ID: 1163508963

View in Genome Browser
Species Human (GRCh38)
Location 19:17724218-17724240
Sequence GGCTGACGTCCTGGAGGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 373}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163508950_1163508963 14 Left 1163508950 19:17724181-17724203 CCCATCAGACAAGTCCCTGTATG 0: 1
1: 0
2: 0
3: 7
4: 94
Right 1163508963 19:17724218-17724240 GGCTGACGTCCTGGAGGGGGCGG 0: 1
1: 0
2: 1
3: 29
4: 373
1163508951_1163508963 13 Left 1163508951 19:17724182-17724204 CCATCAGACAAGTCCCTGTATGA 0: 1
1: 0
2: 0
3: 6
4: 125
Right 1163508963 19:17724218-17724240 GGCTGACGTCCTGGAGGGGGCGG 0: 1
1: 0
2: 1
3: 29
4: 373
1163508947_1163508963 29 Left 1163508947 19:17724166-17724188 CCTGGTCCTCCTGAACCCATCAG 0: 1
1: 0
2: 1
3: 20
4: 202
Right 1163508963 19:17724218-17724240 GGCTGACGTCCTGGAGGGGGCGG 0: 1
1: 0
2: 1
3: 29
4: 373
1163508956_1163508963 -1 Left 1163508956 19:17724196-17724218 CCTGTATGATGAGGTAGGGAATG 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1163508963 19:17724218-17724240 GGCTGACGTCCTGGAGGGGGCGG 0: 1
1: 0
2: 1
3: 29
4: 373
1163508955_1163508963 0 Left 1163508955 19:17724195-17724217 CCCTGTATGATGAGGTAGGGAAT 0: 1
1: 0
2: 0
3: 6
4: 142
Right 1163508963 19:17724218-17724240 GGCTGACGTCCTGGAGGGGGCGG 0: 1
1: 0
2: 1
3: 29
4: 373
1163508949_1163508963 20 Left 1163508949 19:17724175-17724197 CCTGAACCCATCAGACAAGTCCC 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1163508963 19:17724218-17724240 GGCTGACGTCCTGGAGGGGGCGG 0: 1
1: 0
2: 1
3: 29
4: 373
1163508948_1163508963 23 Left 1163508948 19:17724172-17724194 CCTCCTGAACCCATCAGACAAGT 0: 1
1: 0
2: 0
3: 14
4: 122
Right 1163508963 19:17724218-17724240 GGCTGACGTCCTGGAGGGGGCGG 0: 1
1: 0
2: 1
3: 29
4: 373
1163508946_1163508963 30 Left 1163508946 19:17724165-17724187 CCCTGGTCCTCCTGAACCCATCA 0: 1
1: 0
2: 0
3: 14
4: 225
Right 1163508963 19:17724218-17724240 GGCTGACGTCCTGGAGGGGGCGG 0: 1
1: 0
2: 1
3: 29
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163508963 Original CRISPR GGCTGACGTCCTGGAGGGGG CGG Intronic
900155033 1:1200504-1200526 GGGAGACGGGCTGGAGGGGGCGG - Intergenic
900210895 1:1455447-1455469 GGCTGACCTGCTGGAGGGGAAGG - Exonic
900216718 1:1485766-1485788 GGCTGACCTGCCGGAGGGGAAGG - Exonic
900223800 1:1523495-1523517 GGCTGACCTGCCGGAGGGGAAGG - Exonic
900242864 1:1625227-1625249 GGCTGAAGTCCCAGAGGGGAGGG + Intronic
900408976 1:2504393-2504415 GGATGACATGCTGGAGGAGGAGG - Exonic
900599430 1:3496774-3496796 GGCGGACATCCTGCAGGGAGAGG + Exonic
901634928 1:10666139-10666161 GGCTGACGTGCTCGGGTGGGAGG - Intronic
901703283 1:11056748-11056770 GGATGACATCCTGGAGGGGATGG + Exonic
902337895 1:15764502-15764524 GGCTGAAGTCCTGGAGGTTCAGG - Exonic
902338469 1:15767450-15767472 GGCAGAAGCACTGGAGGGGGCGG - Exonic
902394131 1:16123218-16123240 GGAAGACTTCCTGGAGGAGGTGG - Intergenic
902534747 1:17113040-17113062 GGATGACTTCCTGGAAGAGGTGG - Intronic
903262432 1:22138722-22138744 GGCACACTTCCTGGAGGAGGTGG + Intronic
903588026 1:24431851-24431873 GGCTGAAGACCTGGAGTGGTGGG - Intronic
903694616 1:25197631-25197653 GGCTGACATCTTGGAGGTGCCGG - Intergenic
904255490 1:29251902-29251924 GGAGGACTTCCTGGAGGAGGAGG - Intronic
904282711 1:29432611-29432633 AGCAGATGTCCTGGAGGTGGAGG + Intergenic
904313967 1:29648037-29648059 AGCTCACATTCTGGAGGGGGAGG + Intergenic
905945524 1:41898318-41898340 GGCAGTCTCCCTGGAGGGGGAGG + Intronic
906287233 1:44595339-44595361 CCCGGGCGTCCTGGAGGGGGTGG - Intronic
906290892 1:44618622-44618644 GGAGGACGTCCTTGATGGGGTGG + Intronic
907286761 1:53385442-53385464 CGCTTCCGTCCTGGAGGGAGTGG - Intergenic
907312608 1:53547570-53547592 TGGTGACGTTCTGGAGGGGTAGG - Intronic
907409420 1:54274007-54274029 GGCGGAGGAGCTGGAGGGGGTGG + Intronic
