 22:15233156-15233178 CATCTGAAGGAGGGAGAAAGGGG - Intergenic
1180817911 22:18803983-18804005 CAGGTGAAGGACAGAGCAGAGGG + Intergenic
1180862007 22:19088933-19088955 CAGGTGAATGAGTGAGCAGGAGG + Intronic
1181204125 22:21238438-21238460 CAGGTGAAGGACAGAGCAGAGGG + Intergenic
1181520328 22:23444838-23444860 AAGGAGAAGGAGAGAGATGGGGG + Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182522875 22:30894030-30894052 CAGGCAAAGGAGAGGGAAGGAGG + Intronic
1183025462 22:35062826-35062848 CAGGAGAGAGAGAGAGAAGGGGG + Intergenic
1183059328 22:35326638-35326660 CACTAGGAGGAGAGAGAGGGTGG + Intronic
1183252094 22:36737420-36737442 GAGGAGAAGCAGAGAGAAGGAGG + Intergenic
1183361941 22:37387389-37387411 GAAGTGAGGGAGAGAGAAGGGGG - Intronic
1183533306 22:38376524-38376546 AAGGAGAAGGAGAGAGATGGGGG + Intronic
1183692449 22:39398383-39398405 GAGTTGGAGGAGAGAGATGAAGG - Intergenic
1183832624 22:40426469-40426491 CAGTTGAGTAGGAGAGAAGGAGG - Intronic
1184452165 22:44589720-44589742 CAGAAGGAGGAGAGAGGAGGAGG + Intergenic
1185199688 22:49494092-49494114 CAGTTGGAGCAGAGAGCAGAGGG + Intronic
1203222795 22_KI270731v1_random:56977-56999 CAGGTGAAGGACAGAGCAGAGGG - Intergenic
1203268034 22_KI270734v1_random:29836-29858 CAGGTGAAGGACAGAGCAGAGGG + Intergenic
949347769 3:3092782-3092804 CAGTAGAAGGAAAAAGAAGAAGG - Intronic
949506216 3:4730514-4730536 CTGTTGAAGGAGAGACAAAATGG + Intronic
949535355 3:4991446-4991468 CAGTTGAACCCGAGAGGAGGAGG + Intergenic
949596245 3:5550323-5550345 CAGTTCAAGGAGTGAGTAAGGGG - Intergenic
949634205 3:5965253-5965275 CAGATGAGAGAGAGAGAAAGAGG - Intergenic
950584707 3:13883908-13883930 CAGATGGTGGGGAGAGAAGGGGG + Intergenic
950994915 3:17484899-17484921 CAGTTCAAGTAGAGTGAATGTGG - Intronic
951656073 3:25009851-25009873 CAGTGGAAGGGGAGACAAGCAGG + Intergenic
951762445 3:26161473-26161495 CATGTGAAGGAGAAAGAAGTTGG + Intergenic
953377921 3:42444472-42444494 CAGGAGAGAGAGAGAGAAGGGGG - Intergenic
953784793 3:45903265-45903287 CAATTGCAGTAGAGAGAAGCAGG - Intronic
955817506 3:62861043-62861065 CCATAGAAGGAGAGAGGAGGAGG - Intronic
956301267 3:67775114-67775136 CACTTGAAGGATGGCGAAGGTGG + Intergenic
956659684 3:71584563-71584585 CAGTTGAAGGAGAGCGGGGTGGG + Intergenic
956765346 3:72480122-72480144 CAGGAGAAAGAGAGAGAGGGGGG - Intergenic
957022140 3:75138718-75138740 CAGTTGAAAGGGAAACAAGGTGG + Intergenic
957150062 3:76475347-76475369 AAGTGGAAGGAGAGACAATGAGG + Intronic
957282798 3:78175093-78175115 GAGGTGAAGGAGAGGGAAGAAGG - Intergenic
957597512 3:82287324-82287346 TAGTTGAAGAAGAAAGAAGGTGG + Intergenic
958630099 3:96673224-96673246 GAGGTGGAGGAGAGAGATGGAGG - Intergenic
958630113 3:96673338-96673360 GAGATGGAGGAGAGAGATGGAGG - Intergenic
959858742 3:111192375-111192397 CAGTTCAAAGAAAGAGAAGTTGG + Intronic
960913563 3:122674548-122674570 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
961196674 3:125007813-125007835 CAGTTTAAGAATAGAGAAGCTGG - Intronic
961207059 3:125092668-125092690 CTGATGAAGGAGAAAGATGGAGG + Intronic
961456031 3:127024440-127024462 CAGTGGAGGGAGGGAGAGGGAGG + Intronic
961598913 3:128043456-128043478 CAATTGAAGGATGGTGAAGGTGG + Intergenic
961901764 3:130219902-130219924 CAGTTAAGGAAGAGAGAGGGGGG + Intergenic
962305017 3:134278285-134278307 CACCTCAAGGAGAGAGAAGTGGG - Intergenic
962435975 3:135367024-135367046 CAGTTGGGGGTGAAAGAAGGAGG + Intergenic
962474366 3:135742423-135742445 CACTTGAAGGATGGTGAAGGTGG - Intergenic
962845259 3:139268257-139268279 CAATTCAAGAAGTGAGAAGGAGG - Intronic
962873654 3:139519383-139519405 GAGCTGAAGGAGAGGAAAGGAGG + Intronic
962904537 3:139789857-139789879 CAGTGGAAGGTAAGAAAAGGAGG + Intergenic
962921409 3:139953648-139953670 CACCTGAGGGAGAGGGAAGGGGG - Intronic
963184179 3:142394478-142394500 AAGTTGAAGTAGAGTGAAGGAGG - Intronic
963469403 3:145719775-145719797 GAGAGGAAGGAGAGAAAAGGAGG + Intergenic
963596892 3:147339392-147339414 CATTTTTAGGAGAGAGAAGGGGG + Intergenic
963667600 3:148208509-148208531 CAGTTGATGGAGAGAGTATGGGG + Intergenic
963719118 3:148839646-148839668 CAATTGAAGGAGTGACCAGGAGG + Intronic
964666388 3:159178780-159178802 CAGTTGTAGGAGAAAACAGGAGG + Intronic
964906844 3:161727169-161727191 AAGTTGAGGGATAGTGAAGGAGG + Intergenic
