ID: 1163502736

View in Genome Browser
Species Human (GRCh38)
Location 19:17686426-17686448
Sequence ACTGGAGGAGGTTCCGACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163502736_1163502741 -4 Left 1163502736 19:17686426-17686448 CCCACGTCGGAACCTCCTCCAGT No data
Right 1163502741 19:17686445-17686467 CAGTGCCACCTTTAAGAGCCCGG No data
1163502736_1163502744 10 Left 1163502736 19:17686426-17686448 CCCACGTCGGAACCTCCTCCAGT No data
Right 1163502744 19:17686459-17686481 AGAGCCCGGCTACTTAGAGCAGG No data
1163502736_1163502746 12 Left 1163502736 19:17686426-17686448 CCCACGTCGGAACCTCCTCCAGT No data
Right 1163502746 19:17686461-17686483 AGCCCGGCTACTTAGAGCAGGGG No data
1163502736_1163502753 28 Left 1163502736 19:17686426-17686448 CCCACGTCGGAACCTCCTCCAGT No data
Right 1163502753 19:17686477-17686499 GCAGGGGGAGAGGTCAGTAGGGG No data
1163502736_1163502747 13 Left 1163502736 19:17686426-17686448 CCCACGTCGGAACCTCCTCCAGT No data
Right 1163502747 19:17686462-17686484 GCCCGGCTACTTAGAGCAGGGGG No data
1163502736_1163502750 18 Left 1163502736 19:17686426-17686448 CCCACGTCGGAACCTCCTCCAGT No data
Right 1163502750 19:17686467-17686489 GCTACTTAGAGCAGGGGGAGAGG No data
1163502736_1163502751 26 Left 1163502736 19:17686426-17686448 CCCACGTCGGAACCTCCTCCAGT No data
Right 1163502751 19:17686475-17686497 GAGCAGGGGGAGAGGTCAGTAGG No data
1163502736_1163502752 27 Left 1163502736 19:17686426-17686448 CCCACGTCGGAACCTCCTCCAGT No data
Right 1163502752 19:17686476-17686498 AGCAGGGGGAGAGGTCAGTAGGG No data
1163502736_1163502754 29 Left 1163502736 19:17686426-17686448 CCCACGTCGGAACCTCCTCCAGT No data
Right 1163502754 19:17686478-17686500 CAGGGGGAGAGGTCAGTAGGGGG No data
1163502736_1163502745 11 Left 1163502736 19:17686426-17686448 CCCACGTCGGAACCTCCTCCAGT No data
Right 1163502745 19:17686460-17686482 GAGCCCGGCTACTTAGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163502736 Original CRISPR ACTGGAGGAGGTTCCGACGT GGG (reversed) Intronic