ID: 1163508272

View in Genome Browser
Species Human (GRCh38)
Location 19:17720622-17720644
Sequence CAGGGGAAACAGCTGTTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 293}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163508253_1163508272 27 Left 1163508253 19:17720572-17720594 CCCCTGGCCAGTAGGAACAGGTG 0: 1
1: 0
2: 0
3: 21
4: 149
Right 1163508272 19:17720622-17720644 CAGGGGAAACAGCTGTTGCAAGG 0: 1
1: 0
2: 1
3: 31
4: 293
1163508260_1163508272 20 Left 1163508260 19:17720579-17720601 CCAGTAGGAACAGGTGGGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 139
Right 1163508272 19:17720622-17720644 CAGGGGAAACAGCTGTTGCAAGG 0: 1
1: 0
2: 1
3: 31
4: 293
1163508256_1163508272 25 Left 1163508256 19:17720574-17720596 CCTGGCCAGTAGGAACAGGTGGG 0: 1
1: 0
2: 2
3: 16
4: 180
Right 1163508272 19:17720622-17720644 CAGGGGAAACAGCTGTTGCAAGG 0: 1
1: 0
2: 1
3: 31
4: 293
1163508254_1163508272 26 Left 1163508254 19:17720573-17720595 CCCTGGCCAGTAGGAACAGGTGG 0: 1
1: 0
2: 0
3: 20
4: 173
Right 1163508272 19:17720622-17720644 CAGGGGAAACAGCTGTTGCAAGG 0: 1
1: 0
2: 1
3: 31
4: 293
1163508252_1163508272 28 Left 1163508252 19:17720571-17720593 CCCCCTGGCCAGTAGGAACAGGT 0: 1
1: 0
2: 1
3: 11
4: 119
Right 1163508272 19:17720622-17720644 CAGGGGAAACAGCTGTTGCAAGG 0: 1
1: 0
2: 1
3: 31
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163508272 Original CRISPR CAGGGGAAACAGCTGTTGCA AGG Intronic
901329309 1:8392720-8392742 CAGAGCAAACATCTGCTGCAAGG + Intronic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902205252 1:14863747-14863769 CAGGGGAAACTGAAGGTGCACGG + Intronic
902274720 1:15331219-15331241 CTGGGGAAACAGCTGTCTCTTGG - Intronic
904323196 1:29709873-29709895 CAGGGGAGGCAGCTGTTTCGTGG - Intergenic
904488195 1:30841487-30841509 CAGGGAAAACAGCGTATGCATGG - Intergenic
905413858 1:37791588-37791610 CAGGGGACACAATTGTTTCAGGG + Intergenic
905491130 1:38344622-38344644 CAGAGGAAACAAGTGTTTCAGGG + Intergenic
906518303 1:46452494-46452516 CAGAGGGAAGAGCTGTTGGAGGG + Intergenic
906733867 1:48105694-48105716 CAGGGGAGATAGCTGGTGCAGGG - Intergenic
907258917 1:53201444-53201466 CTGGGGAAGAATCTGTTGCATGG - Intronic
907988020 1:59552191-59552213 GAGGGGAAGCAGCTGCTGCCTGG + Intronic
908241695 1:62194220-62194242 CAGAGGAAACAGCCAGTGCAAGG + Intergenic
908463657 1:64370282-64370304 CAGAGGGAACAGCTAGTGCATGG + Intergenic
910981736 1:92965091-92965113 CAGAGGAAACAGGAGTGGCAGGG - Intergenic
912273154 1:108230194-108230216 CAGGGCATACAGCAGGTGCAAGG + Intronic
912295066 1:108464128-108464150 CAGGGCATACAGCAGGTGCAAGG - Intronic
912714826 1:111975694-111975716 CAGGGGAAGCAGCTCATGTAGGG - Intronic
913260203 1:116990864-116990886 AAGGGCAAGCAGCTGTTCCAGGG - Intergenic
913319939 1:117581161-117581183 TATGGGAAACAGCTTCTGCAGGG + Intergenic
915946123 1:160152939-160152961 CAGGAGAAACACCTGTTGGGAGG + Intronic
916155332 1:161839783-161839805 CAGAGGAAACAGCCATTGCAGGG + Intronic
919469169 1:197957586-197957608 CAGGGGAAGCTGATGATGCAGGG + Intergenic
