ID: 1163509693

View in Genome Browser
Species Human (GRCh38)
Location 19:17727313-17727335
Sequence TGCCCTCTGCGGGGCTCCGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 190}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163509693_1163509709 21 Left 1163509693 19:17727313-17727335 CCACCGGAGCCCCGCAGAGGGCA 0: 1
1: 0
2: 1
3: 19
4: 190
Right 1163509709 19:17727357-17727379 CACTGCGGGGCGGGGAGGCCGGG 0: 1
1: 0
2: 3
3: 50
4: 437
1163509693_1163509699 6 Left 1163509693 19:17727313-17727335 CCACCGGAGCCCCGCAGAGGGCA 0: 1
1: 0
2: 1
3: 19
4: 190
Right 1163509699 19:17727342-17727364 GGCTGTCGCTGAGCCCACTGCGG 0: 1
1: 0
2: 1
3: 17
4: 203
1163509693_1163509708 20 Left 1163509693 19:17727313-17727335 CCACCGGAGCCCCGCAGAGGGCA 0: 1
1: 0
2: 1
3: 19
4: 190
Right 1163509708 19:17727356-17727378 CCACTGCGGGGCGGGGAGGCCGG 0: 1
1: 1
2: 3
3: 55
4: 513
1163509693_1163509700 7 Left 1163509693 19:17727313-17727335 CCACCGGAGCCCCGCAGAGGGCA 0: 1
1: 0
2: 1
3: 19
4: 190
Right 1163509700 19:17727343-17727365 GCTGTCGCTGAGCCCACTGCGGG 0: 1
1: 0
2: 0
3: 13
4: 176
1163509693_1163509703 12 Left 1163509693 19:17727313-17727335 CCACCGGAGCCCCGCAGAGGGCA 0: 1
1: 0
2: 1
3: 19
4: 190
Right 1163509703 19:17727348-17727370 CGCTGAGCCCACTGCGGGGCGGG 0: 1
1: 0
2: 0
3: 18
4: 210
1163509693_1163509701 8 Left 1163509693 19:17727313-17727335 CCACCGGAGCCCCGCAGAGGGCA 0: 1
1: 0
2: 1
3: 19
4: 190
Right 1163509701 19:17727344-17727366 CTGTCGCTGAGCCCACTGCGGGG 0: 1
1: 0
2: 1
3: 7
4: 113
1163509693_1163509704 13 Left 1163509693 19:17727313-17727335 CCACCGGAGCCCCGCAGAGGGCA 0: 1
1: 0
2: 1
3: 19
4: 190
Right 1163509704 19:17727349-17727371 GCTGAGCCCACTGCGGGGCGGGG 0: 1
1: 0
2: 0
3: 23
4: 263
1163509693_1163509705 16 Left 1163509693 19:17727313-17727335 CCACCGGAGCCCCGCAGAGGGCA 0: 1
1: 0
2: 1
3: 19
4: 190
Right 1163509705 19:17727352-17727374 GAGCCCACTGCGGGGCGGGGAGG 0: 1
1: 0
2: 17
3: 81
4: 587
1163509693_1163509702 11 Left 1163509693 19:17727313-17727335 CCACCGGAGCCCCGCAGAGGGCA 0: 1
1: 0
2: 1
3: 19
4: 190
Right 1163509702 19:17727347-17727369 TCGCTGAGCCCACTGCGGGGCGG 0: 1
1: 0
2: 1
3: 7
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163509693 Original CRISPR TGCCCTCTGCGGGGCTCCGG TGG (reversed) Exonic
900539426 1:3195436-3195458 TCCCCTCTGCTGGGCTGCAGCGG - Intronic
901660692 1:10796262-10796284 TGCCCGGCGCGCGGCTCCGGGGG - Intronic
901829273 1:11882169-11882191 TGGCCTCTGCCGGCCTCTGGTGG - Intergenic
902823186 1:18955965-18955987 TGCCCGCCGCCGGGCGCCGGGGG + Exonic
903439126 1:23374325-23374347 TGCCCTCTGCTTGGCTTTGGTGG - Intergenic
905473243 1:38208327-38208349 TGTCCTCTCCCTGGCTCCGGCGG - Intergenic
905875873 1:41431872-41431894 TGCCCCCTGCCGGGGTCTGGAGG + Intergenic
905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG + Intronic
