ID: 1163507896

View in Genome Browser
Species Human (GRCh38)
Location 19:17719296-17719318
Sequence CGGCTCCCAAGCGGACACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 80}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163507896 Original CRISPR CGGCTCCCAAGCGGACACCC AGG Intronic
900380503 1:2381734-2381756 GGGCCCCCAAGCGGCCCCCCAGG - Intronic
903832441 1:26183235-26183257 TGTGTCCCAAGTGGACACCCAGG + Exonic
905308053 1:37032777-37032799 CGGCTCCCGGGCGGCCGCCCAGG + Intronic
910679086 1:89843973-89843995 CGGCTCCGCAGCGCACGCCCAGG - Intronic
911139415 1:94482668-94482690 CAGCTCCCAGGAGGAAACCCTGG - Intronic
922753798 1:228083061-228083083 CGGCGTCCAAGCGGACTTCCGGG - Intronic
1062923881 10:1299835-1299857 CGGAGGCCATGCGGACACCCTGG + Intronic
1064137141 10:12760944-12760966 CAGCTCTCCACCGGACACCCTGG - Exonic
1071573718 10:86711487-86711509 CGGCTGCCAAGCGGAGTCCGGGG + Intronic
1073122575 10:101131628-101131650 CGGGTCCCATGCAGCCACCCTGG - Exonic
1075144498 10:119872289-119872311 CGGCTCCCAAGCTGCGACTCGGG + Intronic
1076821171 10:132940470-132940492 CTGCTCCCTAGCGGACAACTTGG - Intronic
1077546180 11:3171007-3171029 AGCCTCCCAAGTGGACACACCGG - Intergenic
1077583075 11:3429747-3429769 CGGCTCCCTGGCAGTCACCCAGG - Intergenic
1078317583 11:10305676-10305698 CGGCTGCGAAGCGCAGACCCTGG - Exonic
1078845291 11:15114593-15114615 CGGCTCCCGGGCGATCACCCTGG + Intronic
1084239988 11:67812550-67812572 CGGCTCCCTGGCAGTCACCCAGG - Intergenic
1084832455 11:71780284-71780306 CGGCTCCCTGGCAGTCACCCAGG + Intergenic
1085708183 11:78805442-78805464 CGCCTCTCACGCAGACACCCCGG + Exonic
1098022338 12:66169575-66169597 CGGCTCCCCAGCGGGCGCCGCGG - Intronic
1113836261 13:113330411-113330433 GGGCTCCCATGCACACACCCGGG - Intronic
1113836267 13:113330431-113330453 GGGCTCCCATGCACACACCCGGG - Intronic
1113836372 13:113330890-113330912 GGGCTCCCATGCACACACCCGGG - Intronic
1113836378 13:113330910-113330932 GGGCTCCCATGCACACACCCGGG - Intronic
1119650156 14:76377413-76377435 CAGCGCCCAAGGGGAGACCCGGG - Intronic
1122372169 14:101234780-101234802 CTGCTGCCAAGCAGACCCCCGGG - Intergenic
1129763990 15:78149547-78149569 CGGCTCCCAAGCTGTCCCCGCGG - Intronic
1134671979 16:16062612-16062634 GGTCTCCCCAGCTGACACCCAGG - Intronic
1136724753 16:32348771-32348793 CGGCGCCCAAGCCGACCCCAGGG - Intergenic
1136843079 16:33554811-33554833 CGGCGCCCAAGCCGACCCCAGGG - Intergenic
1137053860 16:35734358-35734380 GGGCCCCCAAGCGGAGACCATGG - Intergenic
1203001677 16_KI270728v1_random:168984-169006 CGGCGCCCAAGCCGACCCCAGGG + Intergenic
1203133281 16_KI270728v1_random:1705390-1705412 CGGCGCCCAAGCCGACCCCAGGG + Intergenic
1203153244 16_KI270728v1_random:1855109-1855131 CGGCGCCCAAGCCGACCCCAGGG - Intergenic
1142876251 17:2853534-2853556 CGGCTCCCAGGCGCCCTCCCCGG - Intronic
1152769933 17:82161391-82161413 CCGCTCCCAGGTGTACACCCAGG + Intronic
1154032247 18:10763941-10763963 AGGCTCCCAAGTGGAAACCTGGG - Intronic
1155872271 18:31042923-31042945 CTGCTCCCCAGCAGCCACCCGGG + Intergenic
1157566269 18:48681013-48681035 CGGCTCCCAGGCTGACCCGCCGG + Intronic