915289553 1:154874056-154874078 GGGTGGCTTCCTGGAGGTGGTGG + Intergenic
915461762 1:156074810-156074832 GGCTGGTGTTCTGGAGGGGAAGG + Exonic
915559270 1:156676991-156677013 GGCTGAAGAGCTGGAGGGCGTGG - Exonic
915583607 1:156831094-156831116 GGCTTACGTCCTAGAGAGGAGGG + Intronic
915748880 1:158185977-158185999 GGAAGGCGTCCTGGAGGGAGGGG + Intergenic
916057023 1:161074841-161074863 GGGTGACGTCATGGGGGTGGAGG - Intronic
916060951 1:161098416-161098438 GGCTGGCGTCCGGTAGGGGGAGG + Exonic
916588419 1:166167019-166167041 GGCTGCCGTCCGGGTGGGGGGGG + Intergenic
917110280 1:171540650-171540672 GGCTGAGGTGGTGGTGGGGGAGG - Exonic
917789104 1:178488164-178488186 GGCTGAGGCCCTGGGGGAGGTGG - Intergenic
918241382 1:182623347-182623369 GGCTGAGGTCCTGGACTGGAGGG + Intergenic
919843476 1:201626290-201626312 GGCTGAGGTGCTGGGGCGGGTGG - Intronic
921939472 1:220825131-220825153 GGCTTGAGTCCTGGAGGCGGAGG - Intergenic
924740778 1:246793322-246793344 GGCTGCTGGACTGGAGGGGGAGG + Intergenic
924947711 1:248857488-248857510 GGCTCAGGACCTGGAGGGGTGGG + Exonic
1063365028 10:5485457-5485479 AGCTCACGTCCTGGTGGGGTGGG + Intergenic
1069775066 10:70922027-70922049 GGCTGACTTTCTAGAGGAGGTGG - Intergenic
1069848743 10:71391321-71391343 GGCTGACATCTTGGAGGAAGGGG - Intergenic
1069863563 10:71486352-71486374 GGAAGGCTTCCTGGAGGGGGTGG + Intronic
1070388856 10:75951359-75951381 AGCCGACTTCCTGGAGGAGGTGG + Intronic
1070706992 10:78646966-78646988 GGAAGACTTCCTGGAGGGGATGG - Intergenic
1070969997 10:80555596-80555618 AGCTGAGGTCATGGAGGAGGAGG + Intronic
1071565884 10:86671060-86671082 GGCTCAGGTCCTGGCTGGGGTGG - Intronic
1073466255 10:103696126-103696148 GGCTGAGGTCCTGGCAGTGGGGG + Intronic
1073468229 10:103706832-103706854 GGATGACCTCCTGGAGGAAGTGG - Intronic
1074701001 10:116092542-116092564 GTCTGACTTCCTGGTGGGAGGGG - Intronic
1074950775 10:118332566-118332588 GGCTGGCTTCCTTGAGTGGGTGG - Intronic
1075469022 10:122673862-122673884 GGCTGAAATCCTGGCAGGGGAGG - Intergenic
1076462421 10:130656101-130656123 GGCGGACGTGCAGGTGGGGGTGG + Intergenic
1076462440 10:130656147-130656169 GGCGGACGTGCAGGTGGGGGTGG + Intergenic
1076462459 10:130656193-130656215 GGCGGACGTGCAGGTGGGGGTGG + Intergenic
1076471931 10:130725049-130725071 GACACACGTGCTGGAGGGGGTGG - Intergenic
1076727899 10:132421856-132421878 GGCTGAAGGCCTGGAGCCGGAGG + Intergenic
1076826429 10:132971928-132971950 GGCGCACGTCCTGGAGGAAGAGG + Intergenic
1077011240 11:380279-380301 TGCTGGCGTCCTGGGGGGTGCGG - Exonic
1077165119 11:1131331-1131353 AGCTGGCTTCCTGGAGGTGGTGG - Intergenic
1077514870 11:2995395-2995417 GGCTCTGGCCCTGGAGGGGGCGG + Intergenic
1078190524 11:9090070-9090092 GGCAGGCTTCCTGGAGGAGGTGG - Intronic
1078422554 11:11224315-11224337 GGCTGACATCCTGGGGGCTGTGG - Intergenic
1079010834 11:16826771-16826793 GGGTGGCTTCCTGGAGGAGGTGG - Intronic
1081152266 11:39647581-39647603 GGCTGACCTCTAGGAGGGTGTGG - Intergenic
1081684533 11:45032925-45032947 GGAAGACCTCCTGGAGGAGGGGG - Intergenic
1083659783 11:64246718-64246740 GGCGGGCGTCCCGGAGGCGGTGG - Exonic
1083736412 11:64684053-64684075 AGCTGAAGTCCTGGAAGGGCAGG + Intronic
1083811200 11:65107954-65107976 GGCAGTCGTCCTGGATGGCGCGG - Exonic
1084170129 11:67396996-67397018 TGGTGACTTCCTGGAGGGGGTGG - Intronic
1084174269 11:67415535-67415557 GGCTGACGGGCGGGGGGGGGGGG + Intronic
1084335829 11:68457424-68457446 GGAGGACTTCCTGGAGGAGGAGG - Intergenic
1084484412 11:69439438-69439460 GGAAGACTTCCTGGAGGAGGGGG - Intergenic
1084554096 11:69865524-69865546 GGCAGACTTCCTGGAGGAGGTGG - Intergenic
1084661926 11:70551067-70551089 GGATGAGGTCTCGGAGGGGGTGG - Intronic
1084681424 11:70668689-70668711 GGAAGACTTCCTGGAGGAGGAGG + Intronic
1085503292 11:77041219-77041241 GGCTGACTTCTTGGGGGAGGGGG - Exonic
1085745748 11:79112819-79112841 GGAAGACTTCCTGGAGGAGGTGG - Intronic