910030088 1:82709262-82709284 AGCACTCTGCGGGGCTGAGGCGG - Intergenic
912390551 1:109299825-109299847 TGCCCTCGGCTGGGCTCTGGTGG + Intronic
912746783 1:112251950-112251972 TGCCCTGTGCAGGGCTAGGGTGG - Intergenic
919878786 1:201888996-201889018 TGCCACCCGCGGGGCTCCGCCGG + Exonic
923312451 1:232748097-232748119 TGCTCTCTGGGGGGCTGTGGTGG + Intergenic
1063023693 10:2156264-2156286 TGCTCTCTGCTGGCCTCCCGGGG - Intergenic
1063105448 10:2987968-2987990 TGCACTCTGCAGAGCTCGGGAGG - Intergenic
1063126788 10:3142811-3142833 TGCCATCTGCAGGGCTCTGCAGG + Intronic
1063565891 10:7172033-7172055 TGCCCTCGGCCCGGCCCCGGAGG - Exonic
1064086402 10:12349325-12349347 CGCCCTCGCCGGGGCTCCAGGGG + Intergenic
1065046633 10:21752120-21752142 TGCGCTCTGCGGGGCTGAGTGGG + Intergenic
1066653462 10:37680280-37680302 GGGCCTCAGCGGGGCTTCGGTGG + Intergenic
1067448343 10:46366743-46366765 TGCCCTCTGTGGGGCACAGATGG + Intergenic
1067456805 10:46425009-46425031 TGGCCTCTGCAGGGCTCTGTTGG + Intergenic
1067589034 10:47494023-47494045 TGCCCTCTGTGGGGCACAGATGG - Intergenic
1067630396 10:47959630-47959652 TGGCCTCTGCAGGGCTCTGTTGG - Intergenic
1067636159 10:48002114-48002136 TGCCCTCTGTGGGGCACAGATGG - Intergenic
1070132720 10:73666119-73666141 TGCCCTCTGTGGGGCACAGATGG - Intergenic
1071608964 10:87017955-87017977 TGCCCTCTGTGGGGCACAGATGG + Intergenic
1076154014 10:128188940-128188962 TGCCTTCTGCAGAGCTCTGGGGG - Intergenic
1076692709 10:132231888-132231910 GGCCCTCTGGGCGGCTCCGTGGG - Intronic
1076999690 11:316341-316363 TGCCCTACGCGGGGTGCCGGGGG + Intergenic
1077300482 11:1844321-1844343 AGCCCTGTGCGTGGCTCTGGAGG + Intergenic
1077411223 11:2404835-2404857 TGCCCCCTGGGGGGTTCCGCTGG + Exonic
1077441628 11:2571722-2571744 TGCCTTCTGGGGGGCTCCTTGGG - Intronic
1077553776 11:3216114-3216136 GGCCATCTGGGGGGCTCAGGGGG - Intergenic
1077553804 11:3216216-3216238 GGCCATCTGGGGGGCTCAGGAGG - Intergenic
1081870694 11:46381460-46381482 TGCCCTCTGCGCTGCGACGGCGG - Intronic
1083298208 11:61726612-61726634 TGCCCGCTGCGGGGCACCCCTGG - Intronic
1084490710 11:69476719-69476741 TGTAATCAGCGGGGCTCCGGGGG - Intergenic
1084546489 11:69817595-69817617 TGCCCACCGTGCGGCTCCGGAGG + Intronic
1085270900 11:75269266-75269288 TGGTCACTGCGGGGCTCCAGAGG + Intronic
1090982702 11:131737541-131737563 TGCCCTCTGCTGAGTTCTGGAGG - Intronic
1092829112 12:12426854-12426876 TGCCCTCTGGTGGGTTTCGGAGG + Intronic
1094473370 12:30823295-30823317 GGGCCTCTGCAGGGCTCCGCGGG + Intergenic
1095979521 12:47963521-47963543 TGCGCTCTTCGCGGCTCCGGAGG - Intergenic
1096539236 12:52295534-52295556 TGCCCTCTGCAGGGCCCTGCAGG + Intronic
1096550817 12:52370479-52370501 TGCCCTCTCTGGGGCTCCCCAGG + Intergenic
1101990105 12:109477380-109477402 TGCCCTCTGCGGGGCGGAAGTGG - Exonic
1103913326 12:124363645-124363667 TGGACTCTGTGGGGCTCTGGGGG + Intronic
1104590696 12:130082240-130082262 TGCCCTGGGCTGGGCACCGGCGG + Intergenic