1157813142 18:50711932-50711954 CCTCTCCCATTCGGACACCCAGG + Intronic
1162794188 19:13078221-13078243 CGGCTCTCAAGCTGGCGCCCTGG + Intronic
1163021382 19:14482671-14482693 CGGCTCCCCAGTGGATACCTCGG + Exonic
1163507896 19:17719296-17719318 CGGCTCCCAAGCGGACACCCAGG + Intronic
1168292235 19:55362311-55362333 CGGCTCCCACCTGGACCCCCAGG - Exonic
929786965 2:45000413-45000435 GGGCCCCCAGGCCGACACCCGGG - Intergenic
947700738 2:232232036-232232058 GGGCTCCCATGCTCACACCCAGG - Intronic
948578521 2:238969207-238969229 CAGCTCCCTAGCGGACCCCGAGG - Intergenic
948703883 2:239777662-239777684 CAGCTCCCAAGAGGAGACTCAGG - Intronic
1170044958 20:12075170-12075192 CGGCTCCCCTGTGGACACCAAGG - Intergenic
1170883821 20:20320847-20320869 CAGCTGCCAAGAGGACAGCCAGG + Intronic
1172407124 20:34698210-34698232 CAGTTCCCAAGCAGAGACCCAGG + Intronic
1176376116 21:6087628-6087650 AGGCTCCCAGGCGGGCTCCCGGG - Intergenic
1179747359 21:43450616-43450638 AGGCTCCCAGGCGGGCTCCCGGG + Intergenic
1179988234 21:44932718-44932740 CGCCTCCCCAGCGGCCTCCCCGG + Intergenic
1180940173 22:19655721-19655743 CGGGACCCAAGTGGATACCCAGG + Intergenic
1184789591 22:46691658-46691680 CGTCTCCCAAGTGGGCAGCCGGG + Exonic
961298928 3:125909384-125909406 CGGCTCCCTGGCAGTCACCCAGG + Intergenic
961371296 3:126433600-126433622 CCGCTCCCAACCTGACAGCCTGG + Intronic
977919441 4:102626912-102626934 CATCTCCCAACAGGACACCCAGG + Intergenic
990954654 5:61330954-61330976 CGGCTCCCACCCCGGCACCCGGG - Intergenic
996329421 5:122312292-122312314 CAGGTCCCAAGCGGACGCCGCGG + Intronic
998825289 5:146095331-146095353 GGGCTCTCAAGTGGACAACCAGG + Intronic
1001981793 5:176043343-176043365 CTGGTCCCAGGCTGACACCCAGG - Intergenic
1001981896 5:176043773-176043795 CAGGTACCAAGCTGACACCCGGG - Intergenic
1001982868 5:176048239-176048261 CAGCTGCCAGGCTGACACCCAGG - Intergenic
1002234595 5:177795818-177795840 CAGCTGCCAGGCTGACACCCAGG + Intergenic
1002235569 5:177800284-177800306 CAGGTACCAAGCTGACACCCGGG + Intergenic
1002235673 5:177800717-177800739 CTGGTCCCAGGCTGACACCCAGG + Intergenic
1002780661 6:363011-363033 CTGCTCCCAGGCAGTCACCCAGG - Intergenic
1005645523 6:27834143-27834165 CGTCTCCCAGGCTGTCACCCAGG - Intergenic
1019424802 7:969525-969547 CGGCTTCCCAGCGCACACCGGGG + Intronic
1020023519 7:4883278-4883300 CGGGGCCCACGCGGACAGCCAGG + Intronic
1024827186 7:53404424-53404446 TGGCTCCCAATGGAACACCCTGG + Intergenic
1025280769 7:57625409-57625431 AGGCTCACAGGTGGACACCCAGG + Intergenic
1025303961 7:57840098-57840120 AGGCTCACAGGTGGACACCCAGG - Intergenic
1027190350 7:75992736-75992758 GGGCTCACAGGAGGACACCCAGG - Intronic
1038535769 8:28351920-28351942 CGGAGCCCAAGAGAACACCCAGG + Intronic
1060917288 9:127398634-127398656 GGGCTCCCAAGTGGGCAGCCTGG - Intronic
1061828282 9:133275121-133275143 CGGCTCCCTCGCGGGCACCCGGG + Intronic
1062128816 9:134881472-134881494 GGGCTCCCGAGGGGACACTCGGG + Intronic
1062387636 9:136319319-136319341 CGGCTCACAAGCGGAGGCCTTGG - Intergenic
1203632131 Un_KI270750v1:80199-80221 AGGCTCACAGGTGGACACCCAGG + Intergenic