1089167134 11:116485924-116485946 GGCTGATGTCCAGAAGGAGGAGG + Intergenic
1089352674 11:117830307-117830329 TGCGGAGGTCCTGGAGGGTGAGG - Intronic
1089369153 11:117941751-117941773 AGCTGAGGTCCTAGACGGGGAGG + Intergenic
1089556220 11:119317152-119317174 GGCTGACGTCAGGGGGGCGGGGG + Intronic
1089671052 11:120057250-120057272 GCCTGATGCCCTGGAGGGGTGGG + Intergenic
1090105649 11:123851723-123851745 GGCTGTGGTCCTGGGGGTGGGGG + Intergenic
1090470624 11:126978039-126978061 GGCTGCCGTGCTGGAGAAGGAGG - Intronic
1091356439 11:134941297-134941319 TGCTGCTGTCCTGGAGGGTGGGG + Intergenic
1092218882 12:6700062-6700084 TGCGGGCTTCCTGGAGGGGGCGG - Intronic
1092232005 12:6781141-6781163 GGCTGCGGTCCTGGAGGGGAAGG + Intergenic
1092252139 12:6905386-6905408 GGGTGACATCCTGAAGGGAGGGG + Intronic
1100686412 12:96991372-96991394 AGCTGACATCCTGAAGGGAGGGG + Intergenic
1101343652 12:103865138-103865160 GGCTGTCCTCCTGGAGGATGAGG + Intergenic
1101849452 12:108390672-108390694 GGCAGGCTTCCTGGAGGAGGAGG + Intergenic
1102896757 12:116604311-116604333 GGCGGCTGTCCGGGAGGGGGAGG + Intergenic
1103379039 12:120479591-120479613 GGAAGACTTCCTGGAGGGAGTGG + Intronic
1104072756 12:125360710-125360732 GGCAGGCCTCCTGGAGGAGGAGG + Intronic
1113711252 13:112466847-112466869 GGCTGGTGTCCTGGGGGAGGAGG - Intergenic
1113870058 13:113553848-113553870 AGGTGACTTGCTGGAGGGGGAGG - Intronic
1115819879 14:37202583-37202605 GTCTGAAGCCCTGGAGGGAGGGG - Intronic
1117958381 14:61140227-61140249 GGCTCACCTCCTGGTGGGGTTGG - Intergenic
1118121956 14:62855611-62855633 GGCAGAGGTCCTGGAGGAAGAGG + Intronic
1118323548 14:64767094-64767116 GGCTGAAGGCCTGGTGCGGGAGG - Intronic
1121092181 14:91190518-91190540 GGAAGACCTCCTGGAGGAGGTGG + Intronic
1121115458 14:91339764-91339786 TGCTGAGGTTCTGGTGGGGGTGG - Intronic
1121634497 14:95444748-95444770 GGAAGGCTTCCTGGAGGGGGTGG - Intronic
1122297570 14:100713938-100713960 GGGGGACTTCCTGGAGGAGGTGG + Intergenic
1122319566 14:100845612-100845634 GGCGGACCTCGTGGAGGGGCTGG + Intergenic
1122324545 14:100874713-100874735 CTCTGACTTCCTGGAGGGGAGGG + Intergenic
1122911053 14:104827721-104827743 GCCTGCAGTCCTGGAGGGGCAGG + Intergenic
1123025938 14:105424043-105424065 GTGTGATGTCCTGGAGGGGATGG + Intronic
1123476518 15:20595334-20595356 AGGTGACATCCTGGAGGGGTGGG - Intergenic
1123641493 15:22405030-22405052 AGGTGACATCCTGGAGGGGTGGG + Intergenic
1124834290 15:33180831-33180853 GGCTGAAACCCTGGAGGGGGAGG - Intronic
1124962333 15:34408417-34408439 GTGGGACGTCCTGGAGGGTGTGG - Intronic
1124978957 15:34554639-34554661 GTGGGACGTCCTGGAGGGTGTGG - Intronic
1128538611 15:68509340-68509362 AGCTTACATTCTGGAGGGGGAGG + Intergenic
1129673243 15:77618458-77618480 GGATGGCCTCCTGGAGGAGGTGG - Intronic
1129676927 15:77636740-77636762 GGCTGAAGTCCAGAAGGTGGGGG + Intronic
1131224578 15:90613097-90613119 GGCTGAGGCCCAGGAGGTGGAGG + Intronic
1131266136 15:90916374-90916396 GGCTGAATTCCTGGGGTGGGGGG + Intronic
1132673780 16:1113433-1113455 GGCTGATGTGGTGGAGGTGGTGG + Intergenic
1132903432 16:2270577-2270599 GGCTGAGCTCCTGGAAGGGCAGG - Intergenic
1133039014 16:3050052-3050074 GCCTGACGTGCTGGGGGTGGCGG + Exonic
1133147823 16:3803251-3803273 GGCTGACGGCGGGGAGGGGGGGG + Intronic
1133271237 16:4611771-4611793 GGCTGAGGCCCTGCAGGGGTGGG + Intronic
1133774703 16:8887486-8887508 GGCTGAAGGCCTGGAGGAGGGGG + Intergenic
1136043960 16:27601258-27601280 GTCTGGCGTCCTGATGGGGGAGG + Intronic
1136092069 16:27927688-27927710 GGAGGACTTCCTGGAGGAGGTGG - Intronic
1136576054 16:31126011-31126033 GTCAGGCCTCCTGGAGGGGGTGG + Intronic
1138087000 16:54142429-54142451 GGGTGGCCTCCTGGAGGAGGTGG + Intergenic
1139476291 16:67204139-67204161 GGCTGGTGTTCTGAAGGGGGTGG + Intergenic
1139547001 16:67654070-67654092 GGCTGCCGGCCGGGGGGGGGGGG + Intronic