1104989919 12:132619325-132619347 TCCGCTCTGCGGGGCTCTTGGGG - Intronic
1106242818 13:27924205-27924227 GGGGCTGTGCGGGGCTCCGGGGG + Intronic
1106469706 13:30043507-30043529 TGCCCTGTGGGGGTCTCCAGAGG - Intergenic
1108374484 13:49801299-49801321 AGCCCTGTGCGGGGCTGAGGCGG + Intergenic
1117284745 14:54276555-54276577 TGCCCTCTACTTGGCTCCAGGGG - Intergenic
1119709678 14:76812699-76812721 TCGCCTCTGCGGGGCTCCGCGGG - Intronic
1120730140 14:87992795-87992817 GGCCCGCTGCGGGGCTGGGGCGG - Intronic
1120916046 14:89711304-89711326 TGCCCTCCTCAGGGCTCCTGTGG + Intergenic
1121857743 14:97285679-97285701 GGCCCTTTGCGTGGCTCCCGGGG + Intergenic
1122396652 14:101437591-101437613 TGGGCTCTGGTGGGCTCCGGTGG + Intergenic
1122769691 14:104092466-104092488 TGCCCTCTGAGGGGTCCCAGGGG + Intronic
1122876183 14:104666398-104666420 TGCCCTCTGCCCGGCCCTGGGGG - Intergenic
1123106964 14:105846178-105846200 GGCCCTCTGAGTGGCTCCGGAGG + Intergenic
1125714483 15:41811585-41811607 GGCCCCCTGCTGGGCTCAGGAGG + Intronic
1126142778 15:45451337-45451359 AGCCCTGTGCTGGGCTCAGGAGG + Intergenic
1129322263 15:74781986-74782008 CGCCCCCTGCCGGGCGCCGGGGG - Intergenic
1129850336 15:78790106-78790128 TTCCCTCTGCTGGACTCTGGAGG - Intronic
1129903926 15:79172761-79172783 AGCCCTCTGCTGGGCTCCTGGGG + Intergenic
1130253510 15:82315396-82315418 GGCCCTCTGCGGGGCAGCAGTGG - Intergenic
1131231788 15:90665299-90665321 AGCGCTGTGCCGGGCTCCGGGGG - Intergenic
1131439557 15:92448601-92448623 TGTCTTCTGCGGGGCTCTGGGGG - Intronic
1132415193 15:101614367-101614389 TGCCCTCTGCCTGGCTCCCTGGG - Intergenic
1133282881 16:4677114-4677136 TGCCCAAGGCGGGGCTCCAGAGG - Intronic
1133760904 16:8797652-8797674 TGCGCTCTTAGGGGTTCCGGGGG - Intronic
1134078317 16:11307936-11307958 AGCTCTCTGCGAGGCTGCGGCGG + Intronic
1134656991 16:15954652-15954674 TGCCTTCTGCAGGGCCCCTGTGG - Intronic
1138578881 16:57926646-57926668 TGCCCTGTGCTGGGCACAGGAGG - Intronic
1139631803 16:68235931-68235953 CGTCCTCTTCGGGGCTACGGCGG - Exonic
1139947912 16:70654284-70654306 TGCCTCCTGGGGGGCTCCAGTGG + Intronic
1141133024 16:81447761-81447783 TGCCCTCTGGTGGGCTCCAGGGG + Intronic
1142077692 16:88129900-88129922 TTCCCTCGGAGGGGCTTCGGTGG - Intergenic
1142183885 16:88685488-88685510 GGCCCACTGAGGGGCGCCGGCGG - Intronic
1142623096 17:1177390-1177412 TGGCCTCTGGGCGGCTCCTGGGG - Intronic
1142699139 17:1649088-1649110 GGCGCTGGGCGGGGCTCCGGGGG - Intronic
1142699156 17:1649129-1649151 GGCGCTGGGCGGGGCTCCGGGGG - Intronic
1142764325 17:2057099-2057121 TGCCACCTGCGGGGCGGCGGCGG + Exonic
1142974868 17:3637155-3637177 TGCGGAGTGCGGGGCTCCGGGGG + Exonic
1145062009 17:19739466-19739488 TGCCCTCTGCCAGGGTCCTGGGG - Intronic
1145911997 17:28548349-28548371 TGCCCTCTGCAGGGCTCTCTGGG - Intronic
1147996705 17:44363599-44363621 TGCGGGCTGGGGGGCTCCGGCGG + Exonic