965121615 3:164565631-164565653 TAGTTTAAGGAGAGACAAAGTGG - Intergenic
965619195 3:170625543-170625565 CAGAAGAAAGAGAGAGAAGGGGG - Intronic
965773740 3:172207861-172207883 CACTTGAATCCGAGAGAAGGAGG + Intronic
965807126 3:172553183-172553205 CAGGAGCAAGAGAGAGAAGGGGG + Intergenic
965872142 3:173276448-173276470 CAGTTAAATGAGAGAGAAAAAGG - Intergenic
966076249 3:175938687-175938709 CAGTAGGAAGAGAGAGAAAGAGG - Intergenic
966960939 3:184938058-184938080 CAAATGGAGGAGAGAGAAGAAGG + Intronic
967645173 3:191914104-191914126 CAGGAGAAAGAGAGAGAAAGGGG - Intergenic
967834195 3:193947138-193947160 CAGGTGTAGGAGAGAAGAGGAGG - Intergenic
967939256 3:194753815-194753837 GAGTAGAATGAGTGAGAAGGGGG - Intergenic
967988547 3:195114232-195114254 CACGTGGAGGAGCGAGAAGGGGG - Intronic
968764277 4:2459917-2459939 GTGTTGAAGCAGAGGGAAGGTGG + Intronic
969116026 4:4871390-4871412 CACTTGGAGGAGAAAGATGGGGG + Intergenic
969128589 4:4973770-4973792 CAGGGGAAAGAGAGAGACGGGGG - Intergenic
969333182 4:6491754-6491776 CAGGAGAGAGAGAGAGAAGGGGG - Intronic
969499212 4:7542972-7542994 CATTTGCAGGAGGGAGAAGATGG + Intronic
970163769 4:13215064-13215086 CAGGTTGAGGATAGAGAAGGGGG - Intergenic
970166861 4:13247755-13247777 AAGTAGAAGGAGAAAGAAGATGG - Intergenic
970326648 4:14931927-14931949 TATTTGAAGGAGAGAGAGAGGGG - Intergenic
970525472 4:16927709-16927731 CAGTCAAAGGAGAGAGAGTGGGG - Intergenic
970738904 4:19209581-19209603 CAGGAGAAAGAGAGTGAAGGGGG + Intergenic
970870317 4:20809595-20809617 CAGTTGATGGCCAGAAAAGGTGG - Intronic
970984016 4:22134478-22134500 CAGGAGAGAGAGAGAGAAGGAGG - Intergenic
971005663 4:22371746-22371768 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
971197076 4:24479716-24479738 CTGTTGAGAGAGAGAGAGGGAGG - Intergenic
972102099 4:35432691-35432713 TGGTGGCAGGAGAGAGAAGGTGG - Intergenic
972169214 4:36324278-36324300 GAGTTGAAGGAGGAAGGAGGAGG - Intronic
972360615 4:38322715-38322737 CTGATGAAGGAGGGAGAGGGAGG - Intergenic
972610307 4:40650183-40650205 CAGTAGAAGGGCAAAGAAGGTGG - Intergenic
972683897 4:41333085-41333107 CAGAAGGAAGAGAGAGAAGGGGG + Intergenic
972829758 4:42801820-42801842 CAGGAGAAAGAGCGAGAAGGGGG + Intergenic
972878713 4:43396828-43396850 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
972933607 4:44104624-44104646 CAGTGGAAGGAGAGTGTGGGTGG + Intergenic
973933419 4:55817092-55817114 CAGGAGGAAGAGAGAGAAGGAGG - Intergenic
974482420 4:62462862-62462884 CAGAAGAAAGAGAGTGAAGGTGG - Intergenic
975230475 4:71926819-71926841 CAGATGAAGCACAGTGAAGGAGG - Intergenic
975948334 4:79736701-79736723 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
976254449 4:83085398-83085420 TAGCTGAAGCAGAGAGAAGGTGG - Intergenic
976300106 4:83508767-83508789 CAGTTAAATGAGAGAGAAAAAGG + Intronic
977289241 4:95145439-95145461 AAGTTCCAGGAGAAAGAAGGAGG - Intronic
977374213 4:96180571-96180593 CAGGGGAAGGAGAGAGAGGAGGG - Intergenic
977770585 4:100853211-100853233 GAGGTGAAGGAGAGAAAATGGGG - Intronic
977856441 4:101900615-101900637 CAGATGAAGGAAAGAGAGGACGG + Intronic
978489699 4:109299903-109299925 TAGTAGAAGGACAGAGAAGAAGG - Intronic
978591432 4:110328813-110328835 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
978889391 4:113805084-113805106 CAGAAGAAAGAGAGTGAAGGAGG + Intergenic
979002419 4:115240851-115240873 CTGTTGAAGGAGTTAGAAGTGGG + Intergenic
979025185 4:115562668-115562690 CAGCTGAAGGAGAAAAAATGTGG + Intergenic
979351366 4:119647844-119647866 GAGATGAGGGAGAGAGAAAGAGG + Intergenic
979441704 4:120757924-120757946 CAGATCAAGGAGAGAGATGGAGG - Intronic
980150393 4:129040094-129040116 CGGTTGAAAGAGAGAGAAAAAGG - Intronic
980303096 4:131019582-131019604 CAGTTGAAATAGAAAGAATGAGG - Intergenic
980668736 4:135974557-135974579 CAGCTGAGGGAGAGAGGATGTGG - Intergenic
981724107 4:147829937-147829959 GAGTGCCAGGAGAGAGAAGGTGG + Intronic
981912283 4:149995495-149995517 CAGGTGAGAGAGAGGGAAGGAGG + Intergenic
981917539 4:150051424-150051446 CAGTGGAGGTAGAGAGAAGTGGG - Intergenic
982509252 4:156260720-156260742 CAGCTGAAGGAGAGAGTTGGGGG - Intergenic
982550116 4:156787190-156787212 CAGTTGAGAGAGAGAGAAGGAGG + Intronic
