ID: 1163515464

View in Genome Browser
Species Human (GRCh38)
Location 19:17760490-17760512
Sequence ACTTTTTCTGCCACTCTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 229}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163515464_1163515468 3 Left 1163515464 19:17760490-17760512 CCATTGAGAGTGGCAGAAAAAGT 0: 1
1: 0
2: 0
3: 25
4: 229
Right 1163515468 19:17760516-17760538 CCTTTAACATAAATGTCTTTGGG 0: 1
1: 0
2: 5
3: 29
4: 350
1163515464_1163515469 4 Left 1163515464 19:17760490-17760512 CCATTGAGAGTGGCAGAAAAAGT 0: 1
1: 0
2: 0
3: 25
4: 229
Right 1163515469 19:17760517-17760539 CTTTAACATAAATGTCTTTGGGG 0: 1
1: 0
2: 5
3: 41
4: 376
1163515464_1163515466 2 Left 1163515464 19:17760490-17760512 CCATTGAGAGTGGCAGAAAAAGT 0: 1
1: 0
2: 0
3: 25
4: 229
Right 1163515466 19:17760515-17760537 CCCTTTAACATAAATGTCTTTGG 0: 1
1: 0
2: 0
3: 12
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163515464 Original CRISPR ACTTTTTCTGCCACTCTCAA TGG (reversed) Intronic
901594464 1:10373762-10373784 GCTTTTTCTGCCATTTTCTAAGG + Intronic
903573055 1:24320532-24320554 CCTTTTCCTGCCACCCTCAGAGG + Intronic
904298033 1:29535801-29535823 ACATTTTGTGCCATTCTCAATGG - Intergenic
905972179 1:42150582-42150604 ACATTTTCTGCCAATCTCTCTGG - Intergenic
906274313 1:44504967-44504989 AGTTTTTCTTCCCCTCTGAAAGG - Intronic
906733289 1:48101501-48101523 GCTATTTAGGCCACTCTCAAGGG - Intergenic
906882485 1:49607172-49607194 AATTCTTCAGCCTCTCTCAAAGG - Intronic
909418267 1:75432329-75432351 ACATTTTCTGCAACTCACACAGG + Intronic
910074477 1:83261168-83261190 AATTTTTCTGCAACTCTCTAGGG + Intergenic
910686906 1:89926907-89926929 TCTATTTCTTCCCCTCTCAAGGG + Intronic
912040745 1:105386793-105386815 ACTATTTCTGACACTCTATATGG - Intergenic
913448167 1:118972059-118972081 AAGTATTCTGCAACTCTCAAAGG - Intronic
914716494 1:150258689-150258711 ACTCTTACTGCCACTTTCAGAGG - Intronic
915996247 1:160567247-160567269 TTTTTTTGTGCCACTTTCAAGGG - Intronic
916966117 1:169944870-169944892 ACTTTTTCTGGCCCTGTCCATGG - Intronic
917101173 1:171447011-171447033 ATTTTTTCTGTCTCTCTCACAGG - Intergenic
917731525 1:177879643-177879665 AGTTTTCCAGCCACTTTCAAGGG - Intergenic
917778925 1:178370176-178370198 CTTTTTTCTGCCACTTTCAGTGG + Intronic
919126453 1:193399359-193399381 TTTTTTTCTGCTCCTCTCAATGG - Intergenic
919431889 1:197504133-197504155 ACTTTGCCTGCCACCATCAAAGG - Intergenic
920414574 1:205790219-205790241 ACTTTCTCTGCCAGATTCAAAGG + Exonic
921896111 1:220403022-220403044 ACTTTTTCTCCTCCTCTCTAAGG + Intergenic
923641806 1:235770070-235770092 AATTTTTGTGGCACTTTCAATGG - Intronic