1148025141 17:44582009-44582031 TGCGCTGTGCAGGGCTCGGGGGG - Intergenic
1151604777 17:75129512-75129534 TGCCCCCTCCAGGGCTCTGGAGG + Exonic
1152751749 17:82065541-82065563 TGCCCGCCGCGTGGCTCCGGAGG - Exonic
1152924766 17:83081706-83081728 TGCCCTCTGCCAGGCTCTGCAGG - Intronic
1156570659 18:38249087-38249109 TGCCCTCCACAGGGCTCAGGGGG - Intergenic
1158395699 18:57077209-57077231 TGTCCTCTGCAGGGCTCCCATGG + Intergenic
1158436739 18:57439674-57439696 GGCCCTCTGCGGCGTACCGGCGG - Intronic
1160411557 18:78678509-78678531 TGCCCCCTCTGGGGCTCCAGGGG + Intergenic
1160413951 18:78694601-78694623 TGCCCTCTGCAGGGTACCAGTGG - Intergenic
1160508288 18:79439349-79439371 GGGCCTCTGCGTGGCTCCTGGGG - Intronic
1160662420 19:307252-307274 GGACCTCAGCGGGGATCCGGAGG - Exonic
1160790683 19:921869-921891 TGCCATCTGCCGGGCACCTGCGG - Intergenic
1160905583 19:1450269-1450291 CTCCCTCTGCGCGGCTCCGCGGG - Intronic
1161316606 19:3620308-3620330 TGCGGTCTGCAGGGCTGCGGGGG + Intronic
1163509693 19:17727313-17727335 TGCCCTCTGCGGGGCTCCGGTGG - Exonic
1164658541 19:29942327-29942349 AGCCCGCTGCGGGGCGGCGGCGG + Exonic
1164692642 19:30222606-30222628 GGCCGTCTGCGGGGCTCAGGCGG + Intergenic
1167013194 19:46822195-46822217 TGCCCTCTGCCCTGCTCTGGTGG - Intergenic
1167432341 19:49461779-49461801 GGCCTTCTGCGGAGCCCCGGAGG + Exonic
1167445544 19:49535038-49535060 TGTCCTCCACAGGGCTCCGGGGG + Intronic
926083300 2:10005978-10006000 TTGCCTCTCCGAGGCTCCGGTGG + Intergenic
926145715 2:10396221-10396243 TGCCCTGTGCTGGGCCCAGGAGG + Intronic
927517256 2:23679759-23679781 TGCCCTCTGCCCTCCTCCGGAGG - Intronic
934535911 2:95133219-95133241 AGCCCTCTGAGGGGCTGAGGTGG + Intronic
935732667 2:106077149-106077171 TGCCCTGTGCTGGGCACTGGAGG - Intronic
940947768 2:159637288-159637310 TGCCCTGGGAGGGGCTCCAGAGG + Intergenic
942178677 2:173358278-173358300 AGCCCTTTGGGAGGCTCCGGTGG + Intronic
942315469 2:174693124-174693146 TGCCCTCTTTGGGGCTCAGCAGG + Intergenic
942965970 2:181892283-181892305 TGCTCCCGGCCGGGCTCCGGGGG + Intronic
944675952 2:202034261-202034283 TGCGCGCTGCGGTGCGCCGGGGG + Intergenic
944801193 2:203239208-203239230 TGCCCGCTGCGGGCCGCAGGGGG + Intronic
946351773 2:219160233-219160255 TGCCCTCTGCAGGGCGTCGGAGG - Intronic
946395563 2:219442201-219442223 CGCCCTCGGCGGGGCTCGGGTGG - Intronic
947712877 2:232325945-232325967 TGCGCCCTTCGGGGCTCCCGTGG + Intronic
948256053 2:236568578-236568600 TGCTCTCCGGGGGCCTCCGGAGG - Intronic
1171044308 20:21796249-21796271 TGCCCTCTGCTGGGCACCTGGGG - Intergenic
1172013269 20:31858618-31858640 TGGGCTCTGCGGGTCTCAGGAGG + Intronic
1172882908 20:38213298-38213320 TCCCCTCTGGGGGGCCCAGGAGG + Exonic
1173979932 20:47216045-47216067 TGCCCTCTGCAGGGCCTCCGTGG - Intronic
1174047116 20:47741371-47741393 GCACCGCTGCGGGGCTCCGGGGG - Intronic
1174847321 20:53955227-53955249 TGCCCTCTGAAGAGCACCGGTGG - Intronic
