ID: 1163503235

View in Genome Browser
Species Human (GRCh38)
Location 19:17688247-17688269
Sequence GGGTCGGGCTCAGCGGCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163503230_1163503235 -7 Left 1163503230 19:17688231-17688253 CCGGGCCGGCTCTGTCGGGTCGG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1163503235 19:17688247-17688269 GGGTCGGGCTCAGCGGCCGCTGG 0: 1
1: 0
2: 1
3: 11
4: 183
1163503227_1163503235 3 Left 1163503227 19:17688221-17688243 CCGGAGGCGGCCGGGCCGGCTCT 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1163503235 19:17688247-17688269 GGGTCGGGCTCAGCGGCCGCTGG 0: 1
1: 0
2: 1
3: 11
4: 183
1163503221_1163503235 20 Left 1163503221 19:17688204-17688226 CCGAGCTCGCAGGTGGGCCGGAG 0: 1
1: 0
2: 0
3: 9
4: 127
Right 1163503235 19:17688247-17688269 GGGTCGGGCTCAGCGGCCGCTGG 0: 1
1: 0
2: 1
3: 11
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163503235 Original CRISPR GGGTCGGGCTCAGCGGCCGC TGG Intronic
900399593 1:2467533-2467555 GGCTGGGGCTCAGGGGACGCCGG + Intronic
901059668 1:6466177-6466199 GGGGCGGGCCCTGCGGGCGCGGG - Exonic
901251618 1:7784025-7784047 GGGTGGCCCTCAGCGGCCTCAGG - Intergenic
901678525 1:10900416-10900438 GGGTGGGGCTCTGGGGCCCCGGG - Intergenic
903788390 1:25875895-25875917 GGGTCGGGGAGGGCGGCCGCAGG + Intergenic
904782989 1:32964536-32964558 GGCCCGGGCGCGGCGGCCGCGGG + Exonic
904822899 1:33256680-33256702 GGAGCGGGCCCAGCGGCGGCGGG + Intronic
905414406 1:37794444-37794466 GGGGCGGGCTCGGCCTCCGCGGG - Exonic
916676356 1:167066896-167066918 GGCGCGGGCTGAGGGGCCGCCGG + Intronic
921909080 1:220528284-220528306 GGATCGGGCGCCGCCGCCGCTGG + Intronic
922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG + Exonic
922757131 1:228102798-228102820 GGGTCGGGCTGGGCGGGAGCGGG - Intronic
923372613 1:233328128-233328150 GGCTCGGCCTCGGCGGGCGCGGG + Exonic
923591927 1:235327600-235327622 GGCTCGGACACAGCGGCTGCGGG + Intronic
924807656 1:247373914-247373936 GGGTGGGCCTGAGCGGCTGCGGG - Intergenic
1062969001 10:1631415-1631437 GGCTCGGGCTCAGGGCCAGCTGG + Intronic
1072970044 10:100009765-100009787 GGGTCGCGGTCCGGGGCCGCGGG - Intronic
1074772333 10:116742269-116742291 GGGCCGGGGTCAGCAGCAGCGGG - Intronic
1074877220 10:117622787-117622809 GGGACTGGCTCAGAGGCCCCTGG - Intergenic
1075689592 10:124386396-124386418 GGGTCAGGCGCAGCTGCTGCAGG + Intergenic
1075782783 10:125027551-125027573 AGGTAGGGCTCGGCGGCCACGGG + Exonic
1077250692 11:1559390-1559412 GGGGTGGGCTCAGAGGCCACAGG + Intronic
1077305570 11:1867317-1867339 GGGTGGGGTGCAGCGGCCTCTGG - Intronic
1081851470 11:46277883-46277905 GGGATGGGCTCAGGGGCCCCGGG - Exonic
1082767998 11:57183839-57183861 GGGTCAGGCTCAGATGCCACTGG - Intronic
1082986213 11:59172812-59172834 GGGGCGGGGTCAGGGGCGGCTGG - Intronic
1083448525 11:62727054-62727076 GGATCTGGCGCAGCGGCTGCAGG - Exonic
1087014516 11:93542917-93542939 GGGGCGGACTCAGGGGCCGGGGG - Intronic