1063763410 10:9108325-9108347 GCTTTTCATGACACTCTCAAAGG + Intergenic
1065575715 10:27115947-27115969 ACTTTTTCTCTCACTCCAAATGG - Intronic
1066024744 10:31344052-31344074 ACTTTTTCTGACAGCCTCACTGG + Intronic
1067480298 10:46591861-46591883 GCTTTCTCTACCACTCACAATGG + Intronic
1067614439 10:47749939-47749961 GCTTTCTCTACCACTCACAATGG - Intergenic
1072082167 10:92043467-92043489 AGTTTTTCTTCCACTTACAAAGG + Intergenic
1073599836 10:104835903-104835925 ACTTTCCCTGCCACGCTCACAGG - Intronic
1074520226 10:114213979-114214001 ACTTTTCCTTCCACACCCAAGGG - Exonic
1075271336 10:121054371-121054393 GCTTTCCCTGGCACTCTCAAGGG - Intergenic
1075857736 10:125644694-125644716 ACAGGTTCTGCCACACTCAAGGG - Intronic
1075991637 10:126843284-126843306 GCTGTTTTTGCCACTCCCAAGGG - Intergenic
1078760829 11:14250135-14250157 ACTTTGTCAGTCACACTCAATGG + Intronic
1079018992 11:16893868-16893890 ACTTTTTCTTTCACACTCCATGG - Intronic
1079287194 11:19146424-19146446 ACTTTTTCTGCCACACACGTTGG + Intronic
1081076799 11:38685286-38685308 CCTATTTCTGCCATTCTCAGTGG - Intergenic
1081407309 11:42712946-42712968 AGTTTTTCTACAGCTCTCAAGGG - Intergenic
1081695024 11:45103608-45103630 AGTATTTCTGACACCCTCAAAGG - Intronic
1082241209 11:49872962-49872984 ACCATTTTTGCCTCTCTCAATGG + Intergenic
1082964665 11:58954710-58954732 ACTTTTTCTTCACCTCTCACTGG - Intronic
1083380450 11:62264044-62264066 ACTCTTGCTGCCTCTCTCATGGG + Intergenic
1085128088 11:74015554-74015576 TCTTTCTCTGCTACTCTGAAGGG + Intronic
1086178767 11:83924286-83924308 AAATTTTCTGCCACTCTGCAAGG + Intronic
1087912610 11:103771130-103771152 TTTTTTTCTGGCACTCTGAATGG - Intergenic
1088845680 11:113664175-113664197 ACTTTTAATGACTCTCTCAAAGG - Intergenic
1089065380 11:115658749-115658771 ACTTTTTCTTCTACTCCCTAGGG + Intergenic
1089720485 11:120414919-120414941 ACTTTTTATACCAGTCTCACTGG + Intronic
1089832117 11:121337992-121338014 TCTCTTTCTTCCCCTCTCAAAGG - Intergenic
1090871315 11:130751947-130751969 ACTTTCTCTGTCAGTATCAAGGG - Intergenic
1092247142 12:6869999-6870021 ACCTTTTCTGCCTCTCTAAGAGG - Intronic
1092766537 12:11858073-11858095 ACTCTTGCTGCCACTCTCAGAGG - Intronic
1094664893 12:32509869-32509891 ACGTTTTCTGCCATTCACAGAGG - Intronic
1095400762 12:41812731-41812753 ACTTTTTCTCCCTCTCTCTCAGG + Intergenic
1095976633 12:47944459-47944481 ATTTTCTCTGCCAGTATCAATGG - Intergenic
1097600012 12:61679718-61679740 ACATTTCCTTCCACACTCAATGG + Intergenic
1098956142 12:76692060-76692082 ACTTTTTCTGCCTCACCCAGTGG - Intergenic
1099328733 12:81253635-81253657 GCTTTATCTGCCATTGTCAATGG + Exonic
1099470609 12:83043169-83043191 TCTCTTTCTGCCTCTCTGAAAGG - Intronic