919826650 1:201507751-201507773 GAGGGGCAAGAGCTGTTGGAGGG - Intronic
921506639 1:215979132-215979154 CAGGTAAGACAGCTTTTGCAGGG + Intronic
922361642 1:224828162-224828184 CAGGGGAAAGATCTGAAGCAGGG + Intergenic
922579653 1:226687506-226687528 CAGTGGAAAAAGCTGTTCCAGGG - Intronic
923880979 1:238103973-238103995 AAGGGGAAACTGCTCTTGCTTGG - Intergenic
1064003806 10:11684528-11684550 TAGGGAAAACAGCTAATGCATGG + Intergenic
1064155825 10:12902252-12902274 CCGGGGAAGCTGCTGTTACAGGG + Intronic
1064738333 10:18406770-18406792 CAGGGAAAACAATTGTTCCATGG - Intronic
1066124979 10:32332681-32332703 CAGGGGCAACATCTGTTGGGTGG - Intronic
1066435550 10:35394085-35394107 GAGGGGAAACATAAGTTGCACGG - Intronic
1069547800 10:69341235-69341257 CTGGGGAAGCAGAGGTTGCAGGG - Intronic
1070983363 10:80667609-80667631 CAGAGGAAAGGGCTGCTGCATGG - Intergenic
1073297236 10:102448526-102448548 CAGGAGAAACACCTTTTCCAAGG + Intergenic
1074790395 10:116880870-116880892 CGAGGGAAACAGCTGCTGCAGGG + Intronic
1075044877 10:119139081-119139103 CAGAGGAAACAGCTGTGTGAAGG + Intergenic
1075116832 10:119633967-119633989 CAGGGTAAACAGCTGCTCCCTGG + Intergenic
1076389194 10:130084794-130084816 CATGGGAAGCAGCTGATTCAGGG + Intergenic
1076548731 10:131263837-131263859 CAGTGGAAACAGCTGTGGAGAGG - Intronic
1077128666 11:957715-957737 CAGGGCAAACAGTTGTTGGTAGG - Intronic
1077457607 11:2690341-2690363 TAGTGGAAACAGCAGCTGCAGGG - Intronic
1077541780 11:3150092-3150114 CAGGGGAAACAGCTGCTGGTTGG - Intronic
1078110659 11:8389203-8389225 CAGGGGACACAGCTGTAAGAGGG + Intergenic
1081087454 11:38819427-38819449 AAGGGGAAAGAGCTGTAGCAAGG - Intergenic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1081743510 11:45457295-45457317 CAGGAGAAACAGCAGCTGTAAGG + Intergenic
1082004281 11:47411085-47411107 CAGGGGAAACTGCTATTTCCTGG - Intronic
1082821690 11:57548288-57548310 CAGAGGAAACAGCAGGTGCAAGG - Intronic
1082878329 11:58011565-58011587 CAGTGGAAACAACTTTTACAAGG + Intergenic
1083134371 11:60657920-60657942 CAGGGGATAAAGTAGTTGCAGGG + Intergenic
1083603287 11:63961897-63961919 CCTGGGATACAGCTGTTGCCAGG - Intergenic
1086455081 11:86953333-86953355 TTGGAGAAACAGCTTTTGCAGGG - Intronic
1088494691 11:110421231-110421253 CAGGAAACAGAGCTGTTGCAGGG - Intergenic
1089260161 11:117218765-117218787 CAGAGGAAACAGCTGTGTCCAGG + Intronic
1090037724 11:123263440-123263462 CAGGGGGAACAGCTGTCAGAGGG - Intergenic
1090257744 11:125297736-125297758 CAGAGGAAACAGCATTTTCAAGG - Intronic
1091404745 12:202198-202220 CAGGGGGAAGAGCAGGTGCAGGG - Intronic
1092496528 12:9001420-9001442 CAGGGGAAAAACCTGTAGCTGGG - Intronic
1093166400 12:15808621-15808643 AAAGGTAAACTGCTGTTGCAAGG + Intronic
1095906201 12:47380560-47380582 GTAGGAAAACAGCTGTTGCATGG - Intergenic
1097122959 12:56750073-56750095 CAGTGGAAACAGCTTGAGCAAGG + Intronic
1097519465 12:60648704-60648726 CAGAGGACGCAGCTGTTGCATGG - Intergenic
1098761185 12:74427386-74427408 AAGGGGAGCCAGCTTTTGCAGGG - Intergenic
1101905643 12:108823430-108823452 CAGGGGAAAAAGCTTTAGCGTGG + Intronic