1089511156 11:118998127-118998149 GGGTCAGGGTCAGAGGCCGCCGG + Exonic
1091234227 11:134009058-134009080 GGGAAGGGCTCAGAGGCCGCTGG - Intergenic
1091606086 12:1952724-1952746 GGGTCTGGCTCAGCCACCACAGG - Exonic
1095097071 12:38154602-38154624 GGGCCTGGCTCAGGGGCTGCCGG - Intergenic
1095098245 12:38159213-38159235 GGGCCAGGCTCAGGGGCTGCCGG - Intergenic
1096748959 12:53746774-53746796 GCGAAGGGCTCAGCGGCCACAGG - Intergenic
1098262658 12:68686788-68686810 TGGTCAGGCAAAGCGGCCGCAGG + Exonic
1101803409 12:108042419-108042441 GGGGCGGGGTCAGCTGCCTCTGG + Intergenic
1102937640 12:116911136-116911158 GAGGCGGGCTCGGCGGCCGGAGG + Exonic
1103459990 12:121096096-121096118 GGGGCGGGCCCAGCGACCTCGGG + Intergenic
1103800302 12:123533583-123533605 CGGGCGCGCTCAGCGGGCGCTGG + Exonic
1104784103 12:131438698-131438720 TGGTCGGGCTCAGTGGCCTAAGG - Intergenic
1105418380 13:20232264-20232286 AGGTCGGGCTCGGGCGCCGCCGG + Exonic
1106340202 13:28820107-28820129 AGGTTGGGCTGGGCGGCCGCCGG + Intergenic
1108220950 13:48233101-48233123 GGGGCGGGGCCAGCGGCCGGGGG - Intergenic
1109506220 13:63306148-63306170 GGATCTGGCACAGGGGCCGCAGG - Intergenic
1112334708 13:98504763-98504785 GGGTAGGGATCAGCGACCTCAGG - Intronic
1112771821 13:102800577-102800599 CGGCCGGGCTCCGAGGCCGCCGG - Intronic
1119004007 14:70907891-70907913 GGGCCGCGCTCAGCGGGGGCTGG + Exonic
1122162276 14:99793251-99793273 GGGGCGGCCTCGGCGGCCGCGGG - Intronic
1122736523 14:103847054-103847076 TGCTCGGCCTCCGCGGCCGCGGG - Intronic
1122980852 14:105191818-105191840 GGGGCGGGCCCAGCAGCAGCAGG + Intergenic
1123041088 14:105490505-105490527 GGGCCCGGCTCAGCGGCGCCCGG + Intronic
1128264116 15:66253071-66253093 TGCTGGGGCTTAGCGGCCGCGGG + Intronic
1132419344 15:101652222-101652244 GGGTGGGGCTGAGTGGCAGCAGG - Intronic
1132831466 16:1930288-1930310 GGGTTGGGTTCAGGGGCAGCGGG - Intergenic
1132877980 16:2148702-2148724 GGGTCGGGCTCGGCGGGCGCGGG + Exonic
1133127829 16:3657653-3657675 GGGCCTGGCTCAGCACCCGCAGG - Intronic
1133136633 16:3717142-3717164 GGGTCGGGCGGAGCGGCTGCGGG - Intronic
1135480122 16:22814875-22814897 GGGGCGGGCACGGCGGCGGCGGG - Exonic
1138106858 16:54291596-54291618 GGGAGGGGCTCAGAGGCCGGTGG - Intergenic
1138536599 16:57663639-57663661 GGGCCGGGCTCGGGGGCCACAGG - Exonic
1141902729 16:87003192-87003214 GGGTCTGGCTGAGAGGCCCCAGG + Intergenic
1142356738 16:89604938-89604960 GGGTGGGGAGCAGCGGCTGCGGG + Intergenic
1142509847 17:386290-386312 GGCCCGGGCTCTGCGGCCACAGG - Intergenic
1143697178 17:8629890-8629912 GGGTCGGACTCCGCCGGCGCCGG - Intronic
1144340799 17:14309256-14309278 GTCTCCGGCTCAGCGGCCCCCGG - Intronic
1144724849 17:17496625-17496647 GCCGCGGGCTCGGCGGCCGCAGG + Intergenic
1144872429 17:18379437-18379459 GGGTGGGGCTCAGGTGCCCCAGG - Intronic
1146219871 17:31008819-31008841 GGGCCGGGCTGGGCAGCCGCCGG + Intergenic
1147184291 17:38705296-38705318 GGCTCGGGCTACGCGGCGGCGGG + Intergenic
1147264363 17:39225846-39225868 GGGGCGGGCGCAGCGGACGGCGG - Exonic