1140218015 16:73023806-73023828 GGCTGACGTCGTGGTGTGTGTGG - Intronic
1141175766 16:81718024-81718046 GGGAGACTTCCTGGAGGAGGTGG + Intergenic
1141491986 16:84379958-84379980 GGAAGACTTCCTGGAGGAGGTGG + Intronic
1141605792 16:85152605-85152627 GGCTGGCTGCCTGGAGGAGGGGG + Intergenic
1141623360 16:85248817-85248839 GGCTGAGGTCCTGGGAGGTGTGG + Intergenic
1142175036 16:88641163-88641185 GGAAGACTTCCTGGAGGTGGTGG + Intergenic
1142622321 17:1172948-1172970 GGCTGAGGTGATGGGGGGGGTGG - Intronic
1142622401 17:1173304-1173326 GGCTGAGGTGATGGGGGGGGTGG - Intronic
1143147497 17:4786124-4786146 GGCGTAGGTCCTGGAGAGGGCGG - Intronic
1143374941 17:6461867-6461889 GGCTTTCTTCCTGGAGGAGGAGG - Intronic
1143378105 17:6479106-6479128 GGCAGACTTCCTGGAGGAGGTGG + Intronic
1144875466 17:18394903-18394925 GGCTGACTCCCAGGAGGGGCAGG - Intergenic
1145127424 17:20313902-20313924 GACTGAAGTCCTTGAGGGGAAGG + Intronic
1145156759 17:20549518-20549540 GGCTGACTCCCAGGAGGGGCAGG + Intergenic
1146844270 17:36173606-36173628 GGCTGACTCCCAGGAGGGGCAGG + Intronic
1146856575 17:36261541-36261563 GGCTGACTCCCAGGAGGGGCAGG + Intronic
1146864042 17:36326834-36326856 GGCTGACTCCCAGGAGGGGCAGG - Intronic
1146879843 17:36436537-36436559 GGCTGACTCCCAGGAGGGGCAGG + Intronic
1147066902 17:37927422-37927444 GGCTGACTCCCAGGAGGGGCAGG - Intronic
1147075369 17:37986076-37986098 GGCTGACTCCCAGGAGGGGCAGG + Intronic
1147078434 17:38006983-38007005 GGCTGACTCCCAGGAGGGGCAGG - Intronic
1147086894 17:38065622-38065644 GGCTGACTCCCAGGAGGGGCAGG + Intronic
1147094372 17:38130918-38130940 GGCTGACTCCCAGGAGGGGCAGG - Intergenic
1147102839 17:38189585-38189607 GGCTGACTCCCAGGAGGGGCAGG + Intergenic
1148732471 17:49845873-49845895 CACTGACGTCCTGGTGGGGTGGG - Intronic
1148838633 17:50479937-50479959 GGCTGCTGTCCTGGAGGCTGTGG + Exonic
1149730961 17:58945815-58945837 GGGTGAGGTCCTGAAGGGGAAGG + Intronic
1149847413 17:60016052-60016074 GGCTGACTCCCAGGAGGGGCAGG + Intergenic
1150085771 17:62272669-62272691 GGCTGACTCCCAGGAGGGGCAGG + Intronic
1150664799 17:67123085-67123107 GGGTGAGGTCCAAGAGGGGGTGG + Exonic
1150910117 17:69379022-69379044 GGCTTGAGTCCTGGAGGTGGAGG + Intergenic
1151567185 17:74905216-74905238 GACTGACTTACTGGAGGTGGGGG - Intergenic
1151715466 17:75828886-75828908 GGCCGACGACCTGGAAGGCGAGG - Exonic
1152339480 17:79716292-79716314 GGCTGACACCCAGGAGGCGGTGG + Intergenic
1152516698 17:80829307-80829329 GGCTGGTGTCCAGGAGGGCGCGG + Intronic
1154498210 18:14978008-14978030 TGCTGCTGTCCTGGAGGGTGGGG - Intergenic
1155583978 18:27343737-27343759 GGCTGAGGTGCTGGAGAGGATGG - Intergenic
1157876496 18:51278774-51278796 GGAAGACTTCCTGGAGGTGGTGG - Intergenic
1159310367 18:66699719-66699741 GGTTCACGTCCTGGATGGGATGG + Intergenic
1160014852 18:75132815-75132837 TGCTGATGTCGTGGAAGGGGTGG + Intergenic
1160134351 18:76259886-76259908 GGCGGAGGTCATGGAGGGGCCGG + Exonic
1160768712 19:821174-821196 GGCTGGGGGCCTGGAGGGGGCGG - Intronic
1161067990 19:2247908-2247930 GGCAGGCCTCCTGGCGGGGGCGG - Exonic
1161099764 19:2415849-2415871 GGCAGCCTTCCTGGAGGAGGCGG - Intronic
1161171306 19:2813712-2813734 GGCTCAGGTCCTTGTGGGGGCGG + Exonic
1161234977 19:3193236-3193258 GGCTGCTGGCCTGGTGGGGGTGG - Intronic
1161723895 19:5917709-5917731 TGCTGATCTCCTGGCGGGGGTGG - Intronic
1161919429 19:7255036-7255058 GCCTGGCTTCCTGGAGCGGGTGG - Intronic
1162830071 19:13278874-13278896 AGGTGACTTCCTGGAGGGAGGGG + Intronic
1162895652 19:13763472-13763494 GACAGACTTCCTGGAGGAGGAGG + Intergenic
1163035183 19:14565693-14565715 GGCTGCCGGCCCGGAGGGGCAGG - Intronic
1163115209 19:15185010-15185032 CACTGACGTCCTGTTGGGGGTGG + Exonic
1163444572 19:17338992-17339014 GGATGACAACCTGGAGGAGGGGG + Exonic
1163497691 19:17656160-17656182 GGAGGACTTCCTGGAGGAGGAGG - Exonic
1163508963 19:17724218-17724240 GGCTGACGTCCTGGAGGGGGCGG + Intronic