1102034281 12:109761954-109761976 CTGGGGAAGCAGTTGGTGCAGGG - Intronic
1103739411 12:123081338-123081360 TAGGGGAAACAGCAGTTGAGGGG - Intronic
1104489498 12:129181689-129181711 CAGAGGAAACAGCTTTCACAAGG - Intronic
1104848974 12:131862114-131862136 CAGAGGGAACAGCTAGTGCAAGG + Intergenic
1110220372 13:73066017-73066039 CAGGTGAAAAAGCTGATGCAAGG - Intronic
1112344900 13:98581091-98581113 CCTGGGAGACAGCGGTTGCAGGG - Intergenic
1112410741 13:99161337-99161359 CAGGCGAGACAGCTTGTGCAGGG + Intergenic
1113518339 13:110920100-110920122 CATGGGAAACAGCTTTGGAAAGG - Intergenic
1113782347 13:112983841-112983863 CAAGGAAAACAGCTGCAGCACGG - Intronic
1114651894 14:24290435-24290457 CATGGGAAACAGGTCTTGCAGGG + Intergenic
1115312410 14:31992858-31992880 CAGAGGGTACAGCTGTTGCTGGG + Intergenic
1115505907 14:34093808-34093830 CAGGGGAAATAGCTTGTACAAGG + Intronic
1116150700 14:41138264-41138286 CTGGGAAGATAGCTGTTGCATGG + Intergenic
1116643886 14:47501749-47501771 CTGGGGAAAGAGCTGTTCCTTGG - Intronic
1119307219 14:73617225-73617247 GAGGGGATAGAGCTGATGCAGGG + Intronic
1121414609 14:93770484-93770506 CAGAGGAAACAGCATGTGCAAGG - Intronic
1121542779 14:94741148-94741170 CAGGGAGACCAGTTGTTGCAGGG - Intergenic
1122272991 14:100576655-100576677 CAGGGGACACAGATGGTACAGGG + Intronic
1124085328 15:26544537-26544559 CAGGGGAAATGGATGTCGCATGG + Exonic
1128310640 15:66630023-66630045 CAGGGGGCACAGCTGTTCCAGGG - Intronic
1129157630 15:73728663-73728685 GAGGTGAAATAGCTGGTGCAAGG + Intergenic
1130334657 15:82948701-82948723 CAGGGGAAACAGCAAGTGCAAGG + Intronic
1130830625 15:87594887-87594909 CAGGGGACACAGCTCATGCAAGG - Intergenic
1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG + Intergenic
1131592921 15:93768809-93768831 AAGGGGGAGCAGCTGTTACATGG + Intergenic
1133288345 16:4701786-4701808 CTATGGAAACAGCTGCTGCACGG + Intronic
1133330548 16:4970605-4970627 CAGGGGAACCAGCTGATCCTAGG + Intronic
1133647302 16:7776353-7776375 CAGGGGAAACTCCTTTTGCTTGG + Intergenic
1135134431 16:19877135-19877157 CAGAGGAAACAGCTATGGGATGG + Intronic
1135643760 16:24143466-24143488 CAGGGTACTCATCTGTTGCAAGG - Intronic
1135987525 16:27194934-27194956 CAGGCAAAACAGCTTGTGCAGGG + Intergenic
1137068958 16:35881930-35881952 CAGGGGCAACAGCAGTTGCTAGG - Intergenic
1137398864 16:48136771-48136793 CAAAGGAAACAGCAATTGCAAGG + Intronic
1139311774 16:66033637-66033659 CAGGGAAAACAGCTGATGTGGGG - Intergenic
1139939458 16:70594764-70594786 CAGAGGAAACAGGTTTTGGAAGG + Intronic
1140707647 16:77645498-77645520 CTGGGGACTCAGTTGTTGCATGG + Intergenic
1142860620 17:2758649-2758671 CAGGGGCCACAGCTGGAGCATGG - Intergenic
1143295569 17:5869135-5869157 CAGGGGAGATAGCTGGTGCGTGG + Intronic
1143497067 17:7318416-7318438 CAGGGGAAATCTCTGTTCCAGGG - Intronic
1143890285 17:10097522-10097544 CAGGTGCAGCAGCTCTTGCAGGG + Intronic
1148158710 17:45437748-45437770 AAGGGGACACAGCTGTGACACGG + Exonic
1148431164 17:47644891-47644913 AAGGGGAAAGAGCAGATGCAGGG - Intergenic