1148124841 17:45231280-45231302 GGGTGGGGCTCGGCTGCCGCAGG + Intronic
1148225436 17:45895494-45895516 TGGACGGACTCGGCGGCCGCTGG + Intronic
1150373467 17:64661791-64661813 GGGCCGGGCTGGGCAGCCGCGGG - Intronic
1151748833 17:76025585-76025607 GGGTGGGGCTCAGGTGCCCCAGG + Intronic
1151946895 17:77324456-77324478 GGGTCGGGCTTAGCCCCTGCAGG + Intronic
1151974974 17:77479655-77479677 GGGGCCGGCTCAGCTGCAGCTGG - Intronic
1152516610 17:80828532-80828554 GGGTCGGGGTTAGGGGCCTCAGG - Intronic
1152697740 17:81805048-81805070 GGGGCGGGATCAGGGGCCACAGG - Intronic
1152761088 17:82107349-82107371 GGGTGGGGCACAGATGCCGCGGG + Intronic
1152797268 17:82314568-82314590 GGGTCGGCCTCGGAGGCCTCGGG + Intergenic
1154070791 18:11149636-11149658 GGGGCGGGCTCCGCGCGCGCAGG - Intergenic
1155035501 18:22021861-22021883 GGGTGGGCCCCAGCGGCTGCCGG + Intergenic
1157492794 18:48136148-48136170 CAGGCGGGCGCAGCGGCCGCGGG - Intronic
1160663356 19:311778-311800 GGGAGGGGCTCAGGGTCCGCAGG - Intronic
1160697074 19:489836-489858 GAGTCGTCCTCAGAGGCCGCCGG + Intronic
1160878198 19:1307580-1307602 GGCCCGGGTTCAGCCGCCGCCGG + Intergenic
1161487482 19:4543795-4543817 GGGGCGGGCTCCAGGGCCGCGGG + Exonic
1162100242 19:8334763-8334785 AGCTCGCGCTCGGCGGCCGCAGG + Exonic
1162911192 19:13848549-13848571 GGGTGGGTCTCAGGGGCCCCTGG - Intergenic
1162921573 19:13906303-13906325 GGCTCGGGATCGACGGCCGCGGG + Exonic
1163503235 19:17688247-17688269 GGGTCGGGCTCAGCGGCCGCTGG + Intronic
1163564846 19:18045005-18045027 GGGTCTGGCTCATGGGCAGCAGG - Intergenic
1163786302 19:19276749-19276771 GGTGCGGGCTCAGCTGCCTCCGG - Intronic
1166852838 19:45768666-45768688 GGGGCGGGCGCAGCGGCTGCGGG - Exonic
1167080585 19:47274312-47274334 GGGGCGGGGTCAGCGCGCGCGGG + Intergenic
1167162789 19:47778828-47778850 GGGTCGGGGACGGGGGCCGCTGG - Intronic
1167608899 19:50496760-50496782 GGGTCGGCCACAGCGGCTGCTGG - Intergenic
1168076394 19:53982757-53982779 GGGGCGGGCGCAGAGGGCGCGGG - Exonic
925128361 2:1477380-1477402 GGCTCGGGCGCACAGGCCGCAGG - Exonic
926018588 2:9474987-9475009 GGGTCCGGGTTAGCGGCCGCGGG + Intronic
926197913 2:10774714-10774736 GAGTGGGGCTCAGAGGCCCCGGG - Intronic
927714006 2:25341341-25341363 GGGTCGGGGTCCGCGCCCTCCGG + Intronic
935742555 2:106163073-106163095 GGCTGAGGCTCAGCGGCCTCGGG + Intronic
938258381 2:129877844-129877866 GGGGCGGGCACAGCAGGCGCAGG + Intergenic
941987652 2:171523681-171523703 GGGAGGGGCTCAGCAGTCGCTGG + Intronic
942947294 2:181684175-181684197 CCGTGGGGCTCAGGGGCCGCAGG + Intergenic
949032022 2:241801790-241801812 GGGCCAGGCTGAGGGGCCGCCGG + Exonic
1170889167 20:20364582-20364604 GGGTCGGGCGCACCCGGCGCAGG + Intergenic
1170893746 20:20396377-20396399 GGGGCGGCCCCAGCGCCCGCTGG + Intronic
1172245631 20:33443547-33443569 GGGGCGGGCTCGGGGGCCGGCGG - Exonic
1172527787 20:35610842-35610864 GGGTCGGGGGCAGGGGCGGCGGG + Intergenic
1172771342 20:37384319-37384341 AGCTTGGGCTCGGCGGCCGCGGG - Exonic