1163606631 19:18279529-18279551 GGCTGATGTCCAGGTTGGGGAGG - Intergenic
1164415850 19:28046023-28046045 GGCTGAACTCAGGGAGGGGGTGG - Intergenic
1164481080 19:28611449-28611471 GACTGATGCCCGGGAGGGGGTGG - Intergenic
1164529970 19:29041158-29041180 GGCTGACTGCCTAGAGGGGTGGG + Intergenic
1164683174 19:30149530-30149552 GGAAGGCTTCCTGGAGGGGGAGG + Intergenic
1164705365 19:30315359-30315381 GGAAGACTTCCTGGAGGAGGTGG + Intronic
1165069413 19:33247160-33247182 GGCTGGCTTCCTGTGGGGGGGGG - Intergenic
1165072014 19:33261162-33261184 GGCTGAAGGCCTGGGGGGGATGG + Intergenic
1165100717 19:33436973-33436995 GGAAGACTTCCTGGAGGAGGAGG + Intronic
1166142087 19:40810694-40810716 GGCGCGCGTCCTGGAGGAGGCGG - Intronic
1166302283 19:41918089-41918111 GGGTGGCGTCCGGGATGGGGGGG - Intronic
1166554293 19:43687929-43687951 GGCAGAGGTCCTGGAGGGCTTGG + Intergenic
1167077181 19:47257002-47257024 GGCTGACGCAATGGCGGGGGCGG + Intronic
1167091097 19:47344490-47344512 AGCTGAGGTCCTGGGAGGGGAGG + Intergenic
1167097110 19:47380429-47380451 GGCTGACTTCCTGGAGTAGAAGG + Intronic
1167106992 19:47436205-47436227 GGAGGGCTTCCTGGAGGGGGTGG - Intronic
1167295490 19:48646669-48646691 GGCTGCTCGCCTGGAGGGGGAGG + Intergenic
1167648527 19:50718255-50718277 GGCTGGGTACCTGGAGGGGGAGG - Intronic
1168260546 19:55191624-55191646 GGCTGACCGCCTGGAGGGTGGGG - Intronic
927181819 2:20452206-20452228 GAATGAGCTCCTGGAGGGGGAGG - Intergenic
927184590 2:20473226-20473248 GGCTGCCTTCCTGTAGGGAGAGG + Intergenic
927201671 2:20582180-20582202 GGCTGCCTTCCTGGAGGCGAAGG + Intronic
927860781 2:26558771-26558793 GGCTGACAACTTGGAGGGGCGGG - Intergenic
928086550 2:28349860-28349882 GGCTGAGGTGATGCAGGGGGTGG - Intergenic
929043824 2:37771998-37772020 GGCTGAGTTCCTGGGTGGGGAGG - Intergenic
929604720 2:43226722-43226744 GCCTGACGTCCGCGAGCGGGCGG - Intergenic
929864057 2:45703022-45703044 GACTGACTTCCTGACGGGGGGGG - Intronic
930706872 2:54513089-54513111 GGCTGAGGCCCTGGAGGCAGAGG + Intronic
932188331 2:69717484-69717506 GGCTGATACCCTGGAGAGGGAGG - Intronic
932567501 2:72918774-72918796 GGCTGAGGTCTCGGAGGTGGTGG - Intronic
932874164 2:75433172-75433194 GGCTGAGTTCCTGGTGGGGAGGG + Intergenic
933700786 2:85254049-85254071 GGCTCATGGCCTGGAGCGGGTGG + Intronic
937230555 2:120396020-120396042 GGCTGAGATCCAGGAGGGGAGGG - Intergenic
937441526 2:121919788-121919810 GGCTGAGGTTCTGGAGTGGGTGG + Intergenic
937953980 2:127408724-127408746 GGAAGACTTCCTGGAGGAGGCGG - Intergenic
938168788 2:129056835-129056857 GGCTGCAGTCCAGGAGGGAGAGG - Intergenic
938262553 2:129906027-129906049 GGATGGCTTCCTGGAGGAGGTGG + Intergenic
942303587 2:174585542-174585564 GGCGGGGGTGCTGGAGGGGGAGG + Exonic
945241577 2:207681523-207681545 GGCGGGCGTCCCGGAGGCGGCGG + Intergenic
946239800 2:218346544-218346566 GGTTGCCTTCCTGGAGGAGGGGG - Exonic
947748722 2:232522313-232522335 GGCTGGCATCCTGGCGGGGCGGG - Intronic
947802821 2:232942146-232942168 GGGGGACTTCCTGGAGGAGGTGG - Intronic
948626167 2:239269576-239269598 TGCTGGCCTCCTGGAGGAGGAGG + Intronic
948720318 2:239895158-239895180 GGCAGGCATCCTGGAGAGGGAGG - Intronic
949046218 2:241873698-241873720 GGCTGAGCTGCTGGCGGGGGCGG - Exonic
1169016523 20:2297161-2297183 GGCTGAGGCCCAGGAAGGGGTGG + Intronic
1169142849 20:3235911-3235933 GGAGGACTTCCTGGAGGAGGAGG - Intronic
1169205746 20:3739641-3739663 GTCTGAGGTGCTGGAGGGGCAGG - Intronic
1169279031 20:4251458-4251480 GGCTGAAATCCGGGAAGGGGTGG + Intergenic
1169424237 20:5484075-5484097 GGCTCAAGTAATGGAGGGGGTGG + Intergenic
1170157934 20:13285513-13285535 GGCTAGCCTCCTGGAGGGGGAGG - Intronic
1172701525 20:36856281-36856303 GGCAGACTTCCTGGAGGAGGAGG - Intronic
1172764085 20:37341822-37341844 GGCTTCTGTCCTGGAGGTGGTGG - Intergenic
1173636406 20:44562516-44562538 GGCTTGAGTCTTGGAGGGGGAGG + Intronic