1175172374 20:57089789-57089811 TGCCCTCTGCTGGCCGCCGGGGG - Intergenic
1175378104 20:58543101-58543123 AGCCATCTGCAGGGATCCGGTGG - Intergenic
1175911398 20:62406999-62407021 AGCCCGGTGGGGGGCTCCGGCGG + Exonic
1176157313 20:63628050-63628072 TGCCGGCTGCGGGACTCGGGTGG - Intergenic
1176198269 20:63847901-63847923 TTCCCTCAGCGGGGGTCAGGGGG - Intergenic
1176370666 21:6059947-6059969 TGCCCCCTGGGGGACTCAGGGGG - Intergenic
1176549771 21:8216122-8216144 TAGCGTCCGCGGGGCTCCGGGGG - Intergenic
1176557662 21:8260351-8260373 TAGCGTCCGCGGGGCTCCGGGGG - Intergenic
1176568696 21:8399156-8399178 TAGCGTCCGCGGGGCTCCGGGGG - Intergenic
1176568951 21:8400068-8400090 GGCCCGCCGCGGGGCCCCGGCGG + Intergenic
1176576610 21:8443391-8443413 TAGCGTCCGCGGGGCTCCGGGGG - Intergenic
1176576865 21:8444303-8444325 GGCCCGCCGCGGGGCCCCGGCGG + Intergenic
1178728576 21:35078330-35078352 TTCCCTCTTCCAGGCTCCGGTGG + Intronic
1179411814 21:41168242-41168264 TGCCCACGGCGGGGCCCGGGGGG - Exonic
1179627015 21:42654355-42654377 GGCTCTCCGCGGGGCCCCGGAGG - Intronic
1179752853 21:43478594-43478616 TGCCCCCTGGGGGACTCAGGGGG + Intergenic
1179980319 21:44892072-44892094 TGGCCTCTGCAGGGGTCCTGGGG + Intronic
1180300396 22:11032295-11032317 TGCACGCTGCGGGAATCCGGGGG + Intergenic
1182298938 22:29327366-29327388 TGCCATCTGGGAGGCTCCAGGGG - Intergenic
1182333882 22:29570354-29570376 TGCCCTTTCAGGGGCTCTGGGGG - Intronic
1182446463 22:30392581-30392603 TCCCCTCTGGGGGACTCCTGAGG + Intronic
1203254660 22_KI270733v1_random:132448-132470 TAGCGTCCGCGGGGCTCCGGGGG - Intergenic
1203262716 22_KI270733v1_random:177527-177549 TAGCGTCCGCGGGGCTCCGGGGG - Intergenic
952494351 3:33902805-33902827 GGCCCTGTGCTGGGCTCTGGGGG + Intergenic
954613136 3:51956639-51956661 GGCCCTCTGGGGGTCTCTGGAGG - Exonic
954627374 3:52029898-52029920 TGGCCTCTGCTGGGCACCCGAGG - Intergenic
961446674 3:126984331-126984353 TCCCCTCAGCGCGGCTCCTGTGG + Intergenic
968245129 3:197137720-197137742 AGCACTCTGCGGGGCTGAGGTGG + Intronic
968815315 4:2818642-2818664 TCCCCACTGCGGGGCTCCTTCGG + Intronic
969043645 4:4320736-4320758 CCCGCTCTGCGGTGCTCCGGCGG + Exonic
973974946 4:56253744-56253766 TGCCAGCTGTGGGGCTCCTGTGG + Intronic
976850187 4:89536146-89536168 TGACCTCTGTGGGGATCCAGAGG - Intergenic
984734571 4:183098329-183098351 TGGCCACGGCGGGGCTGCGGTGG + Intergenic
985794235 5:1950148-1950170 GGTCCTCAGCGGGGCTCCAGGGG + Intergenic
986523994 5:8653040-8653062 TGACCTCTGTGGGGCTCCCTAGG + Intergenic
990753230 5:59039902-59039924 CGCCCGCCGCGGGGCTCAGGAGG + Intronic
992671870 5:79069550-79069572 TGCCCGCTGCAGGGCTCCCCCGG - Exonic
995753161 5:115474662-115474684 TTCAGTCTGTGGGGCTCCGGAGG - Intergenic
998152341 5:139764609-139764631 TGCCCACTGCGGGGCGCCGGGGG - Intergenic
1005339933 6:24834340-24834362 GCCCCTCTGCTGGGCTCCCGAGG + Intronic
1006390839 6:33757356-33757378 TGCCCTCTGCTGAGTTCCAGAGG + Intergenic
