ID: 1163505538

View in Genome Browser
Species Human (GRCh38)
Location 19:17703876-17703898
Sequence TGGGCCTGGAGTGGTTGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163505528_1163505538 27 Left 1163505528 19:17703826-17703848 CCCTGCAGGGATGTAGGGTGGAA No data
Right 1163505538 19:17703876-17703898 TGGGCCTGGAGTGGTTGGATGGG No data
1163505529_1163505538 26 Left 1163505529 19:17703827-17703849 CCTGCAGGGATGTAGGGTGGAAA No data
Right 1163505538 19:17703876-17703898 TGGGCCTGGAGTGGTTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163505538 Original CRISPR TGGGCCTGGAGTGGTTGGAT GGG Intergenic