1173845052 20:46182896-46182918 GGCTGAGGGACTGGAGGAGGAGG + Intronic
1174191378 20:48743018-48743040 GGCCTGCTTCCTGGAGGGGGTGG - Intronic
1174330482 20:49813265-49813287 GGACGACTTCCTGGAGGAGGCGG - Intronic
1174362165 20:50035638-50035660 GGCAGCCTTCCTGGAGGAGGGGG + Intergenic
1174855196 20:54038074-54038096 AGCTGAAGTTCTGGAGGGTGTGG - Intronic
1175598667 20:60255479-60255501 AGCTGAGGTCCAGGAGGGGCTGG + Intergenic
1175914647 20:62419966-62419988 GGCTGCCGTGCGGGAGGGGCTGG + Intronic
1175923728 20:62462080-62462102 GGCTGAGGACCTGGAGCAGGAGG - Intergenic
1178935792 21:36860371-36860393 GCCTGACTTCCTGGCGGGTGTGG - Intronic
1179172433 21:38982956-38982978 GGCTAGCTTCCTGGATGGGGCGG + Intergenic
1179234092 21:39529650-39529672 TGCTGACTCCCTGGAGGAGGTGG + Intergenic
1179397634 21:41056177-41056199 GGCTGAGTTCCTGGAGGGGTGGG - Intergenic
1179597392 21:42452076-42452098 GGAGGGCTTCCTGGAGGGGGTGG - Intergenic
1179642557 21:42757041-42757063 GGCTGGCGTCCAGGATGGTGGGG + Intronic
1179911184 21:44449803-44449825 GGCGGACGCCCTGGAGAGTGTGG + Intergenic
1179971064 21:44836798-44836820 GTCTGAGGTCCTGGAGCGGCAGG - Intergenic
1180072328 21:45442701-45442723 GGCGGAGGTCCTGGTGTGGGCGG + Intronic
1180072362 21:45442812-45442834 GGCGGAGGTCCTGGTGTGGGCGG + Intronic
1180072374 21:45442848-45442870 GGCGGAGGTCCTGGTGTGGGCGG + Intronic
1180839443 22:18952300-18952322 GGGTGATGTCCTGGAGGGGCAGG + Intergenic
1181925784 22:26357461-26357483 GGAGGACTTCCTGGAGGAGGTGG - Intronic
1181938680 22:26457911-26457933 GGCTGACGGCCTGGAGGAAGCGG + Exonic
1182114686 22:27749318-27749340 CTCTGAGGACCTGGAGGGGGTGG + Exonic
1182458614 22:30468847-30468869 AGCTGAGGTCCTGCAGGGGAGGG + Intronic
1183323207 22:37177552-37177574 TGATGTCATCCTGGAGGGGGAGG - Intergenic
1183456421 22:37925648-37925670 GGCTGGTGTCCTGGAGGAGGGGG - Exonic
1183731014 22:39618680-39618702 TGCTGAAGTCCTGGGGTGGGAGG + Intronic
1184147931 22:42622450-42622472 AGCAGCCGACCTGGAGGGGGTGG + Intronic
1184436189 22:44478879-44478901 GGCAGAGCTCCTGCAGGGGGTGG - Intergenic
1184665008 22:45983702-45983724 GGCTGGCAGGCTGGAGGGGGAGG + Intergenic
1184670279 22:46008547-46008569 AGCTGAGGTGCTGGAGAGGGAGG + Intergenic
1184738321 22:46412017-46412039 TGCGGACGTCCTGGAGTAGGCGG + Intronic
1185099525 22:48830213-48830235 GGCTGAGGTCCTGGGAAGGGAGG + Intronic
949460732 3:4290561-4290583 GGCAGAAGACCTGGAGGGGAAGG - Intronic
950581614 3:13866003-13866025 GGAAGACCTCCTGGAGGAGGTGG + Intronic
951786162 3:26421536-26421558 GCCTGATATCCTGGTGGGGGAGG + Intergenic
953569164 3:44057740-44057762 GGCTGATGACCTCGAGAGGGAGG - Intergenic
953792673 3:45960141-45960163 GCCTGATGCACTGGAGGGGGAGG + Intronic
953843389 3:46407475-46407497 GGCTGAGCTCCTGCAGGGGAAGG - Intronic
953951122 3:47191018-47191040 GGCTTGAGTCCTGGAGGTGGAGG - Intergenic
954154941 3:48680220-48680242 TGCTGAGGTCCTAGAGGGAGAGG + Exonic
954615410 3:51966804-51966826 GGCTGGGGTCCTGGGGGGTGGGG - Intronic
954762907 3:52890027-52890049 GGCTCTCGACATGGAGGGGGTGG - Intronic
955705568 3:61724130-61724152 GGCTGAGGCACTGGAGGGGGAGG + Intronic
956799473 3:72743903-72743925 GGGTGACCTCCTGGAGGAAGTGG + Intergenic
956966374 3:74465871-74465893 GGCTGACATCCAGGAGGTGGAGG + Intronic
960997660 3:123350535-123350557 GGCTGAGGGCCAGGAGGGGTGGG + Intronic
961379861 3:126489999-126490021 GGCTGATGGCCTGGAGGTGTTGG + Intronic
961695053 3:128698609-128698631 CGCTGAGGTCCTGGGGGAGGAGG - Intergenic
962370151 3:134814504-134814526 GGATGGCTTCCTGGAGGAGGAGG + Intronic
962844455 3:139262535-139262557 GGAAGGCTTCCTGGAGGGGGAGG - Intronic
966048155 3:175578347-175578369 CGCTGGAGCCCTGGAGGGGGAGG + Intronic
966890200 3:184401704-184401726 GGCTGTAGGGCTGGAGGGGGTGG + Intronic
968591115 4:1460105-1460127 GGCTGGGGTCCTGGAGGAGGTGG + Intergenic
