ID: 1163503498

View in Genome Browser
Species Human (GRCh38)
Location 19:17689556-17689578
Sequence TCATAAATGCAGAATGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163503488_1163503498 17 Left 1163503488 19:17689516-17689538 CCCCACAGGGTCTCCTGCCCCCA No data
Right 1163503498 19:17689556-17689578 TCATAAATGCAGAATGTGCATGG No data
1163503497_1163503498 -8 Left 1163503497 19:17689541-17689563 CCACATGAAAGAGCTTCATAAAT No data
Right 1163503498 19:17689556-17689578 TCATAAATGCAGAATGTGCATGG No data
1163503494_1163503498 -2 Left 1163503494 19:17689535-17689557 CCCAGCCCACATGAAAGAGCTTC No data
Right 1163503498 19:17689556-17689578 TCATAAATGCAGAATGTGCATGG No data
1163503489_1163503498 16 Left 1163503489 19:17689517-17689539 CCCACAGGGTCTCCTGCCCCCAG No data
Right 1163503498 19:17689556-17689578 TCATAAATGCAGAATGTGCATGG No data
1163503490_1163503498 15 Left 1163503490 19:17689518-17689540 CCACAGGGTCTCCTGCCCCCAGC No data
Right 1163503498 19:17689556-17689578 TCATAAATGCAGAATGTGCATGG No data
1163503495_1163503498 -3 Left 1163503495 19:17689536-17689558 CCAGCCCACATGAAAGAGCTTCA No data
Right 1163503498 19:17689556-17689578 TCATAAATGCAGAATGTGCATGG No data
1163503496_1163503498 -7 Left 1163503496 19:17689540-17689562 CCCACATGAAAGAGCTTCATAAA No data
Right 1163503498 19:17689556-17689578 TCATAAATGCAGAATGTGCATGG No data
1163503493_1163503498 -1 Left 1163503493 19:17689534-17689556 CCCCAGCCCACATGAAAGAGCTT No data
Right 1163503498 19:17689556-17689578 TCATAAATGCAGAATGTGCATGG No data
1163503492_1163503498 0 Left 1163503492 19:17689533-17689555 CCCCCAGCCCACATGAAAGAGCT No data
Right 1163503498 19:17689556-17689578 TCATAAATGCAGAATGTGCATGG No data
1163503491_1163503498 4 Left 1163503491 19:17689529-17689551 CCTGCCCCCAGCCCACATGAAAG No data
Right 1163503498 19:17689556-17689578 TCATAAATGCAGAATGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163503498 Original CRISPR TCATAAATGCAGAATGTGCA TGG Intergenic
No off target data available for this crispr