982968319 4:161945172-161945194 CAGTGGAAGAAGAGAGCAGGAGG - Intronic
983855550 4:172639628-172639650 GAGCTGGAGGAGAGAGAAGAAGG - Intronic
984352424 4:178612876-178612898 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
985425814 4:189828983-189829005 CAGGTAAGGGAGAGAGAAGCAGG - Intergenic
985785401 5:1890613-1890635 CAGGAGAAGGAGAGTGAAAGGGG - Intergenic
985936991 5:3104988-3105010 CAGAAGACGGACAGAGAAGGAGG + Intergenic
986372817 5:7097831-7097853 CAATTGGAGGAGAGAGAAGAGGG + Intergenic
987037066 5:14029722-14029744 CAGTAGAAGGGTAGAGTAGGAGG - Intergenic
987502319 5:18729214-18729236 CAGTTGAAAGAGGCAGAAGGAGG - Intergenic
987777402 5:22385849-22385871 CAGGAGAAAGGGAGAGAAGGTGG + Intronic
988440248 5:31225585-31225607 CAGGAGGAAGAGAGAGAAGGGGG + Intronic
988683761 5:33507870-33507892 ATGTAGAAGAAGAGAGAAGGAGG - Intergenic
988788230 5:34583788-34583810 GAGAGGAAGGAAAGAGAAGGAGG + Intergenic
988913770 5:35872029-35872051 GAGTAGAAGGAGGGAGCAGGTGG - Intronic
989226138 5:39031364-39031386 CAGTTGAAGGTGAGAGATCAGGG - Intronic
989363318 5:40627832-40627854 CAACTAAGGGAGAGAGAAGGTGG - Intergenic
989608852 5:43272522-43272544 CAGGGGAAGGAAGGAGAAGGAGG + Intronic
989662751 5:43816781-43816803 CAGGAGGATGAGAGAGAAGGAGG - Intergenic
989969469 5:50505095-50505117 AAGCTGAAGAAGAGAGAAGTTGG + Intergenic
990047381 5:51450043-51450065 CCCTTGAAGGTGAGAGAAGAGGG - Intergenic
990240391 5:53811095-53811117 CAGGAGTAAGAGAGAGAAGGGGG + Intergenic
990667882 5:58094241-58094263 AAGTTTGAGGAAAGAGAAGGTGG - Intergenic
991431762 5:66555456-66555478 CAGGTGGAGGAGAAAGACGGGGG - Intergenic
991522354 5:67515195-67515217 CAGGAGAAAGAGAGAGATGGGGG + Intergenic
992255463 5:74916551-74916573 GGCCTGAAGGAGAGAGAAGGGGG - Intergenic
992409980 5:76495750-76495772 CAGGAGAGGGAGAGAGAAGGGGG + Intronic
992441446 5:76800970-76800992 CAGGGTAAGGAGAGAGAATGAGG + Intergenic
992583208 5:78203507-78203529 CAGTTCAAGGTGAGATATGGGGG + Intronic
992679124 5:79135691-79135713 AAATTGAAGGACAGAGAAGTGGG - Intronic
992846442 5:80753832-80753854 CAGTGGAAGGAGAAAGAACAGGG + Intronic
992877965 5:81076479-81076501 GAGTTGGAGAAGAGAGAAAGAGG + Intronic
992877987 5:81076606-81076628 GAGTTGGAGAAGAGAGAAAGAGG + Intronic
993048659 5:82898680-82898702 AAGTTGAAGGAGAGAAAGGAAGG + Intergenic
993275505 5:85851418-85851440 CAGGAAAAAGAGAGAGAAGGAGG + Intergenic
993404893 5:87499519-87499541 CACTTGAAGGACAGTGAAAGTGG - Intergenic
993437415 5:87915086-87915108 CAAGAGAAAGAGAGAGAAGGAGG + Intergenic
993523480 5:88934816-88934838 GAGATGGAGGAGAGAGATGGTGG - Intergenic
994067990 5:95564856-95564878 CCTTTCAGGGAGAGAGAAGGAGG - Intronic
994135989 5:96287240-96287262 CAGTGGAAGGAAAGGGGAGGGGG - Intergenic
994232147 5:97318875-97318897 AAGGTGAAGGGGAGAGATGGGGG + Intergenic
994248493 5:97509211-97509233 TGGGGGAAGGAGAGAGAAGGAGG + Intergenic
994367913 5:98936649-98936671 CAAGTGCAGGAGTGAGAAGGAGG + Intergenic
994438153 5:99764072-99764094 CTGTGGAAGGAGAGAGAAGCAGG - Intergenic
995726533 5:115186723-115186745 GGGTTGATGGAGAGAGAAGTGGG - Intergenic
995727402 5:115195806-115195828 TAGTTGGGGGAGAGAGAAAGTGG - Intergenic
996245915 5:121263630-121263652 CAGTTGGAGGAGAGTGCGGGTGG + Intergenic
996250144 5:121319178-121319200 CAATTGAAGGATGGTGAAGGTGG - Intergenic
996660409 5:125996234-125996256 GGGATGAGGGAGAGAGAAGGGGG - Intergenic
996916884 5:128722778-128722800 CAGTTGAAAGACAAAGATGGGGG - Intronic
997068852 5:130594912-130594934 CAGGAGCAAGAGAGAGAAGGTGG - Intergenic
997273302 5:132560472-132560494 AGATTTAAGGAGAGAGAAGGTGG - Intronic
997373759 5:133382454-133382476 CAGTTTAAAGTGAGAGGAGGAGG - Intronic
997524512 5:134543823-134543845 AGGTTGAAGGAGAGGGAGGGAGG + Intronic
997577243 5:134990000-134990022 CAGGAGAGGGAGAGAGATGGAGG + Intronic
997779755 5:136644726-136644748 CAGCAGTAAGAGAGAGAAGGGGG - Intergenic
998391279 5:141788514-141788536 GAGAAGTAGGAGAGAGAAGGAGG - Intergenic
998941088 5:147282678-147282700 CAGTTAAAAGAGAGACAAAGAGG + Intronic
999111075 5:149121789-149121811 CACTTCATGTAGAGAGAAGGAGG - Intergenic
999354122 5:150907613-150907635 GGGTTGGAGGAGAGAGAGGGAGG + Intergenic
999413419 5:151372927-151372949 CAGATGAAGAAGACAGAATGTGG + Intergenic