968609323 4:1549959-1549981 GGGAGACTTCCTGGAGGAGGTGG - Intergenic
969265552 4:6061939-6061961 GGTGGATGTCCTGGAGGGCGGGG + Intronic
969319418 4:6402732-6402754 GGATGACTTCCTGGAGGAGGAGG + Intronic
969432049 4:7161117-7161139 GGCAGAATTCCTGGAGGAGGTGG + Intergenic
969452283 4:7281462-7281484 GGCCCACGTGCTGGAGGCGGAGG - Intronic
969583217 4:8077425-8077447 GGCAGGCTTCCTGGAGGAGGTGG + Intronic
969670494 4:8587481-8587503 GGCTGAAGTACAGGAGGAGGAGG + Exonic
969977632 4:11120317-11120339 GGCTGCCTTCCTGGAGGCAGTGG + Intergenic
970515453 4:16825070-16825092 GGCAGCCTTCCTGGAGGGGGTGG + Intronic
971672783 4:29584873-29584895 GGCTGAAGTAATGGAGGGGAAGG + Intergenic
975609107 4:76186328-76186350 AGCTGTGGTCCTGGAGGAGGAGG + Intronic
975703587 4:77089978-77090000 GGCTGAAGTCATGGAGGGATTGG + Intergenic
978964521 4:114725296-114725318 GGGTGAGGCCCTGGAGAGGGTGG + Intergenic
982074405 4:151724312-151724334 GGCAGAAGTCCTGGTGGGAGTGG - Intronic
982198425 4:152937417-152937439 GGCTGGCGCCCTGGGGGGCGTGG + Intronic
984762060 4:183370988-183371010 AGGTGACGTCCGGGAGGGGTGGG + Intergenic
985548620 5:522233-522255 GGAAGACGTCCTTGAGGGCGGGG - Intronic
985636092 5:1036515-1036537 GGGTGCCGTCCTGGGTGGGGTGG - Intronic
985773387 5:1826796-1826818 GGGTGACCTCCTGGGTGGGGAGG + Intergenic
988824003 5:34916079-34916101 GGCCGTCTTCCTGGAGGCGGCGG + Exonic
989205662 5:38806827-38806849 GCCTGCCGTCCAGGAGGTGGGGG - Intergenic
990003550 5:50921871-50921893 GGAAGACTTCCTGGAGGAGGTGG + Intergenic
990078146 5:51876917-51876939 GCCTGAGGTGCTGGAGGAGGAGG + Intergenic
990517291 5:56542031-56542053 GACTGAAGCCATGGAGGGGGTGG + Intronic
993495601 5:88605399-88605421 GGCTGTCATCAGGGAGGGGGTGG - Intergenic
1002100417 5:176854914-176854936 GGCAGGCTTCCTGGAGGAGGGGG + Intronic
1002317068 5:178350189-178350211 GGTGGGCGTCCTGGAGGAGGTGG - Intronic
1002927094 6:1611025-1611047 GGCTGGCGGCCGGGCGGGGGCGG - Exonic
1006379967 6:33691703-33691725 GCCTGAGGTCCTGGAAGGTGAGG + Exonic
1006448560 6:34092937-34092959 GGGTGGCGCCCTGGAGGGGAGGG - Intronic
1007384106 6:41509194-41509216 GGGAGACTTCCTGGAGGAGGTGG + Intergenic
1007717894 6:43867842-43867864 GGCTGACTTCATGGAGGAGCAGG - Intergenic
1007755717 6:44097975-44097997 GGATGACTTCCTGGGGGAGGAGG - Intergenic
1010779875 6:79933312-79933334 CGCTTACGCCCTGGAGGTGGAGG - Intronic
1011775162 6:90721891-90721913 GGCTGAGGCCCTGGAATGGGGGG + Intergenic
1012551345 6:100466970-100466992 GGCTGACGTCCTGGGGGGCTGGG + Intergenic
1013435581 6:110102046-110102068 GGGGGAGGTACTGGAGGGGGAGG + Exonic
1015989010 6:138915914-138915936 GGCTGTGGCCTTGGAGGGGGAGG + Exonic
1018238067 6:161745290-161745312 GGCAGGCTTCCTGGAGGTGGTGG + Intronic
1019012646 6:168854228-168854250 TGCAGACCTCCTGGAGGGGAAGG - Intergenic
1019386084 7:757034-757056 GGCTGACGGCCGGGCAGGGGAGG - Intronic
1019427099 7:983006-983028 GGCTGAGGCCCTGGTGGGGCCGG - Intergenic
1020035715 7:4961800-4961822 GGCTGAGATCCTGGAGGCAGAGG - Intergenic
1020083362 7:5297934-5297956 GGCAGACGTCCTTGGGGGGCTGG + Intronic
1020279467 7:6642998-6643020 GGATGAGGACCTGGAGGAGGAGG + Exonic
1021881382 7:25098250-25098272 GGCTGAGGCCCGGGAGGTGGAGG + Intergenic
1022102057 7:27174586-27174608 GGCTCACGTCCGGGTAGGGGCGG - Intronic
1022655881 7:32319083-32319105 GGGTGACGGCGTGGAGGGCGCGG - Intergenic
1026044818 7:66899733-66899755 GGAAGACTTCCTGGAGGAGGTGG + Intergenic
1029496277 7:100896822-100896844 GGGTGAACTCCTGGAGGGCGGGG - Intronic
1029594913 7:101532580-101532602 GGAGGACGTCCTGGAGGCAGTGG - Intronic
1031011232 7:116526487-116526509 GGCGGACGGCCAGGACGGGGAGG - Intronic
1032108524 7:129055207-129055229 GGGTTACTTCCGGGAGGGGGCGG - Intergenic
1032261142 7:130337968-130337990 GGCGTACGTCCTGGGGGAGGGGG + Intergenic
1032466331 7:132147910-132147932 TGCTGAGGTCCTGGAGACGGTGG + Exonic