1173778843 20:45736308-45736330 GGGTCCCGCTCTGGGGCCGCAGG - Intergenic
1174148399 20:48468567-48468589 GGGTCCTGCTCAGCGGCCCTGGG - Intergenic
1176125340 20:63472486-63472508 GGGTCGGGCTCAGGCTCAGCGGG + Exonic
1176194520 20:63831121-63831143 AGGGCGGGCGCCGCGGCCGCCGG + Intronic
1176194579 20:63831320-63831342 GGGGCGGGGTCAGGGTCCGCGGG - Intergenic
1176242126 20:64080017-64080039 GGGGCGGGCCCGGCGACCGCCGG - Intergenic
1176377076 21:6092053-6092075 GGGCGGGGCCGAGCGGCCGCGGG + Intergenic
1179746399 21:43446191-43446213 GGGCGGGGCCGAGCGGCCGCGGG - Intergenic
1179809911 21:43864423-43864445 GGGACGGCGTCAGCGCCCGCGGG + Intergenic
1179910049 21:44442768-44442790 GGGTAGGGCTGAGGGGCTGCAGG - Exonic
1180791331 22:18577185-18577207 GGGCCGGGCTCTGCGGCTGGTGG - Intergenic
1181230406 22:21418126-21418148 GGGCCGGGCTCTGCGGCTGGTGG + Intronic
1181248243 22:21516740-21516762 GGGCCGGGCTCTGCGGCTGGTGG - Intergenic
1181573542 22:23780546-23780568 GGGGCGGGGTCAGTGGCTGCTGG - Intronic
1183082825 22:35467795-35467817 GGGTCGGGCTCCGCGTCTGGGGG + Intergenic
1184739457 22:46419062-46419084 GGGTCTGGCTCAGTGGGGGCTGG - Intronic
1185223001 22:49638315-49638337 GGGGAGGTCTCAGAGGCCGCGGG - Intronic
952970902 3:38649612-38649634 GGCGCAGGCTCAGCGGCCCCGGG + Exonic
953904281 3:46860724-46860746 GGTTCTGGCCCAGCGCCCGCAGG + Exonic
954110367 3:48429813-48429835 GGGTCGCGCTCCGCACCCGCAGG + Intronic
955246266 3:57227797-57227819 GGGCCGGGGTCAGCTGCGGCGGG + Exonic
960223742 3:115146936-115146958 GGGTCGGGCGAGGCAGCCGCCGG + Intronic
961213323 3:125141871-125141893 GGGTGGGGCTCGGAGGGCGCAGG + Intronic
962249445 3:133826484-133826506 GGGGCGGTCTCAGAGGCCACAGG + Exonic
964862879 3:161221466-161221488 GGGGCGGGCTCCCCGGCCTCGGG + Intronic
967118486 3:186362298-186362320 GGGGCGGGCTCTGCGCCCGGGGG - Intergenic
967805324 3:193710696-193710718 CGGTCCGGCTCCGCGGCCTCTGG - Intergenic
968178197 3:196569063-196569085 GGCTCGGGCTCTGGGGCCGCGGG + Exonic
968353343 3:198080774-198080796 GGCTCGGGCGCAGGCGCCGCTGG + Intergenic
968583537 4:1405740-1405762 GGGTCAGGCCCAGGGGCTGCAGG - Intronic
972740314 4:41881587-41881609 GGGTCGCGCTCACCCGCCCCGGG + Intergenic
980990474 4:139735004-139735026 GGCGCGGGCGCAGCGGCGGCCGG - Intronic
985840436 5:2301405-2301427 GGGTCGGGCTGAGCCGCTGACGG - Intergenic
997870198 5:137499343-137499365 GGCTCGGGCGCGGCGTCCGCGGG + Exonic
998369497 5:141651585-141651607 GGGGCGGACGCAGCGTCCGCTGG + Intergenic
999248347 5:150167180-150167202 GGGCCGGGCCCAGGGGGCGCCGG - Exonic
999248457 5:150167579-150167601 GGGTCTTGCTCCGCGGCCGCAGG - Intronic
999291515 5:150429184-150429206 GGGTTGGGCTCTGCTGGCGCTGG + Intergenic
1000919525 5:167121610-167121632 GGGTCTTGCTCAGTGGCCCCAGG + Intergenic
1002281230 5:178131095-178131117 AGGGCGGGCACAGCGGCCGGCGG + Intronic
1004289112 6:14350472-14350494 GGGCCGCGCTCAGCTGCAGCCGG + Intergenic
1004650271 6:17600947-17600969 GGGTCAGGCCCCGCGGCCCCGGG - Exonic