1149665238 17:58360668-58360690 CATGGGAAACAGATGTAGCCAGG + Intronic
1149939019 17:60843290-60843312 CACGGGAAGCAGAGGTTGCAGGG - Intronic
1150117490 17:62566638-62566660 CAGTGTAAACAGCAGTTACATGG + Intronic
1150213346 17:63453602-63453624 CAGGGCCCACAGCTGTTGGAAGG + Intergenic
1150390126 17:64785146-64785168 AAGGGGACACAGCTGTGACACGG + Intergenic
1151575541 17:74951084-74951106 CAGGGGAAAAAGGTGTGGCCAGG - Exonic
1152164051 17:78689949-78689971 CAGCGGAAGCAGCGGTGGCAGGG - Intronic
1152407133 17:80104237-80104259 CAGGCCAAACAGCTGTCGCCTGG - Intergenic
1153461661 18:5341000-5341022 CAGGGGAAACATTTTTGGCAAGG + Intergenic
1155621233 18:27782998-27783020 AAGGGGAAACATCTTTTGCTTGG + Intergenic
1156354863 18:36332239-36332261 CTGGGGCCACAGCTGCTGCAGGG - Intronic
1157534573 18:48448883-48448905 CAGAGGAAATAGCTTTGGCAAGG + Intergenic
1157733563 18:50025783-50025805 CAGAGGAAAAAGCTGTCCCACGG - Intronic
1159877474 18:73828524-73828546 CAGATGAAACAGCTGATTCAGGG - Intergenic
1160685113 19:430987-431009 CAGGGGGAACAGCCATTGCAAGG - Intronic
1161122276 19:2535619-2535641 CAGGGGAAAGAGATCTTCCAGGG - Intronic
1161574809 19:5049380-5049402 CAGGGGAGACAGCTGGGGCGGGG + Intronic
1161937866 19:7383125-7383147 AATGGGCACCAGCTGTTGCAAGG + Exonic
1162730389 19:12715155-12715177 CAGGGCAAATAGGTGCTGCAGGG + Exonic
1163508272 19:17720622-17720644 CAGGGGAAACAGCTGTTGCAAGG + Intronic
1163691150 19:18739162-18739184 CAGGTGAAACAGCTGAGGCCTGG - Intronic
1164741820 19:30581536-30581558 GACTGGAAACAGCTCTTGCAGGG + Intronic
1165699923 19:37929685-37929707 AGGGGGAAACAGCCTTTGCAAGG - Intronic
1166065503 19:40356128-40356150 CAGGGAAAGCAGCTGTGGGAGGG + Intronic
1166636289 19:44454450-44454472 TAAGGGAAATAGCTTTTGCATGG - Intergenic
1166741062 19:45115088-45115110 CTGGGGACACAGCAGTGGCAAGG + Intronic
1167019354 19:46861992-46862014 CAGGGGAATGAGCTGGGGCACGG - Intergenic
1167173391 19:47848827-47848849 CAGAGGAAACAGCTGGGGGAAGG - Intergenic
1167458183 19:49609660-49609682 CAGAGGAAACAGCTGTGCAAAGG + Intronic
925394571 2:3523786-3523808 CAGGAGCAACAGCGGTAGCAGGG + Intergenic
926064250 2:9824374-9824396 CAGGGGGACCAGCTGTGGCCAGG + Intergenic
926966981 2:18425679-18425701 CAGGGGAAAAAGCTTTTCCAGGG - Intergenic
927173226 2:20387751-20387773 CAGGGGAAACAGGTTTGGAAAGG + Intergenic
929789640 2:45013520-45013542 CACGGAAAACCGCTGGTGCAGGG - Intergenic
930924525 2:56800632-56800654 CAGAAGAAACAGCAGATGCAAGG + Intergenic
932057476 2:68461224-68461246 CAGGGGAAAGAACAATTGCAGGG - Exonic
932112876 2:69017423-69017445 CAGGGGAAGAAGGAGTTGCAGGG - Intronic
932563028 2:72888758-72888780 CAGGGGAAATAGAGGTGGCAGGG + Intronic
932682242 2:73836319-73836341 CAGGAGCAGCAGCTGTTGCAGGG + Intronic
937315644 2:120930602-120930624 CAGGGGACACTGCTGCTGCTTGG - Intronic
937370733 2:121295613-121295635 CAGGGGCACCAACTGTGGCAGGG + Intergenic
938629931 2:133155452-133155474 CCAGGGAAAGAGCTGTGGCAGGG - Intronic
939506100 2:143049345-143049367 CAGGCAAAACAGCTGATGCAGGG - Exonic
940028446 2:149234344-149234366 TTGGGGAAACAGGTGTTTCATGG - Intergenic