1006410356 6:33870137-33870159 GGCCAGCTGCGGGGCTCAGGAGG + Intergenic
1007298763 6:40849687-40849709 TTCCCTCTGCGGGGCTACAGAGG + Intergenic
1007320977 6:41028561-41028583 TGGCCGCTGCGGGGCTGCGCTGG + Exonic
1007424098 6:41735617-41735639 TGCCCTCTGCCGGGCGCGGAGGG - Intronic
1007701165 6:43767379-43767401 TGCCCTCTCTGGGCCTTCGGAGG + Intergenic
1007913380 6:45537818-45537840 TGCCCTTTGAGGCGCTCCCGTGG - Intronic
1018972267 6:168537860-168537882 TGCCCTCGGAGGGGCACCTGGGG + Intronic
1025215376 7:57051619-57051641 TGCCCTTTGGGGGGCTAAGGCGG - Intergenic
1025655997 7:63519084-63519106 TGCCCTTTGGGGGGCTAAGGCGG + Intergenic
1034959358 7:155355400-155355422 TGCCCTCTGGGGGGCTCGCCTGG - Intergenic
1035238898 7:157517455-157517477 TGCCCTCTGCGGGGCCCGGCTGG + Intergenic
1035767600 8:2119621-2119643 TGCCCTCTGAGGTGCTCAGCTGG + Intronic
1036739655 8:11348587-11348609 TGCCCCCTGCGTGGCCCTGGGGG + Intergenic
1037799371 8:22024194-22024216 TGCCCGCTGCGGCTCTCCGCGGG + Exonic
1037820060 8:22131097-22131119 TGCCCCCTCCCGGGCCCCGGGGG + Exonic
1040016760 8:42706488-42706510 TGCCCTCAGCGTGGCCCCGGTGG + Intronic
1041411505 8:57561317-57561339 TGCCATCTGTGGGGCTCTGCCGG + Intergenic
1047190322 8:122673631-122673653 TGCCCTCTTCTGGGCACTGGTGG - Intergenic
1048675643 8:136776119-136776141 TCCTCTCTGCGGGACTCAGGAGG - Intergenic
1048980263 8:139699626-139699648 TGCCCTTTGCGGGGCCCAGCTGG + Intronic
1049009501 8:139877763-139877785 TGCTCTCTGCTGGGCTCCTGGGG + Intronic
1049482783 8:142834840-142834862 CGCACACTGCGGGGCTCCGAGGG + Exonic
1051414920 9:16829124-16829146 TGGCCTCTGCGGGACTGCAGCGG + Intronic
1056569038 9:87799742-87799764 TGCCCTGAGCGGAGCTGCGGTGG + Intergenic
1056762758 9:89426694-89426716 TGGCCTCTGAGGGGCTTTGGGGG - Intronic
1057306348 9:93914357-93914379 TTCCCACTGCAGGGCTCCTGTGG + Intergenic
1057600242 9:96450802-96450824 AGCCTCGTGCGGGGCTCCGGGGG + Intronic
1057602846 9:96473478-96473500 AGCCCTGTGAGGGGCTCCAGTGG - Intronic
1059218087 9:112585516-112585538 TGTCCTCCACGGGGCTCAGGGGG + Intronic
1061713757 9:132505700-132505722 TGCGCTCTGCCTGGCTCCTGGGG + Intronic
1062041217 9:134405136-134405158 GGCCCTGTGCTGTGCTCCGGGGG + Intronic
1062459262 9:136656033-136656055 TCCCCTCTGGGGGGCTCTGGGGG + Intergenic
1062540786 9:137040834-137040856 TGCCCTCCCCGGGGCTCCAGGGG + Exonic
1203471061 Un_GL000220v1:115593-115615 TAGCGTCCGCGGGGCTCCGGGGG - Intergenic
1203471316 Un_GL000220v1:116505-116527 GGCCCGCCGCGGGGCCCCGGCGG + Intergenic
1203478882 Un_GL000220v1:159565-159587 TAGCGTCCGCGGGGCTCCGGGGG - Intergenic
1203479137 Un_GL000220v1:160477-160499 GGCCCGCCGCGGGGCCCCGGCGG + Intergenic
1185541467 X:906020-906042 TGCACACTGCGGGAATCCGGGGG - Intergenic
1199953205 X:152721950-152721972 TGACCTCTGCGGGGGGGCGGGGG - Intergenic
1199956477 X:152746496-152746518 TGACCTCTGCGGGGGGGCGGGGG + Intergenic