1005636588 6:27758672-27758694 GGGTGGGGCTCAGAGCGCGCAGG + Intergenic
1007940659 6:45777985-45778007 GGGTCGAGGTCAGGGGCCGTGGG + Intergenic
1016662597 6:146598891-146598913 GGGGCGGGCTCTGCGGCCTGTGG - Intergenic
1016752142 6:147642606-147642628 GGGTTGGGCTAAATGGCCGCTGG - Intronic
1016933244 6:149429271-149429293 GTGGGGGGCTCAGCGGCTGCAGG - Intergenic
1018013609 6:159693352-159693374 GGGTTGGGCGCGGCGGGCGCGGG - Intronic
1019556574 7:1634399-1634421 GGGTTGGGGTCAGCTGCCCCGGG + Intergenic
1020007941 7:4792235-4792257 GGGACGGGCTCAGCCGCCAGGGG + Intronic
1020009777 7:4801669-4801691 GGAACGGACTCAGCGGCCTCCGG - Exonic
1020085679 7:5308984-5309006 GGGTCGGGTGCAGCAGCCCCCGG - Intronic
1022207612 7:28179789-28179811 GGGCCGGGGCCGGCGGCCGCGGG - Intronic
1022629994 7:32075949-32075971 GGGTTGGGCTCAGGGACCTCTGG + Intronic
1024548878 7:50543953-50543975 CGGCAGGGATCAGCGGCCGCAGG + Exonic
1025139097 7:56448051-56448073 GGGTGGGGCTGGGCGGCAGCCGG - Intergenic
1032274239 7:130440763-130440785 GGGCCGGGCTTGGGGGCCGCGGG - Intronic
1033654300 7:143362608-143362630 GGGCCCGGCTCTGCGGCCCCCGG - Exonic
1035664837 8:1373286-1373308 GTGTCGGGAGCAGGGGCCGCGGG + Intergenic
1037825217 8:22156567-22156589 GGGGCGGGGGCCGCGGCCGCCGG - Exonic
1041281031 8:56211403-56211425 GGGGCGGGCGCAGCGGCGGGCGG - Intergenic
1045137321 8:99234519-99234541 GGTTGGGGTTCAGGGGCCGCAGG + Intronic
1048484166 8:134831997-134832019 GGGTCGGGCGAGGAGGCCGCCGG + Intergenic
1049799870 8:144512781-144512803 GAGCAGGGCTCAGCGGACGCGGG + Intronic
1050094254 9:2047330-2047352 GGCCCGGGCACTGCGGCCGCGGG - Exonic
1052872778 9:33524139-33524161 AGCTCGGGCTCAGGCGCCGCTGG - Intergenic
1055030596 9:71768832-71768854 GGGTCGCGCTCAGCCTCCGCCGG + Exonic
1059389819 9:113991994-113992016 GGGTCAGGCTCAGAGGAAGCTGG + Intronic
1060096267 9:120793359-120793381 GGACCGGGAGCAGCGGCCGCAGG - Exonic
1060389918 9:123268649-123268671 GGGGCGGGCCCCGCGGCTGCTGG + Intergenic
1060514608 9:124258056-124258078 CGGGCGGGCTCGGCTGCCGCTGG - Exonic
1062036849 9:134386263-134386285 GGGGCGGCCCCATCGGCCGCTGG - Intronic
1062436015 9:136546834-136546856 GGGTCGGGCGGATCTGCCGCTGG + Intergenic
1203794585 EBV:169746-169768 GGGTCGGGGTCCGCGGGCTCCGG + Intergenic
1203794786 EBV:170284-170306 GGGTCGGGGTCCGCGGGCTCCGG + Intergenic
1203794977 EBV:170807-170829 GGGTCGGGGTCCGCGGGCTCCGG + Intergenic
1203795178 EBV:171345-171367 GGGTCGGGGTCCGCGGGCTCCGG + Intergenic
1189323093 X:40097877-40097899 GGGCCGAGCTCGGCGGCTGCGGG - Intronic
1191249996 X:58255757-58255779 GGGCCTGGCTCAGGGGCTGCTGG - Intergenic
1191252155 X:58264884-58264906 GGGCCGGGCGCAGGGGCTGCTGG - Intergenic
1191255534 X:58278020-58278042 GGGTCAGGCGCAGGGGCTGCCGG + Intergenic
1191257132 X:58284416-58284438 GGGTCAGGCTCAGTGGCTGATGG + Intergenic
1197774459 X:130110517-130110539 CGGTCGGTCCCCGCGGCCGCCGG + Intronic
1199793866 X:151177580-151177602 GGGTCGGGCACAGCAGGCGGTGG + Intronic