ID: 1163507936

View in Genome Browser
Species Human (GRCh38)
Location 19:17719436-17719458
Sequence GCCTCTTAAAGGGGCCGCAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 5, 3: 4, 4: 46}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163507936_1163507950 10 Left 1163507936 19:17719436-17719458 CCGGTGCGGCCCCTTTAAGAGGC 0: 1
1: 0
2: 5
3: 4
4: 46
Right 1163507950 19:17719469-17719491 GGGCGGGCGCCGAGAACGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 115
1163507936_1163507952 14 Left 1163507936 19:17719436-17719458 CCGGTGCGGCCCCTTTAAGAGGC 0: 1
1: 0
2: 5
3: 4
4: 46
Right 1163507952 19:17719473-17719495 GGGCGCCGAGAACGCCGGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 139
1163507936_1163507956 28 Left 1163507936 19:17719436-17719458 CCGGTGCGGCCCCTTTAAGAGGC 0: 1
1: 0
2: 5
3: 4
4: 46
Right 1163507956 19:17719487-17719509 CCGGGGCGGCCCGAAGATGGCGG 0: 1
1: 0
2: 0
3: 8
4: 87
1163507936_1163507949 9 Left 1163507936 19:17719436-17719458 CCGGTGCGGCCCCTTTAAGAGGC 0: 1
1: 0
2: 5
3: 4
4: 46
Right 1163507949 19:17719468-17719490 GGGGCGGGCGCCGAGAACGCCGG 0: 1
1: 0
2: 0
3: 18
4: 159
1163507936_1163507951 11 Left 1163507936 19:17719436-17719458 CCGGTGCGGCCCCTTTAAGAGGC 0: 1
1: 0
2: 5
3: 4
4: 46
Right 1163507951 19:17719470-17719492 GGCGGGCGCCGAGAACGCCGGGG 0: 1
1: 0
2: 1
3: 9
4: 121
1163507936_1163507946 -7 Left 1163507936 19:17719436-17719458 CCGGTGCGGCCCCTTTAAGAGGC 0: 1
1: 0
2: 5
3: 4
4: 46
Right 1163507946 19:17719452-17719474 AAGAGGCGGGGCCTGCGGGGCGG 0: 1
1: 0
2: 7
3: 79
4: 958
1163507936_1163507945 -10 Left 1163507936 19:17719436-17719458 CCGGTGCGGCCCCTTTAAGAGGC 0: 1
1: 0
2: 5
3: 4
4: 46
Right 1163507945 19:17719449-17719471 TTTAAGAGGCGGGGCCTGCGGGG 0: 1
1: 0
2: 1
3: 14
4: 178
1163507936_1163507954 25 Left 1163507936 19:17719436-17719458 CCGGTGCGGCCCCTTTAAGAGGC 0: 1
1: 0
2: 5
3: 4
4: 46
Right 1163507954 19:17719484-17719506 ACGCCGGGGCGGCCCGAAGATGG 0: 1
1: 0
2: 0
3: 3
4: 41
1163507936_1163507947 -6 Left 1163507936 19:17719436-17719458 CCGGTGCGGCCCCTTTAAGAGGC 0: 1
1: 0
2: 5
3: 4
4: 46
Right 1163507947 19:17719453-17719475 AGAGGCGGGGCCTGCGGGGCGGG 0: 1
1: 1
2: 13
3: 113
4: 837

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163507936 Original CRISPR GCCTCTTAAAGGGGCCGCAC CGG (reversed) Exonic
902240180 1:15083224-15083246 GCAACTAAAAGGGGCTGCACAGG - Intronic
902488622 1:16764503-16764525 GCCTCTTCTTGGGGCCACACTGG - Intronic
907381729 1:54096340-54096362 GCCTCATTAATGGGCCGTACCGG + Exonic
911647708 1:100353225-100353247 GCCTCGTAATGGGACAGCACCGG + Intronic
922344180 1:224682395-224682417 GTCTCTTAAAGAGGCAACACAGG - Intronic
923531817 1:234818013-234818035 GCCTCTTCTTGGGGCCACACTGG + Intergenic
1065259029 10:23905580-23905602 GCCTCTGAAAGATGCCCCACAGG + Intronic
1075568402 10:123520931-123520953 GCCACTGAATGGGGCTGCACTGG - Intergenic
1090244551 11:125206542-125206564 GCCTCTTCAGGGGACCCCACTGG - Intronic
1095597848 12:43979631-43979653 GCCTGTTGAAGGGGCCCCATAGG + Intronic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1112461341 13:99606393-99606415 GCCTCTTTGAGGGGCCTCTCTGG - Intergenic