940553613 2:155193801-155193823 CAAAGGACACAGCTGGTGCAGGG - Intergenic
940983114 2:160024711-160024733 CAAGGGAAACAGCATTGGCAAGG + Intronic
941955495 2:171200058-171200080 CAGGGGAAAAAACTCTTGCTTGG - Intronic
943791092 2:191933435-191933457 AAGGTGGAACAGCTGTTGGAGGG + Intergenic
943791103 2:191933472-191933494 AAGGTGGAACAGCTGTTGGAGGG + Intergenic
944458827 2:199922807-199922829 AAGGGGCAATAGCTGATGCAAGG - Intronic
945386572 2:209209143-209209165 TCTGGGAAACAGGTGTTGCAGGG + Intergenic
945888479 2:215402419-215402441 TAGGGGAAAAAGCTGTTTCTGGG - Intronic
946969893 2:225079923-225079945 CAGGGCAAACAGTTTGTGCAAGG - Intergenic
947938298 2:234026128-234026150 CAGGGGACAGAGCTATTGCTTGG - Intergenic
948017520 2:234702299-234702321 AAGGGGAAACACCTTTTGCTTGG + Intergenic
948057421 2:235019021-235019043 CAGAGGGAACAGCTAGTGCAAGG + Intronic
948284601 2:236773924-236773946 CTGGGGAACCAGCTGTGGCTGGG + Intergenic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
1168756432 20:321618-321640 CAGAGGAAACAGCAAGTGCAAGG - Intergenic
1168767030 20:388613-388635 CAGGGGGAACAGCTGTTCAAAGG + Intronic
1169561278 20:6803250-6803272 CAGTGGAGGCAGCTGTTGCATGG - Intergenic
1172229248 20:33326023-33326045 CAGGGGAAACCCCTTTTGCTTGG - Intergenic
1172509778 20:35492536-35492558 CAGAGGAAACACCTGTCGCAAGG + Intronic
1174286742 20:49479461-49479483 CAGCGGAAACAGCAAGTGCAAGG + Intronic
1174438339 20:50528075-50528097 CAGAGGAAACAGCATATGCAAGG - Intronic
1175522378 20:59610177-59610199 CTGGGGAAGCAGAGGTTGCATGG + Intronic
1176038408 20:63051543-63051565 CAGAGGAATCAGCTGTTCGAAGG - Intergenic
1177333606 21:19694704-19694726 CAGGGGCAACAGAAGTAGCATGG + Intergenic
1178594499 21:33940864-33940886 CAGGGGAGGCAGCTGGTGCCAGG + Intergenic
1178881319 21:36452481-36452503 CAGAGGAAACAGATGATTCAGGG - Intergenic
1178909113 21:36660011-36660033 CAGGGGAGTGAGCTGGTGCATGG - Intergenic
1179021065 21:37641615-37641637 CAGAGGGAACAGCATTTGCAGGG + Intronic
1179255813 21:39714326-39714348 CAAGGGAAACAGTAGATGCAAGG - Intergenic
1181451805 22:23027670-23027692 CAGGGTAAACAGATCTTACATGG - Intergenic
1182015790 22:27038648-27038670 CAGAGGAAACAGCAGGTGCAAGG + Intergenic
1182159076 22:28103777-28103799 CAGGCAAACCAGCTGTTTCATGG + Intronic
1182752211 22:32650908-32650930 CTGGGGAAGCAGCTGTTATAAGG - Intronic
1183086863 22:35491910-35491932 CAGGGGACACATCTGGGGCAGGG - Intergenic
1183517424 22:38274891-38274913 CAGAGGGAACAGCTAGTGCAGGG - Intergenic
1183781012 22:39998862-39998884 CAGGGGAAGTTGCTGATGCATGG + Intronic
1184011884 22:41755025-41755047 CAGGAGGAACAGCAGCTGCAGGG + Intronic
1184491870 22:44814584-44814606 CAGTGGAGGCAGCTGTTTCAGGG + Intronic
1185238568 22:49728431-49728453 CAGAGGAAACAGATGTTACAGGG - Intergenic
949554364 3:5140348-5140370 AAGGGGAAACCCCTTTTGCATGG + Intronic
950024839 3:9813127-9813149 CAGGAGCAACAGCTGTGGAAAGG - Intronic
950456987 3:13098610-13098632 CAGAGGAAACAGCAGTGGAAAGG + Intergenic
950825054 3:15809929-15809951 CAGAGGAAACAGCATCTGCAAGG - Intronic