1104493136 12:129211942-129211964 ACTTTTTTTTCTACTCTAAAGGG + Intronic
1105380152 13:19879756-19879778 ACTTTTTGTGCCACTTTGACTGG + Intergenic
1105593244 13:21812958-21812980 ACTTTTTTTGACTCTCCCAAAGG - Intergenic
1107171530 13:37347975-37347997 ACTTTTGCTGTCACTCTCATTGG + Intergenic
1108643486 13:52405292-52405314 ACTTTTTCTGCAGCTATGAAGGG - Intronic
1108871242 13:54988631-54988653 CCTTTTTCTGCCTTTCTCACTGG - Intergenic
1113052138 13:106225033-106225055 ACTTTTCCTGCTATTTTCAAAGG + Intergenic
1113322334 13:109246267-109246289 ACATTATCTGACACTCACAAAGG + Intergenic
1114067444 14:19074699-19074721 ACTTCTTCTGCCACTGTCACAGG + Intergenic
1114094813 14:19325328-19325350 ACTTCTTCTGCCACTGTCACAGG - Intergenic
1115103512 14:29732545-29732567 ACTATTTCTGTCACTCTTCATGG + Intronic
1117108924 14:52428384-52428406 AGATTTTCTGCCTTTCTCAAGGG + Intergenic
1117579962 14:57142498-57142520 ACATTTTGTGCCACTCCCACAGG + Intergenic
1118340466 14:64892330-64892352 TCTTTTTCTTCCAATCTCCAAGG - Intergenic
1118598273 14:67452973-67452995 ATTTTTTCTGCTACTGTCTAGGG + Intronic
1118864580 14:69693022-69693044 CCTTTAACTGCCACTGTCAAGGG + Intronic
1121870762 14:97404725-97404747 ACTTTTCCTGCCACCTTAAATGG + Intergenic
1122109333 14:99485448-99485470 ACTTTTCCTTCCATTCTCAGGGG + Intronic
1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG + Intronic
1124834059 15:33178395-33178417 CTTTTATCTGCCAGTCTCAATGG + Intronic
1125316779 15:38440891-38440913 ACCCTTTCTGCAACTCTCCATGG + Intergenic
1125898491 15:43323447-43323469 ACTTTGTGTGTAACTCTCAAAGG - Intergenic
1126038686 15:44570462-44570484 ACCCTTTCTACTACTCTCAAAGG + Intronic
1128635425 15:69299350-69299372 ACCTTTTCTCTCACTCTCCAGGG + Intronic
1129712706 15:77828722-77828744 TCTCTTTCTGCCACTGTCACAGG - Intergenic
1130313218 15:82772329-82772351 ACTTTCTCTTCCATTCCCAAAGG - Intronic
1132237324 15:100232117-100232139 AATTTTTCTGCCTATCTCATTGG - Intronic
1132758755 16:1498908-1498930 AATTTTTTTGGCACTGTCAAAGG + Intronic
1138448735 16:57080447-57080469 ACTTTTATTGCTACTATCAATGG - Intronic
1138685697 16:58723672-58723694 ACTATTCCTGCCACTCTCCAGGG + Intronic
1141513726 16:84529120-84529142 ACGGTTTCTGCCACTCTAAAGGG + Intronic
1143479242 17:7219160-7219182 CCTTTTTCTGCAATTCTCATTGG - Exonic
1144269805 17:13604707-13604729 AAGCTTGCTGCCACTCTCAAGGG - Intergenic
1146278859 17:31532142-31532164 AATTTTGCTCCCACTCCCAAGGG - Exonic
1148975834 17:51527598-51527620 ACTTTCTTTGCCATTCTCAATGG - Intergenic
1149547878 17:57517854-57517876 TCTCTTTCTGCCACTCTGATGGG - Intronic
1149938539 17:60836756-60836778 ACTTTTTCTGCTTGCCTCAAAGG - Intronic