1000913057 5:167045500-167045522 AAGGTGAAGGAGAGAGAAGAGGG - Intergenic
1001494023 5:172175330-172175352 CAGGGGAAGCAGAGAGAAAGGGG + Intronic
1001945655 5:175775392-175775414 GAGGGGAAGGAGAGTGAAGGAGG - Intergenic
1002048182 5:176553732-176553754 CAGTTGGGGGAGGGAGATGGTGG - Intronic
1002167249 5:177355853-177355875 CAGCTGAAGGAGAAAGAGGGAGG + Intergenic
1002379304 5:178814230-178814252 CCGTTGAGAGGGAGAGAAGGGGG - Intergenic
1002394549 5:178942542-178942564 CAGAAGGAGGAGAGAGAATGGGG + Intronic
1002493142 5:179593928-179593950 CAGTGGAGGGACAGTGAAGGTGG - Intronic
1002775900 6:327322-327344 CAGCTGGAGGAGAGTGAAGGTGG + Intronic
1002910704 6:1489037-1489059 CAGTAGGAAGAGAGTGAAGGGGG - Intergenic
1002952475 6:1828340-1828362 CAGAAGAAGCAGAGAGAAGAAGG + Intronic
1002961894 6:1923207-1923229 CACTTGAAGGATGGTGAAGGTGG - Intronic
1003091652 6:3108997-3109019 TCTTTGTAGGAGAGAGAAGGTGG - Intronic
1003596161 6:7475994-7476016 CAGGTGAAGGAGAGATATTGGGG + Intergenic
1003652985 6:7978357-7978379 CAGGAGCAAGAGAGAGAAGGGGG - Intronic
1004290060 6:14358589-14358611 GAGTTGAAGGATGGAGAAAGAGG - Intergenic
1004317538 6:14603245-14603267 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
1004347057 6:14858202-14858224 CAATTCAGGGGGAGAGAAGGAGG - Intergenic
1004495209 6:16156436-16156458 CAATGGCAGGAGAGTGAAGGTGG + Intergenic
1004961405 6:20793219-20793241 AAGTTGAAGTAGACAGAAAGGGG - Intronic
1005026438 6:21466983-21467005 CAGTTGAAGGATGATGAAGGTGG - Intergenic
1005901091 6:30216791-30216813 CAGATGAAGGAGGGAGAAGGAGG - Intergenic
1006199716 6:32277162-32277184 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
1007048226 6:38798984-38799006 GAGCTATAGGAGAGAGAAGGTGG - Intronic
1007088419 6:39166903-39166925 CCGAGGAAGGGGAGAGAAGGAGG - Intergenic
1007167468 6:39839025-39839047 CTGTGGGAGGAGAGAGAGGGGGG - Intronic
1007701033 6:43766757-43766779 GAATTGAAGGAGAGAGAATTGGG - Intergenic
1008125476 6:47663623-47663645 CAGTGTAAGGGGAGAGCAGGAGG + Intronic
1008248095 6:49203823-49203845 CAATTGAAGGATAGTAAAGGTGG - Intergenic
1009272801 6:61636383-61636405 CATTTCAAGAACAGAGAAGGTGG - Intergenic
1009602569 6:65821264-65821286 TAGGAGAAAGAGAGAGAAGGGGG + Intergenic
1009618130 6:66037595-66037617 CAGTTGCAAAAGAGAGAAGTGGG + Intergenic
1009634084 6:66241374-66241396 CAGATGAAATAAAGAGAAGGGGG + Intergenic
1009822438 6:68820630-68820652 CGGTGGAGGGAGAGAGAAGCGGG - Intronic
1009993132 6:70868477-70868499 TAGTTGGAGAAGAGAGAATGTGG - Intronic
1010690810 6:78909388-78909410 CATTTCAGGGAAAGAGAAGGAGG - Intronic
1010840782 6:80647443-80647465 GAGTTGTAGAAGACAGAAGGAGG + Intergenic
1011587873 6:88946369-88946391 CAGGAGAGGGAGAGAGACGGAGG - Intronic
1011748209 6:90428482-90428504 ATGTTGGGGGAGAGAGAAGGGGG - Intergenic
1011786320 6:90849231-90849253 CAGAAGAAGGATGGAGAAGGAGG + Intergenic
1011806645 6:91079882-91079904 CAGGTGAAAGAGAGAGGAGATGG - Intergenic
1011849019 6:91602975-91602997 CAGGAGCATGAGAGAGAAGGGGG + Intergenic
1011867933 6:91854415-91854437 GAGTGGCAGGAGAGAGAATGAGG - Intergenic
1012019527 6:93900139-93900161 GAGTGGAAGGAGAAAGGAGGAGG + Intergenic
1012200623 6:96402007-96402029 CAGGAGAGAGAGAGAGAAGGGGG - Intergenic
1012511715 6:100010134-100010156 CAGGAGAAAGAGAGTGAAGGGGG + Intergenic
1012551199 6:100465887-100465909 CAGATGAGAGAAAGAGAAGGCGG - Intergenic
1013393778 6:109713730-109713752 CAGTGGAGGGAGGGAGAGGGTGG + Intronic
1013514334 6:110872181-110872203 AATTTGAAGGAGAGATGAGGAGG + Intronic
1013650541 6:112190269-112190291 CAGGCTAAAGAGAGAGAAGGCGG - Intronic
1013729754 6:113151189-113151211 GGGCAGAAGGAGAGAGAAGGTGG + Intergenic
1013855989 6:114572584-114572606 CAGGAGAAAGAGAGTGAAGGAGG - Intergenic
1014288701 6:119533599-119533621 CAGATGAAGGAGGGAGAGGGAGG + Intergenic
1014305464 6:119735823-119735845 CAGTTGCAGGATAGAGAAATGGG + Intergenic
1014466077 6:121758801-121758823 CAGGAGAAAGAGAGAGAAGGGGG - Intergenic
1014677137 6:124380486-124380508 CAGTTGAAGGAGACAGATCCTGG - Intronic
1015001766 6:128225867-128225889 CATTTGACAGAGAGAGAAAGAGG + Intronic
1015058055 6:128928549-128928571 CCGTTCAAGGAGAGGGAAGGAGG + Intronic
1015283621 6:131460153-131460175 CAGTTGAAGGAGGGCATAGGAGG - Intergenic