951801862 3:26604779-26604801 AAGGGGAAACACCTTTTGCTTGG - Intergenic
954310801 3:49765572-49765594 CATGGGAATCAGAGGTTGCAGGG + Intronic
954409611 3:50364723-50364745 CAGGAGGAGCAGCAGTTGCAGGG + Exonic
954660461 3:52224274-52224296 CAGGAGAGACAGCGGGTGCAGGG + Exonic
955127028 3:56123040-56123062 AATGGGCAACAGCTGTTTCAAGG - Intronic
956039882 3:65134673-65134695 AATGGGAAACAGTTATTGCAGGG - Intergenic
956961167 3:74402890-74402912 CAGAGGGAACAGCTAATGCAAGG + Intronic
961630459 3:128294756-128294778 CAGAGGAAACAGCATATGCAAGG + Intronic
962187732 3:133277768-133277790 TTGGGGAAATATCTGTTGCATGG - Intronic
962379267 3:134884056-134884078 CAGGGCACACAGCTCTAGCACGG - Intronic
964514091 3:157488442-157488464 CAGGTGAATAAGCTGTTGCAAGG - Intronic
965857414 3:173105024-173105046 CAGGGAAAACTGGTCTTGCAGGG - Intronic
967349596 3:188498030-188498052 CTAGGGAAATGGCTGTTGCATGG + Intronic
967750928 3:193115548-193115570 CAGCTGAAACAGCTGTTGAGAGG - Intergenic
968753207 4:2401147-2401169 CAGGGGAAACATTTGCTCCATGG + Intronic
969543279 4:7807423-7807445 CAGAGGAAACAGCTGTAGCACGG - Intronic
970403654 4:15741788-15741810 CAGTGGCAACAGAGGTTGCATGG + Intergenic
970518745 4:16861795-16861817 CAGGGGGAACAGCATGTGCAAGG - Intronic
972822589 4:42718807-42718829 CTGGGAAAACAGATGTTTCAGGG + Intergenic
972958476 4:44421775-44421797 CATCAGAAACAGATGTTGCATGG - Intronic
974582098 4:63815996-63816018 TAGTGGAAACAGCAGTTGCTGGG - Intergenic
975371967 4:73599508-73599530 CTGGGAAAACAGCTGTGGTAAGG + Intronic
976875744 4:89851376-89851398 AAGGGGAGAGAGCTTTTGCAGGG + Intergenic
977475292 4:97499786-97499808 CAGCAGAAACAGCTAGTGCAAGG + Intronic
977785047 4:101023036-101023058 CAGGAAAAACAGCTGATGCAGGG + Intergenic
978482542 4:109210741-109210763 CAGGGGAAACAGCTGGAACATGG - Intronic
978724934 4:111958530-111958552 CATAGGGAACAGCTGATGCAAGG - Intergenic
979368136 4:119849297-119849319 AAGGGGAAACCGCTTTTGCCTGG - Intergenic
981497712 4:145412260-145412282 CAGAAGAAACAGCTAGTGCAAGG - Intergenic
982336610 4:154246586-154246608 CAGTGGAAACAGATATTGAAAGG + Intronic
983521385 4:168712544-168712566 CAATGGAAACAGCTCATGCAAGG - Intronic
984316968 4:178140849-178140871 TAGGGCACACAACTGTTGCAGGG - Intergenic
986308856 5:6536334-6536356 CAGGGAAAACAGCAGGTCCAGGG - Intergenic
986367191 5:7044202-7044224 CAAGGGAAAGAGCAATTGCAGGG - Intergenic
986610473 5:9562034-9562056 CAGGAGAAAGAGCGCTTGCAGGG + Intergenic
986693114 5:10330391-10330413 CAGGGAGAACAGCTAATGCAAGG - Intergenic
987116833 5:14732341-14732363 CAGGGGTCACATCTGTGGCAGGG + Intronic
990363220 5:55042700-55042722 AACGGGAAACCGCTTTTGCATGG + Intergenic
991004856 5:61817977-61817999 CACGGGAAACTGCAGTTCCAAGG + Intergenic
991413893 5:66371609-66371631 CAGGTGAAACAGCAGTGGCCAGG - Intergenic
993615645 5:90108614-90108636 AAGGTAACACAGCTGTTGCATGG + Intergenic
995799544 5:115979131-115979153 TAGGGGACACAGCTCTTGCAAGG + Intronic
996414185 5:123191881-123191903 CAGGTTAAACATCTGTGGCAAGG - Exonic
996455977 5:123681395-123681417 CTGGGAAGATAGCTGTTGCATGG + Intergenic