1156282355 18:35652350-35652372 ACTTTTCATGCCTCTCTCAGAGG + Intronic
1156781334 18:40854265-40854287 TCTTTTTATGCCATTCTGAAGGG - Intergenic
1157743949 18:50118332-50118354 CCTCTTTCTGCAACTCTCATTGG - Intronic
1157828632 18:50835803-50835825 ACTTTTTCAGTGATTCTCAAAGG + Intergenic
1158084238 18:53631590-53631612 TCTGTTTCTTCCATTCTCAAGGG - Intergenic
1159006850 18:63020864-63020886 TCTCTTCCTGTCACTCTCAAAGG - Intergenic
1159179456 18:64882929-64882951 ATTTTTTTTCCCACTGTCAAGGG - Intergenic
1159194282 18:65091652-65091674 ATTTTTTCTGCCAAACACAATGG - Intergenic
1159970282 18:74643047-74643069 ACTTTTTCTGCAACACTGAAGGG - Intronic
1160240752 18:77120648-77120670 ACTTTTCTTGCCACTCTCTCTGG - Intronic
1161644693 19:5445821-5445843 ACTGTTACTGCCACTCCCAGAGG - Intergenic
1163118518 19:15201879-15201901 ACTTCCTCTGTGACTCTCAAAGG + Intergenic
1163515464 19:17760490-17760512 ACTTTTTCTGCCACTCTCAATGG - Intronic
925116032 2:1378891-1378913 AGTTGTTCTGCTCCTCTCAAAGG + Intronic
925598352 2:5582112-5582134 ACTTATTCTGCCACTCTGCTTGG + Intergenic
927471448 2:23380686-23380708 TCTTTTTTTGGCATTCTCAATGG - Intergenic
927883599 2:26705585-26705607 CTATTTTCTGCCACTGTCAAGGG - Intronic
930129333 2:47833046-47833068 ACTTTGTCTGCCACTTTCCCAGG + Exonic
930885012 2:56315315-56315337 ACTTTTTCTCCCCCTCCCAGCGG + Intronic
931157061 2:59646843-59646865 AATTTGTCTGCCCCTCCCAATGG - Intergenic
931331887 2:61295032-61295054 ACTTTTTTTGCCTTTCTCATAGG - Exonic
931373884 2:61689771-61689793 TCATTTTCTCCCACTCTAAAAGG - Intergenic
931763289 2:65434649-65434671 ACTTTCTCAGGAACTCTCAATGG - Intergenic
931922875 2:67039689-67039711 ACTTTTACTGATACTCTCAGAGG - Intergenic
934950577 2:98572613-98572635 TCTTTTACTGCCACCTTCAAAGG - Intronic
936925187 2:117729825-117729847 CCTTTTTCTGCCTAACTCAAAGG - Intergenic
938485091 2:131697313-131697335 ACATCTTCTGCCACTATCACAGG + Intergenic
938742265 2:134244112-134244134 AGATTTGCTTCCACTCTCAAAGG - Intronic
939572715 2:143859643-143859665 AATGTTTCTGCCACAGTCAATGG + Intergenic
941408082 2:165117160-165117182 ACTTTTTCTTCCAATTTCACTGG + Intronic
942507951 2:176663709-176663731 ATTTTTTCTGCCACTGAAAAAGG + Intergenic
943327505 2:186519107-186519129 ACTTTTTCTGTCAGTCTCTGTGG - Intergenic
944540367 2:200748566-200748588 TGTTTTTGTGCCACTCCCAAGGG + Intergenic
948115411 2:235491719-235491741 ATGTTTTCTGCCACAGTCAAGGG + Intergenic
1171042706 20:21780219-21780241 ACTTTTGGTGCCACTGTGAAAGG + Intergenic
1172854550 20:37992019-37992041 ACTTTTTCTCTCACACACAATGG + Intronic
1173277422 20:41596887-41596909 ACTTTTTGGGCCTCCCTCAAAGG - Intronic