1015288565 6:131511498-131511520 CACTTGAAGGATGGAGAATGTGG - Intergenic
1015845208 6:137513237-137513259 CAGTTCAAGGAAAAAGAGGGGGG + Intergenic
1016267071 6:142245071-142245093 CACCTGAAGGAGAGAGATGAAGG - Intergenic
1016292253 6:142538546-142538568 CAGTTAAATGAGAGAGAAAAAGG - Intergenic
1016476636 6:144434412-144434434 AAGATGAAGGAGAGAGAAGCTGG + Intronic
1017104169 6:150872462-150872484 GAGGAGAGGGAGAGAGAAGGGGG + Intronic
1017306755 6:152927139-152927161 CAGTAGAGGGAGGGAGCAGGTGG + Intergenic
1017753090 6:157507009-157507031 CAGTTGAAACTGAGAGTAGGGGG - Intronic
1018007271 6:159634081-159634103 CATTTGAAGAAGAAAGAATGCGG - Intergenic
1018026774 6:159813041-159813063 CAACTGAAGAACAGAGAAGGGGG + Intronic
1018431915 6:163729515-163729537 CAGAGGAAGGTGAGAGTAGGTGG + Intergenic
1018465271 6:164038242-164038264 CAGTGGGAGGACAGAGATGGGGG + Intergenic
1018700096 6:166419591-166419613 CAGGTGCAGCAGAGAGAATGGGG + Intronic
1018896425 6:168021422-168021444 CATTTGAAGCAGAGAGAAAGGGG - Intronic
1019335764 7:481754-481776 CAGGTGAAGCACAGAGAAGGTGG - Intergenic
1019531766 7:1506748-1506770 GAGCAGGAGGAGAGAGAAGGGGG - Intergenic
1019590914 7:1831390-1831412 AAGGAGAAGGAGAGAGATGGGGG - Intronic
1019816366 7:3204045-3204067 CAGGAGGAGGAGAGAGGAGGAGG + Intergenic
1019964114 7:4484839-4484861 GAGAGGAAGGAGAGAGAAAGGGG + Intergenic
1019975052 7:4574459-4574481 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
1020031883 7:4939116-4939138 CACTTGAACTAGAGAGATGGAGG + Intronic
1020068560 7:5209989-5210011 CAGTTGAACCTGAGAGACGGAGG - Intronic
1020890884 7:13876563-13876585 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1021339169 7:19442022-19442044 CAGTTGAAGCATAGGGAAGTTGG + Intergenic
1021776378 7:24059038-24059060 CAGCGAAAGGAGAGAGAAGGAGG + Intergenic
1021833508 7:24643078-24643100 CAGTTGTAGAAGAGAGATGTGGG + Intronic
1022094315 7:27129629-27129651 AAGGAGGAGGAGAGAGAAGGTGG + Intronic
1022289069 7:28983936-28983958 CAGGAGGAGGAGAGAGAGGGAGG + Intergenic
1022622198 7:31996135-31996157 AAGTTGAGAGAGAGAGAAGCTGG + Intronic
1022724257 7:32966412-32966434 AAGCTGATGGAGAGAAAAGGAGG + Intronic
1022857519 7:34329946-34329968 AGGCTGAAGGAGAGAGAAGAAGG + Intergenic
1023015581 7:35966993-35967015 CAGTTAAAGGAGAGAAAATTAGG + Intergenic
1023155836 7:37251023-37251045 CAGTGGAAGGACACAGAAGTAGG + Intronic
1023663154 7:42491315-42491337 CATTTGAAGGAGTGAGCAGCAGG - Intergenic
1023734624 7:43223919-43223941 CAATCAAAGGAGAGAGAAGGTGG - Intronic
1023813677 7:43931780-43931802 CAGTTGAACCAGAGAGACGGAGG - Intronic
1023984602 7:45087587-45087609 GAGTTGAAGCTGAAAGAAGGGGG + Intronic
1024012332 7:45279700-45279722 CAGACGAAGGTGATAGAAGGTGG + Intergenic
1024065351 7:45727690-45727712 CAGTTAAAGGAGAGAAAATTAGG - Intergenic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024303464 7:47905629-47905651 CAATTGAAGGAATGGGAAGGTGG - Intronic
1024485232 7:49910140-49910162 GAGTTCAGGGAGGGAGAAGGGGG + Intronic
1024683434 7:51718237-51718259 CAGTAGAAGGTGAGTGACGGAGG - Intergenic
1024928480 7:54643465-54643487 CATTTGAATGAGTGAGTAGGAGG + Intergenic
1025735131 7:64140263-64140285 CAGTTGAAGGATATTGAAGCAGG + Intronic
1026004635 7:66591569-66591591 CAGTTGAGGGAGAGAGAAGGGGG - Intergenic
1026013648 7:66655291-66655313 CAGTTTAGGGAGAGAGAGGGAGG + Intronic
1026025652 7:66741452-66741474 CAGTTTAGGGAGAGAGAGGGAGG + Intronic
1026105458 7:67417433-67417455 CAGAAGAAGGAGAGAGAAATGGG + Intergenic
1026302794 7:69112377-69112399 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1026399905 7:69999136-69999158 CACTTGAAGGAAAGAGAGGGTGG + Intronic
1026434452 7:70383183-70383205 CAGTAGAAGATGAGAGGAGGAGG + Intronic
1026661676 7:72308278-72308300 CATTTGAACCAGGGAGAAGGAGG + Intronic
1027244187 7:76355107-76355129 ATGTTGAAGAAGAGAGAAAGTGG - Intronic
1027831163 7:83179492-83179514 GAGATGAAGTAGAGAGAAGTAGG + Intergenic
1027879794 7:83820162-83820184 CAGGAGAAAGAGAGAAAAGGAGG - Intergenic
1028110087 7:86929864-86929886 CAGGAGGAAGAGAGAGAAGGGGG - Intronic
1028308424 7:89296760-89296782 CAGTTTAGGGAGAGGAAAGGTGG - Intronic
1028688209 7:93617727-93617749 CACTGGAATGAGAGAGTAGGTGG + Intronic