1032695411 7:134331580-134331602 GGAAGACTTCCTGGAGGAGGAGG - Intergenic
1033654182 7:143362236-143362258 GGCGGATGGCCTGGAGGGGCAGG + Intronic
1034222816 7:149459586-149459608 GGCTGCGGGCCTGGACGGGGAGG - Intronic
1034547701 7:151799855-151799877 GTGTGAGGTTCTGGAGGGGGCGG - Intronic
1035320915 7:158028778-158028800 GGCTGAAGCCCAGGAGGGCGGGG + Intronic
1036432512 8:8703178-8703200 GGTGGACGTCCTCGACGGGGAGG + Exonic
1036600948 8:10259758-10259780 AGCTGAGGTCCGGGAGAGGGTGG - Intronic
1037876521 8:22551548-22551570 GGCTGGCGTCGGGGAGGGGTCGG - Intronic
1037927126 8:22852247-22852269 GGCTGACGCTTTGGAGGTGGAGG - Intronic
1038275708 8:26119041-26119063 GGCTGACATCCTGGAGAGCTTGG - Intergenic
1038296155 8:26292035-26292057 GGCTGGCGCCGTGGCGGGGGTGG + Intronic
1040087997 8:43365554-43365576 GGGTGAGGTGCTGGTGGGGGTGG - Intergenic
1040644491 8:49382391-49382413 GGCAGACGTCCTAGATTGGGAGG + Intergenic
1040993431 8:53376492-53376514 GGCCCACAACCTGGAGGGGGTGG + Intergenic
1041015730 8:53591558-53591580 CGCAGAGGTCCTGGAGGGGTTGG - Intergenic
1046657733 8:116913261-116913283 GACTGAGCTCCTGGAGGGAGGGG - Intergenic
1047313338 8:123710605-123710627 GGCTGCAGTCCTGGAGGGGGTGG - Intronic
1049160471 8:141094689-141094711 GGATGTCTTCCTGGAGGAGGTGG + Intergenic
1049319841 8:141990245-141990267 ACCTGAAGTCCTGGAGGGTGAGG - Intergenic
1049469145 8:142767642-142767664 GGAGGCCTTCCTGGAGGGGGTGG - Intronic
1050013372 9:1208230-1208252 GGCTGATGTTCTGGAGAGGGAGG + Intergenic
1051403538 9:16709142-16709164 GGCTGAAGTGTTGGTGGGGGTGG + Intronic
1053271818 9:36755233-36755255 GGAAGACTTCCTGGAGGAGGTGG - Intergenic
1054705111 9:68453937-68453959 GGCCTAAGTCCAGGAGGGGGTGG + Intronic
1055939254 9:81634219-81634241 GGCTGAAGTCCCGAAGGGTGAGG + Exonic
1056254296 9:84782908-84782930 GGCTTATGTCCTGAAGTGGGTGG + Intronic
1056580757 9:87886907-87886929 AGCTGGCATCCTGGAGGGGTGGG + Exonic
1057200184 9:93135535-93135557 GGCTCAATTCCTGGAGGGGCAGG + Intergenic
1057276085 9:93676691-93676713 GGCTGGCGTGGTGGAGGTGGAGG - Exonic
1060042140 9:120308843-120308865 GCCTGACTTCCTGGGGGTGGGGG + Intergenic
1060393522 9:123299605-123299627 GGCAGACTTCCTGGAGGAGCTGG - Intergenic
1060990568 9:127846525-127846547 GGCTGACGGCATGGAGGAGGCGG - Intronic
1061219277 9:129240968-129240990 GGCAGGCTTCCTGGAGGAGGTGG - Intergenic
1061673816 9:132204137-132204159 GGCTGAAGTCCTTGAGCGAGAGG + Intronic
1061878344 9:133556033-133556055 GGCTGAGGTCCTAGAGGTAGAGG + Intronic
1061920565 9:133780187-133780209 GGCAGGCTTCCTGGAGGAGGTGG - Intronic
1062142887 9:134969566-134969588 GGCAGGCTTCCTGGAGGAGGCGG - Intergenic
1062315583 9:135965527-135965549 GGCGGGCTTCCTGGAGGAGGAGG - Intergenic
1062429051 9:136518905-136518927 GGAAGGCTTCCTGGAGGGGGCGG - Intronic
1062448219 9:136604614-136604636 GGCAGGCTTCCTGGAGGAGGGGG - Intergenic
1062472725 9:136713347-136713369 GGCTGGGGTCCTGGAGGGTCTGG - Intronic
1062500438 9:136849766-136849788 GGCTGAGGTCCTGGGCGGGAAGG + Intronic
1185683703 X:1909790-1909812 GGCTGAGGCCCAGGAGGGAGGGG - Intergenic
1185736750 X:2501221-2501243 GTCTGTGGTCCTGGGGGGGGGGG - Intronic
1189322250 X:40094246-40094268 GGCTGAAGGACTGGAGGGGGGGG - Intronic
1189381695 X:40506843-40506865 CCCTGACTTCATGGAGGGGGTGG + Intergenic
1190370647 X:49737345-49737367 GGCAGACTTCCTGAAGGAGGTGG - Intergenic
1190440515 X:50470750-50470772 GGCTGCCGGACTGGAGTGGGCGG - Intergenic
1190829120 X:54044516-54044538 GGGTGACGTCATCGGGGGGGCGG + Intronic
1191830393 X:65408515-65408537 GGCTGAAGTCCCGAAGGGTGAGG - Intronic
1192787262 X:74347505-74347527 GGCTTAAGTCCGGGAGGTGGAGG - Intergenic
1195704974 X:107732139-107732161 AGCTGAAATCCTGGAGGGGAAGG - Intronic
1197892265 X:131279208-131279230 GGGTGAAGTCCCGGTGGGGGAGG - Intronic
1198764011 X:140062694-140062716 GCCTGAGGTGCTTGAGGGGGAGG + Intergenic