ID: 1163505226

View in Genome Browser
Species Human (GRCh38)
Location 19:17701813-17701835
Sequence GTGAGTGTGAAATGCCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163505224_1163505226 -8 Left 1163505224 19:17701798-17701820 CCAGGTTTTGGCCTTGTGAGTGT No data
Right 1163505226 19:17701813-17701835 GTGAGTGTGAAATGCCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163505226 Original CRISPR GTGAGTGTGAAATGCCTGCA AGG Intergenic
No off target data available for this crispr