1028706185 7:93849599-93849621 CAGTTTTAGGAGAGTGAAGAGGG + Intronic
1028724504 7:94071669-94071691 CCCTTGAAGGAGAGAAATGGAGG + Intergenic
1028809637 7:95069428-95069450 AAATGGAAGGAGAGGGAAGGAGG + Intronic
1028874226 7:95802405-95802427 CAGTTGAATCAGAGAGAAGTTGG + Intronic
1028938402 7:96491393-96491415 CAGTTCATTGATAGAGAAGGAGG - Intronic
1029174503 7:98655038-98655060 CAGGAGGAAGAGAGAGAAGGGGG - Intergenic
1029174719 7:98656446-98656468 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1029189331 7:98760714-98760736 CAGTTGGAGAGGACAGAAGGAGG + Intergenic
1029241431 7:99166010-99166032 CAGAAGGAAGAGAGAGAAGGGGG - Intergenic
1029788850 7:102821267-102821289 GAGTTGGATCAGAGAGAAGGGGG - Intronic
1029944668 7:104519518-104519540 CAGTTTAGGGAGGGAGAAGAAGG + Intronic
1030130252 7:106193787-106193809 CAGTGGAAGGAGGGAGTCGGTGG - Intergenic
1030364920 7:108634814-108634836 CAGATGAATGAGACAAAAGGTGG + Intergenic
1030961816 7:115932327-115932349 GAGGTGAGAGAGAGAGAAGGGGG - Intergenic
1031196053 7:118615328-118615350 CAGTGGAAGTAAAGAGAAGAGGG + Intergenic
1031488519 7:122359427-122359449 GAGTTGAAGGAGACAGAAAATGG - Intronic
1032333611 7:131003720-131003742 CATTTGAAGGTGGGAGAAGAAGG + Intergenic
1032433219 7:131879863-131879885 CAGATGAAGGATGGAGCAGGGGG + Intergenic
1032473071 7:132192384-132192406 CAGTTGAAGAAGGAAGAAGGAGG + Intronic
1032616599 7:133479352-133479374 CTGGTGAAGGAGGGAGAAGGAGG - Intronic
1033035954 7:137876590-137876612 CAGTTACAGGAGAGAGTAGGTGG - Exonic
1033078990 7:138277003-138277025 CAGGAGAAAGAGAGAGAAGGGGG + Intergenic
1033112504 7:138593704-138593726 AAGGAAAAGGAGAGAGAAGGGGG + Intergenic
1033241595 7:139684243-139684265 GAGAAGAAGGAGAGAGATGGGGG - Intronic
1033313235 7:140277618-140277640 AGGTTGCAGGAGAGAGGAGGGGG + Intergenic
1033393851 7:140955462-140955484 AAGAAGAAGGAGAGAGATGGAGG - Intergenic
1034100971 7:148450157-148450179 CACTTGAACCCGAGAGAAGGAGG - Intergenic
1034407281 7:150913468-150913490 CAGAGGAAGGAGAGAGAGAGGGG - Intergenic
1034416108 7:150965007-150965029 CCAGTGAATGAGAGAGAAGGAGG + Intronic
1034551708 7:151824848-151824870 CAGAAGAAAGAGAGGGAAGGGGG - Intronic
1035083498 7:156236747-156236769 CAGATGTTGGAGAGAGCAGGTGG + Intergenic
1035385611 7:158470642-158470664 CAAGTGCAGTAGAGAGAAGGCGG - Intronic
1035479067 7:159167560-159167582 CAGGGGAAGGAGGGAGAGGGTGG - Intergenic
1035536074 8:392459-392481 CAGCTGAAAGAGTGAGAAGCAGG - Intergenic
1035791756 8:2312695-2312717 CAGTGGAAAGAGAGAGACAGGGG + Intergenic
1035801049 8:2409010-2409032 CAGTGGAAAGAGAGAGACAGGGG - Intergenic
1035898052 8:3426484-3426506 CAATTGAGGGAAAGAGCAGGTGG - Intronic
1035971259 8:4251852-4251874 GAGATGGAGGAGAGAGAGGGTGG + Intronic
1036116784 8:5967697-5967719 CACTTGAAGGAGAAAGAGGAGGG - Intergenic
1036496058 8:9270998-9271020 CAAGGGAAGGAGAGAGAATGTGG + Intergenic
1036612138 8:10359648-10359670 CAGTGGAAGGAGTGAAAAGAAGG - Intronic
1037061027 8:14509821-14509843 AAGTGGCAGGAGAGAGAAGAGGG + Intronic
1037069527 8:14626380-14626402 AAGTAGGAGGAGAGAGAAAGTGG - Intronic
1037565991 8:20118965-20118987 CAGGGGGAAGAGAGAGAAGGGGG - Intergenic
1038273914 8:26103406-26103428 CACTTGAAGCAGGGAGATGGAGG - Intergenic
1038787806 8:30636767-30636789 CACTTGAACGAGAGAGTTGGAGG + Intronic
1038870063 8:31484028-31484050 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1038875063 8:31539547-31539569 CAGTTGAACAACAGAGTAGGTGG + Intergenic
1039087608 8:33795447-33795469 CAGTTGCAGTACTGAGAAGGTGG + Intergenic
1039823511 8:41154389-41154411 CAGATGGAGCAGAGAGAAGGAGG + Intergenic
1039826049 8:41174941-41174963 CACTTGTAGGAGAGATAAGAGGG + Intergenic
1040058076 8:43078615-43078637 GAGGTGAGGGAGAGAGATGGTGG - Intronic
1040413499 8:47178424-47178446 ATTCTGAAGGAGAGAGAAGGAGG - Intergenic
1041296488 8:56362479-56362501 CAGTTCAAGGAGAGAGGGGATGG - Intergenic
1041969037 8:63715635-63715657 TAGTTGAAGGACAGAGGAAGAGG + Intergenic
1042157961 8:65865229-65865251 CAGTTAAATGAGAGAGAAAAAGG - Intergenic
1042310507 8:67374700-67374722 CAGGTGGACCAGAGAGAAGGTGG - Intergenic
1042610407 8:70593526-70593548 CAGGTGAAGGAAAGTGAAGAGGG - Intronic
1042680688 8:71380109-71380131 CAATCCAAGGAGAGAGAAGTGGG - Intergenic