1175515826 20:59569133-59569155 ACTTTATCTGCCACTGACAAGGG - Intergenic
1177129358 21:17237545-17237567 AAATTTCCTTCCACTCTCAAAGG - Intergenic
1180485920 22:15797267-15797289 ACTTCTTCTGCCACTGTCACAGG + Intergenic
1180756790 22:18167954-18167976 GCTGTTTCTGCTACTCTCCATGG - Exonic
1181074974 22:20369489-20369511 GCTGTTTCTGCTACTCTCCATGG + Exonic
1182155493 22:28068346-28068368 AGTTGTCCTGCCTCTCTCAAAGG + Intronic
1184151678 22:42643340-42643362 GCTTTTCCTGCCACCCTCACGGG + Intronic
950018022 3:9767967-9767989 AATTTTGCTGCCACTGTGAAAGG - Intronic
951261184 3:20511386-20511408 ACTTTTTCTCCTTCTCTCACAGG + Intergenic
951810558 3:26694374-26694396 ACTCTTTCTGAGACTCACAATGG - Intronic
952624353 3:35386214-35386236 CCTCTCTCTGCCACTCTCAAAGG + Intergenic
954884991 3:53864891-53864913 TCTTTTTCTGCCACTTTTCAAGG - Exonic
956083080 3:65580017-65580039 ACTTTTTCTGCCTCGTTCACTGG + Intronic
956587954 3:70884136-70884158 TCTTTTTCTGATTCTCTCAAAGG - Intergenic
957463497 3:80554962-80554984 ACTTTTAATGCAATTCTCAAGGG - Intergenic
960975472 3:123169741-123169763 CCTTTGTCTTCCACTCTCACTGG - Intronic
961066714 3:123882761-123882783 CCTTTTTCTCCCACTCTCAGTGG - Intronic
962236414 3:133711154-133711176 ACTCTTTTTCCCAATCTCAACGG + Intergenic
963261966 3:143201988-143202010 ACTTTTCCAGCCACCCTCCATGG + Intergenic
964282651 3:155083061-155083083 ACTTTATCAGCCAGTCTCCAAGG - Intronic
964666584 3:159181348-159181370 ACTTTTGCTGGCATTCTCACTGG + Intronic
965651675 3:170939845-170939867 CCTTCTTCTTCTACTCTCAAGGG + Intergenic
966533984 3:181010567-181010589 CCTATATCTGCGACTCTCAAAGG + Intergenic
966624614 3:182002468-182002490 ATTTTTTCTGCTACTCCCATGGG + Intergenic
969294302 4:6260570-6260592 ACTTTCTCTGCCCGTCTCTATGG + Intergenic
969604229 4:8194323-8194345 ACTTTTTCTGTGACTCTCCCAGG - Intronic
970388157 4:15577681-15577703 GCTTTTTCTACCACTTTCATTGG - Intronic
972478817 4:39478803-39478825 ACTTTTTCTGCATATCTAAAAGG + Intergenic
972714432 4:41631852-41631874 ACTTTTTCTTTCTCTCTCTAAGG - Intronic
972723500 4:41724417-41724439 ACTTTTTCTCCCACTCATTATGG - Intergenic
974258603 4:59495207-59495229 ATTTCTTCTGCCATTCTCTAAGG - Intergenic
976501600 4:85796877-85796899 AATTTTTCTGGCACTCTGGAGGG - Intronic
976974209 4:91147110-91147132 ACTGATTCTGCCAAGCTCAAAGG - Intronic
977888633 4:102281031-102281053 ACTATTTATACCACTCTAAAAGG + Intronic
978831001 4:113084886-113084908 ACTTGTTCTGTCTCTCTCAGAGG - Intronic
980185110 4:129451273-129451295 AAATTTTCTCCCACTCTCAAGGG - Intergenic
980592310 4:134906120-134906142 ATTTTTTCTGAAACTCTCGAAGG + Intergenic
980999898 4:139818613-139818635 AATTTTTCTCCAACTCTCATTGG - Intronic