1121342971 14:93115961-93115983 GCCTCTTAAAGGCGCCGCGCCGG + Intronic
1129620831 15:77143938-77143960 GCTTCTTACAGGGCCCACACTGG - Intronic
1132570445 16:641853-641875 GGCCCTTAAAGGGCCCGCACGGG - Exonic
1132884429 16:2176404-2176426 GCCATTCAAAGGGGCTGCACAGG + Intronic
1136516744 16:30773096-30773118 GCCTCCCAAAGGGGTCCCACAGG - Intronic
1143373437 17:6454334-6454356 GGCTCTTAAAGGAGCCTCTCTGG - Exonic
1145243650 17:21253533-21253555 ACCTCTTAAAGGGGCCGCGCCGG + Intergenic
1151685450 17:75643567-75643589 GCCTCTTAAAGGAGCGGGCCAGG - Intronic
1155937429 18:31768116-31768138 GCCTCTTCAAGGGGCTGCTTAGG + Intergenic
1160891311 19:1380093-1380115 CCATCTTAAAGGGGCAACACAGG + Intergenic
1163507936 19:17719436-17719458 GCCTCTTAAAGGGGCCGCACCGG - Exonic
1164056268 19:21624516-21624538 CCCTGTTGAAGGGGCCCCACAGG - Intergenic
1168451367 19:56469163-56469185 GCCTCTTGGAGTGGCCTCACAGG - Intronic
928939558 2:36713808-36713830 GCCAATTAATGGGGCTGCACAGG + Intronic
929589473 2:43135685-43135707 GCCTCTTCATGGGGCCTCCCTGG - Intergenic
932708259 2:74043585-74043607 GCCTCTTAGAGCGGCCTCCCTGG - Intronic
934052027 2:88219200-88219222 GCCTCTTAGAGGGGCCGCAGGGG + Intergenic
936265063 2:110998439-110998461 TTCACTTAAAGGAGCCGCACTGG - Intronic
937346165 2:121126948-121126970 GCCTCTTCAGGGGGCTGCCCTGG - Intergenic
938982135 2:136537070-136537092 GCCACTTTAAGGGGCAGCCCAGG + Intergenic
948537267 2:238655376-238655398 CCCTCTTCAAGGGGCAGCAGGGG + Intergenic
948550926 2:238772673-238772695 GCCTCTCACAGGGTCCCCACAGG + Intergenic
1168757265 20:326029-326051 GCCTCTTGATGTGGCCGCTCGGG - Exonic
1168991885 20:2102655-2102677 CCGTCTTAAAGGGGCCGCGGCGG + Intronic
1175894100 20:62328482-62328504 GCCTCTGAGAGGGGCGGGACTGG - Intronic
1176106517 20:63392126-63392148 GCCACTTAAAGAGGCCCCTCAGG + Intergenic
1180636508 22:17266482-17266504 GCATCTTAAGGGGGCCTGACTGG - Intergenic
1181940464 22:26471776-26471798 GGCTCTTAATGGGGCAGCACAGG + Intronic
1183469579 22:37998359-37998381 GCCCCTTGAAGGGGCCTCCCTGG + Intronic
1183607158 22:38872431-38872453 GGCTCTTAAAGGGGCCGCGCGGG + Intergenic
950108062 3:10400878-10400900 GCCTCATGAAGGGGACACACAGG + Intronic
954822927 3:53347317-53347339 GTCTCTTAAAGGGGCCGCGCGGG - Intronic
956179200 3:66501341-66501363 GCCTCTTAAAGGAGACACGCAGG + Intergenic
971382139 4:26108719-26108741 GCCTCTTAAAGGAACCAGACTGG + Intergenic
989577575 5:43002684-43002706 GTAACTTAAAGGGGCGGCACTGG + Intergenic
1008542151 6:52554609-52554631 GCCTCTCAATGGGGCAGCAATGG + Intronic
1013048328 6:106509717-106509739 GCCTCTGAAAGGGGCCCCTGTGG + Intergenic
1019362158 7:610393-610415 GCCTCTTAAATGAGCCTCACTGG + Intronic
1035394453 7:158526125-158526147 GCTTCTGAAAGGGCCCGCTCTGG + Intronic
1036102426 8:5801844-5801866 CCCTGTTAAAGGGGCCCCATAGG + Intergenic
1036123263 8:6040674-6040696 GACTCATACAGGGGCCTCACTGG - Intergenic
1046527609 8:115401025-115401047 GACTCTTAAAGGGCCAGCATTGG + Intergenic
1055924678 9:81497446-81497468 GCCTCATGAAGGGGGAGCACTGG - Intergenic
1058816067 9:108683967-108683989 GCCTCTTACAGGGGCTACACAGG - Intergenic