1042972489 8:74425477-74425499 AAGTGGAAGGAGACAGAAAGTGG + Intronic
1043358252 8:79439323-79439345 CAGGAGGAGGAGAGAGAAGGGGG - Intergenic
1043566923 8:81558931-81558953 CAGGGGAAGGACAGAGAAGGAGG + Intergenic
1043740611 8:83806645-83806667 CAGTTGAAAGAGAGAGTGTGGGG + Intergenic
1043951287 8:86311751-86311773 CAATTGAAGGACAGTGAATGTGG - Intronic
1044473263 8:92597155-92597177 CACTGGAAGGAGAGGGAGGGAGG + Intergenic
1044770899 8:95632819-95632841 CACATGCAAGAGAGAGAAGGGGG + Intergenic
1045208778 8:100072508-100072530 TTGTTGAAGGAGGGAGAATGAGG + Intronic
1045394749 8:101749800-101749822 CAGATGAAAGAGAGAGATAGAGG - Intronic
1045461300 8:102427848-102427870 CAGCAGAAGTAGAGAGAATGGGG - Intergenic
1046571755 8:115974935-115974957 GAGAAGAAGGAGAGAGATGGAGG + Intergenic
1046612888 8:116445254-116445276 CAGGAGGAGGAGAGAGGAGGGGG + Intergenic
1046735021 8:117767706-117767728 CAGAAGGAAGAGAGAGAAGGGGG - Intergenic
1046885809 8:119365797-119365819 GAGTTTAAAGAGAGAGAAAGTGG - Intergenic
1046889377 8:119404484-119404506 CAGTTTAAGGAGAGATAATGAGG - Intergenic
1047210235 8:122834768-122834790 CAGTTAAATGAGAGAGAAAAAGG + Intronic
1047338112 8:123955276-123955298 CAGTGGGTGGGGAGAGAAGGAGG + Intronic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1047937870 8:129799741-129799763 CAGGAGGAAGAGAGAGAAGGAGG + Intergenic
1048327505 8:133450698-133450720 AAGATGCAGCAGAGAGAAGGAGG - Intergenic
1048406540 8:134128313-134128335 CCAATTAAGGAGAGAGAAGGCGG - Intergenic
1048410643 8:134168841-134168863 CAGTTGAAGGATAAGGAGGGTGG + Intergenic
1048977552 8:139681457-139681479 CAGGGGAAGGAGTGAGAAGCTGG + Intronic
1049064435 8:140301805-140301827 CAGCCGAAGGAGAGAGCTGGGGG - Intronic
1049739866 8:144233464-144233486 GAGCTGCGGGAGAGAGAAGGTGG - Intronic
1049739875 8:144233501-144233523 GAGCTGCGGGAGAGAGAAGGTGG - Intronic
1049785124 8:144446942-144446964 CACTTGAACCTGAGAGAAGGCGG - Intergenic
1050766493 9:9141216-9141238 CGGGGGGAGGAGAGAGAAGGGGG - Intronic
1051270562 9:15351173-15351195 CTGTTGGAGGAGAGAGGATGTGG + Intergenic
1051919928 9:22252555-22252577 CAGGAGAAAGAGAGAGATGGGGG + Intergenic
1052269575 9:26613651-26613673 CAGCTGAGGCAGAGAGAAAGAGG + Intergenic
1052822189 9:33146206-33146228 CAGCGGAAGGAGTGAGAAGGAGG - Intronic
1053193739 9:36098037-36098059 CAGGAGGAGGAGAGAGAAGAGGG + Intronic
1053381738 9:37654650-37654672 CAATTGAGGGTGAGAGAAGGAGG + Intronic
1053493492 9:38529901-38529923 GAGTTGAGAGAAAGAGAAGGTGG - Intergenic
1053710178 9:40799229-40799251 CATCTGAAGGAGGGAGAAAGGGG + Intergenic
1055150677 9:72995258-72995280 GAGGAGAAGGAGAGAGATGGGGG - Intronic
1055530129 9:77176287-77176309 TAGCTGAATGAGAGAGAAGCAGG + Intergenic
1055708456 9:79033610-79033632 CACTTGAAGGATGGTGAAGGTGG + Intergenic
1055712681 9:79081599-79081621 CAGATGAAACAGAGAGAAGGGGG + Intergenic
1056467337 9:86870568-86870590 AAGTTGAGAGAGAGAGACGGTGG - Intergenic
1056672247 9:88640181-88640203 CAGCTGGAGGAGAGAGGAGGAGG + Intergenic
1057196022 9:93115934-93115956 AGGGTGAAGGAGAGTGAAGGAGG + Intergenic
1057480343 9:95440481-95440503 GAGGGGAAGGAGGGAGAAGGGGG + Intergenic
1057882575 9:98803621-98803643 TATTGGAAGGAGAGAGCAGGGGG + Intergenic
1058317466 9:103586585-103586607 CAGTTGAAAGATGGTGAAGGCGG - Intergenic
1058321444 9:103636420-103636442 CAGTTGAAGGGTAGTGAATGTGG - Intergenic
1058760383 9:108125202-108125224 CAGTAGAAGGAGGAAAAAGGGGG + Intergenic
1058809860 9:108629214-108629236 CAGTTCAAGGTGAGAGTTGGTGG - Intergenic
1059612794 9:115917157-115917179 CAGGAGCATGAGAGAGAAGGGGG + Intergenic
1059855525 9:118393070-118393092 CAGGAGCAAGAGAGAGAAGGAGG - Intergenic
1060057896 9:120431537-120431559 AAGTTGAAGGAGAAACAATGAGG - Intronic
1060257582 9:122046281-122046303 CAGGAGGAAGAGAGAGAAGGAGG - Intronic
1061182383 9:129032425-129032447 CACTTGAAGGATAGCAAAGGAGG - Intergenic
1061216798 9:129226288-129226310 GAGGAGGAGGAGAGAGAAGGGGG + Intergenic
1061552793 9:131347748-131347770 CATTTGAAGGTGAGTGAAGGAGG + Intergenic
1062362757 9:136195450-136195472 CAGTGGACGGGGAGGGAAGGTGG - Intergenic
1185830196 X:3294303-3294325 AAGGAGAAGGAGAAAGAAGGAGG - Intergenic
1186619535 X:11224304-11224326 AAGATGAAGAAGAGAGAAGAAGG + Intronic