998174477 5:139893528-139893550 CTGGGGAAGGAGCTGCTGCAGGG - Intronic
998427240 5:142039319-142039341 CTGGGGAAACAGCAGTGCCAAGG - Intergenic
998697230 5:144653834-144653856 CAGGCAAAAGAGCTGGTGCAGGG + Intergenic
999941629 5:156549227-156549249 GAGGGAAAACATCTGTTCCATGG + Intronic
1001106717 5:168860786-168860808 CAGGGGAAACAGCTTAAGAATGG - Intronic
1001122583 5:168992544-168992566 CAGGGGAACCTTCTGTTGAATGG + Intronic
1001233960 5:170013947-170013969 AAGGGGAAATAGCTGTAGAATGG + Intronic
1001245088 5:170100205-170100227 TATGGAAAACAGCTGCTGCAGGG - Intergenic
1001570340 5:172726717-172726739 CAGAGGGAACAGCTGTGGCGAGG - Intergenic
1001695678 5:173667998-173668020 CAGGGGAAGCAGCTATTGAGGGG + Intergenic
1002190664 5:177475815-177475837 CAGGGGCAACAGCAGCTGAAAGG - Intergenic
1002346188 5:178548626-178548648 GATGGGAAACAGAGGTTGCAGGG - Intronic
1003560843 6:7178511-7178533 AAGGGGAAGAAGCTGGTGCAAGG - Intronic
1005585153 6:27269092-27269114 GAGCGGAAACTGCAGTTGCACGG - Intergenic
1005831643 6:29675867-29675889 CAGGGAAACCAGATGTTCCAGGG + Intronic
1006698702 6:35954239-35954261 CCGGGGACACAGCTTTTGAAGGG + Intronic
1006878361 6:37317831-37317853 CAGAGGAAACAGCCAGTGCAGGG + Intronic
1007375968 6:41456909-41456931 CTGGGTAAACAGCTGCTGCTGGG + Intergenic
1007901926 6:45421448-45421470 CAAGGGAAAAAGATTTTGCAGGG - Intronic
1010164308 6:72897464-72897486 CCTGGGAGACAGCTGTTGCGGGG + Intronic
1010389206 6:75318036-75318058 CAGAGGACACAGCATTTGCAAGG - Intronic
1011203194 6:84861011-84861033 CAGGGGAAAAAGCTGGGTCAAGG + Intergenic
1011551099 6:88531587-88531609 CAGGGGCCTCAGCTGTTGCTGGG - Intergenic
1011714873 6:90094785-90094807 CAGGGGAACCAGAAGTGGCATGG - Intronic
1012210408 6:96511172-96511194 GAGGGGAAAGAACTGTTGAAAGG - Intergenic
1014222858 6:118815826-118815848 CAGGAGAGACAGGTGTTCCATGG - Exonic
1014664718 6:124222746-124222768 CAGGTGAAAAATGTGTTGCATGG + Intronic
1015879711 6:137859205-137859227 CAAAGTAAACAGCTGTAGCAAGG + Intergenic
1018098731 6:160417383-160417405 CTGGGGAAACAGCTTTTTCTTGG - Intronic
1018260695 6:161967916-161967938 TAGAGGAAACAGCTGTCTCAGGG + Intronic
1019594418 7:1851866-1851888 CAGGCGAACCAGCTGTTGGCAGG - Intronic
1022594264 7:31697115-31697137 CAGGTAAAAAAGCTGGTGCAGGG + Exonic
1022835495 7:34109896-34109918 AAGGGGAAAGAGATTTTGCAAGG - Intronic
1023462401 7:40413247-40413269 ATGGGGAAACTGCTGTTCCATGG + Intronic
1023717190 7:43056326-43056348 CAGGGGAAGCATCTGGAGCATGG - Intergenic
1024448388 7:49509441-49509463 CTATGGAAACAGCTGTTGCAGGG - Intergenic
1024749050 7:52442289-52442311 CATGGGGATCAGTTGTTGCATGG - Intergenic
1024886040 7:54143935-54143957 CAGGAGAAATGGCTGTTGCTAGG + Intergenic
1029189466 7:98761487-98761509 CAGGGGAAACAGCCAGTGCAAGG + Intergenic
1029214305 7:98934828-98934850 CAGAGGAAACCACTGTTGCTAGG - Intronic
1029672384 7:102042382-102042404 CAGGAGAAAGAGCTCTTTCAGGG - Intronic
1031574429 7:123398233-123398255 CAGAGGTGACAGATGTTGCAAGG - Intergenic