1186669647 X:11756793-11756815 GATGTGAAGGAGAGGGAAGGAGG - Intergenic
1186671597 X:11772516-11772538 CAGTTCCAGTAGAGATAAGGAGG + Intronic
1186733984 X:12441450-12441472 TATTTGAAGGAGAGAGAAGGGGG - Intronic
1187025682 X:15433649-15433671 AAGAGGAAGGAGAAAGAAGGAGG + Intronic
1187204896 X:17172404-17172426 CAGGAGAAAGAGAGTGAAGGGGG - Intergenic
1187704273 X:21993902-21993924 CAGGAGGAGGAGAGGGAAGGAGG - Intronic
1187967388 X:24625757-24625779 TAGTAAAAAGAGAGAGAAGGGGG + Intronic
1188007377 X:25024744-25024766 AAGCTGAAGAAGAGAGAAAGAGG - Intergenic
1188305935 X:28559750-28559772 CAGGTGAGAGAGAGAGAAGGAGG + Intergenic
1188495495 X:30779478-30779500 CAGTTGAAGGATGGTGAAGGTGG - Intergenic
1189244524 X:39553182-39553204 CATTTGAAGCACAGAGAAGTTGG - Intergenic
1189289757 X:39876822-39876844 CTGTTGATGCAGAGAGAAGCAGG + Intergenic
1189318281 X:40071110-40071132 GAGATGAAAGAAAGAGAAGGTGG - Exonic
1189628964 X:42931603-42931625 CAGAAGAAAGAGAGAGAAGGGGG + Intergenic
1189676722 X:43468144-43468166 CAGTTGAAGGATGGTAAAGGTGG + Intergenic
1189730149 X:44011707-44011729 AAGTGGAAGGAGGCAGAAGGAGG - Intergenic
1189783351 X:44537040-44537062 CAGTAGAAGGAAAGTGAAAGGGG - Intronic
1190048010 X:47128002-47128024 CAGGAGAAGGAGAGAGAGGTAGG + Intergenic
1190236070 X:48616748-48616770 CAGTTGATGTAAAGGGAAGGAGG + Intergenic
1190437040 X:50435814-50435836 CAGTGGTAGGTGAGAGCAGGAGG + Intronic
1190522141 X:51291194-51291216 CAGTAGAAAGAGAGAAAAGAAGG - Intergenic
1191024138 X:55895171-55895193 AAGATGAAGGAGAGAGCAAGGGG + Intergenic
1191666270 X:63705967-63705989 GAGATGCAGGGGAGAGAAGGAGG + Intronic
1191739273 X:64419250-64419272 GAGTGGAAGGTGAGAGGAGGGGG - Intergenic
1192182403 X:68924421-68924443 AAGTAGGAGGAGAGGGAAGGAGG - Intergenic
1192194464 X:69019022-69019044 CAGAGGAAGGAGGGAGAGGGAGG + Intergenic
1192282644 X:69701702-69701724 CAGTTAAACGAGAGAGAAAAAGG + Intronic
1192562030 X:72133535-72133557 AAGGTGAAGGAGAGGGAAGGAGG - Intergenic
1192797070 X:74432812-74432834 AAGTTCAGGGAGAGAGAAAGGGG - Intronic
1193143401 X:78053523-78053545 CAGGTGAAAGAGAGTGAAAGGGG + Intergenic
1193486081 X:82086686-82086708 CAGTTGAAGAATGGTGAAGGTGG + Intergenic
1193558284 X:82984299-82984321 CAGGAGGAAGAGAGAGAAGGGGG + Intergenic
1193804884 X:85983381-85983403 CAGTGAAAGGAAGGAGAAGGTGG + Intronic
1193965269 X:87976837-87976859 CAGGAGAAAGAGAGAGAAGTGGG - Intergenic
1194064049 X:89240505-89240527 CAGGAGCAAGAGAGAGAAGGGGG - Intergenic
1194132142 X:90094612-90094634 GAGTTGAGGGAGAGACTAGGTGG + Intergenic
1194305246 X:92237682-92237704 GAGGTTAAGGAGAGATAAGGGGG - Intronic
1194409954 X:93544999-93545021 CAGGGGAGAGAGAGAGAAGGGGG + Intergenic
1194568309 X:95521494-95521516 CAGTAGAAAGGGAGAAAAGGAGG + Intergenic
1196242067 X:113353428-113353450 CAGTTGGGGGAGCCAGAAGGGGG - Intergenic
1196577374 X:117335176-117335198 CAGAGGGAGGAGGGAGAAGGGGG - Intergenic
1196804995 X:119575312-119575334 CAGATGAAGCAGGGAGAAGGGGG + Intronic
1197289510 X:124638163-124638185 CATCTGGAAGAGAGAGAAGGAGG + Intronic
1197725628 X:129774475-129774497 AAATTGCAGGAGGGAGAAGGCGG - Intergenic
1197906080 X:131427276-131427298 CAGGAGGAGGAGAGAGGAGGAGG - Intergenic
1198187408 X:134266951-134266973 CAGGAGAAGGGGAGAGAAGTGGG + Intergenic
1198677421 X:139145688-139145710 CAGTTGGAGAGGAGGGAAGGTGG - Intronic
1199109280 X:143910932-143910954 CAAGGGAAAGAGAGAGAAGGAGG + Intergenic
1199201885 X:145100404-145100426 CATTTGACAGAGAGAGAGGGAGG - Intergenic
1199249582 X:145644626-145644648 GAGGGGAAGGAGAGAGAGGGAGG + Intergenic
1199412068 X:147535742-147535764 ATGTTTAAGGAGAGAGTAGGGGG - Intergenic
1199743962 X:150760283-150760305 CAGGTGAGGCAGAGAGAAGGAGG + Intronic
1199854486 X:151749484-151749506 CAGTTATAGGAGAGAGGCGGGGG - Intergenic
1200539887 Y:4445015-4445037 CAATTGAAGAAGAGAGTATGGGG - Intergenic
1200718224 Y:6574604-6574626 CAGGAGCAAGAGAGAGAAGGGGG - Intergenic
1200803822 Y:7411652-7411674 CATGTCAAGGAGAGACAAGGTGG - Intergenic
1201146208 Y:11066849-11066871 GAGAAGAGGGAGAGAGAAGGTGG + Intergenic
1201550494 Y:15212315-15212337 AAGTTGCAAGAGAGAGAGGGAGG + Intergenic
1202594133 Y:26519504-26519526 CAGGAGAAGGAGAAAGATGGGGG - Intergenic