1033530365 7:142256870-142256892 CAGAGGCAACAGCTGCAGCATGG + Intronic
1034006608 7:147479003-147479025 AAGGGGAAAGGGCTGTGGCATGG + Intronic
1035571007 8:672137-672159 GATGGGAAACACCTGTTGAAGGG - Intronic
1038145141 8:24888391-24888413 CAGGGGAAACAGCAGGTGATGGG + Intergenic
1038625907 8:29193103-29193125 CAGGGGAGACACCTGTTCCCTGG + Intronic
1039819696 8:41124766-41124788 CAGGGGAAGCAGCTGCTCCCCGG - Intergenic
1040879312 8:52188376-52188398 CAGCAGAAACAGCAGGTGCAAGG + Intronic
1041624390 8:60008829-60008851 CAAGGGAGACACCTGTTGGAAGG - Intergenic
1042022134 8:64379284-64379306 AAGGGGAAAAAGCAATTGCAGGG + Intergenic
1042770265 8:72372895-72372917 CAGAAGAAACAGCATTTGCAAGG - Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1044740457 8:95321244-95321266 CAGGGGAAGCAGGTGTTAGAAGG - Intergenic
1046661998 8:116957862-116957884 GAAGGGAAAAAGCTGGTGCATGG - Intronic
1047635468 8:126756868-126756890 CAGAGGAAACAGCACGTGCAGGG - Intergenic
1047915745 8:129582174-129582196 CAGGGGAAGGAGCCGTGGCATGG + Intergenic
1047919447 8:129618825-129618847 GAGGATAAACACCTGTTGCATGG - Intergenic
1048616430 8:136080286-136080308 AAGGGGTAACAGCGGTTGCCTGG - Intergenic
1049401655 8:142430337-142430359 CAGGGGAAACACAGGTTGCAGGG - Intergenic
1050076654 9:1872761-1872783 GAGGTGACACAGCTGTGGCAGGG - Intergenic
1050798912 9:9584221-9584243 AAGGGGAGACAGAGGTTGCAGGG - Intronic
1051278378 9:15418215-15418237 CTTGGGAAACAGCAGGTGCAAGG + Intergenic
1053164506 9:35835064-35835086 CAGGGGACACAGCTGTGCCTGGG + Exonic
1054451213 9:65404429-65404451 CAGGGGAAGAAGCTGGGGCAGGG - Intergenic
1057080766 9:92172914-92172936 CAGGGGCACCAGCAGGTGCAAGG - Intergenic
1058364939 9:104198198-104198220 CAGGGGGAAAAGATGTTGTATGG - Intergenic
1059929420 9:119246399-119246421 CAGGGGAAAAAGATGTAGCCTGG - Intronic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1061729672 9:132604083-132604105 CAGTGGAAACTGGTTTTGCATGG + Intronic
1062068766 9:134543915-134543937 CAGGGGACACAGATGTCGTAGGG + Intergenic
1062342126 9:136098410-136098432 CAGTGGGAACAGCGGGTGCAAGG - Intergenic
1185579255 X:1197924-1197946 CGTGGGAGACAGATGTTGCAGGG + Intronic
1185710605 X:2300606-2300628 CACGGGAGAAAGCTGTAGCATGG - Intronic
1186713636 X:12227269-12227291 TAGTGGAAACAGCTCTTGCATGG + Intronic
1188533755 X:31171697-31171719 CAGGGAACACAGCTATGGCAGGG - Intronic
1189332301 X:40151635-40151657 CAGAGGTAACAGCTGTGGAAGGG + Intronic
1189654919 X:43234958-43234980 CAGGGAAAACAGATCTTTCACGG + Intergenic
1190320124 X:49175156-49175178 GAGTGGAAACAGCTGGGGCAAGG + Exonic
1191206099 X:57835395-57835417 GAGGGGGATCAGCTGCTGCATGG - Intergenic
1192309570 X:69998783-69998805 AAGGGGAAACATGTGTTGCTTGG + Intronic
1194535413 X:95100810-95100832 TAGGAGAAACAGCTGATTCAAGG + Intergenic
1196824727 X:119732109-119732131 CAAGGGAAGCAGGAGTTGCAAGG + Intergenic
1199523653 X:148767094-148767116 CAGGTAAAACAGTTGTTGCCAGG + Intronic
1199849715 X:151716750-151716772 CAGAGGAAACAGCAAATGCAAGG - Intronic
1200283581 X:154799839-154799861 CAGAGGAAACATCTGCAGCAGGG + Intronic