981288753 4:143049392-143049414 AGTTTATATGCCACTCTCAGAGG + Intergenic
982628670 4:157803189-157803211 ACTTTTTCTATCACTCTTTAAGG + Intergenic
983857949 4:172668715-172668737 TCTTTTTCTGTTACTTTCAATGG - Intronic
984611270 4:181841809-181841831 ACTTTATGTGCCACTCACCATGG + Intergenic
984811665 4:183800774-183800796 ACTTTTATTACCACTCTCTATGG - Intergenic
988361611 5:30242999-30243021 TATTTTTATGCCACTCTTAAAGG - Intergenic
990895676 5:60698352-60698374 ACTTTTTCTTCAAATCTCATTGG - Intronic
991344731 5:65651734-65651756 ATTTTTTCTTCCACTTACAAAGG - Intronic
992764183 5:79980263-79980285 CCTGTTTCTGCCTCTTTCAATGG + Exonic
993043123 5:82837786-82837808 ACTTTTTGTGTCACTGTCAGAGG + Intergenic
993496408 5:88614920-88614942 ACTTTTTCTTCCACTCCCTTCGG - Intergenic
994150433 5:96441388-96441410 ACTTGCTCTGGCTCTCTCAACGG - Intergenic
994685895 5:102951717-102951739 AATTTTTATGTCACTCTAAATGG + Intronic
994902126 5:105787219-105787241 AGTTTTCCTGGCATTCTCAAGGG - Intergenic
995458851 5:112381371-112381393 ACCCTTTCTACCACTCTCTAAGG + Intronic
995637286 5:114208257-114208279 ACTTTATCTCCCACTCTTAGCGG + Intergenic
997468030 5:134101161-134101183 GGATTTTCTGCCACCCTCAAGGG + Intergenic
997843917 5:137268658-137268680 ACATTTTCTGCTATTCTCAAGGG + Intronic
998076469 5:139240688-139240710 TCTCTTTCTTCCACGCTCAAAGG + Intronic
998421786 5:141994214-141994236 ACTTTGGCTGCCACTCTGAGAGG + Intronic
998897555 5:146815910-146815932 ATTTGTTTTGCCACCCTCAAAGG - Intronic
999701570 5:154233323-154233345 ACCATTTCTGCCGCACTCAAAGG - Intronic
1000260995 5:159588598-159588620 ACATTTTATCCCATTCTCAAAGG + Intergenic
1003184894 6:3822062-3822084 ACTCTCTGTGCCACTCTCATAGG - Intergenic
1003862263 6:10333165-10333187 ACTTGCTCTGCCACTCCAAATGG + Intergenic
1004240279 6:13915156-13915178 CCTTTTTCTCCCACTCTCCCAGG - Intergenic
1004893637 6:20125525-20125547 AGTCTTTCTGCCACTCTCCAAGG - Intronic
1005291338 6:24382164-24382186 ATTATTTTTGTCACTCTCAATGG + Intergenic
1006697444 6:35943230-35943252 ACTTTTGCTGTCATTCTCAGAGG - Intergenic
1010065275 6:71675489-71675511 TCTTTCTCTGCCCCTCTGAAAGG + Intergenic
1010454973 6:76044319-76044341 GCTTTTTCTTCCATTCTAAATGG - Intronic
1011240661 6:85268123-85268145 AATTGTTGTGCCACTCTCAATGG + Intergenic
1012174014 6:96056271-96056293 TCTTTTTCTACCCCACTCAATGG - Intronic
1012870630 6:104669089-104669111 AATTTTTCTCCCATTCTCTAGGG - Intergenic
1015428172 6:133096912-133096934 ACTTTTTCTTCTGCTCTCTAGGG + Intergenic
1015447364 6:133322218-133322240 ATGTCTTCTGTCACTCTCAAAGG - Intronic
1015919441 6:138252104-138252126 ATTTCTTCTTCCACCCTCAAAGG + Intronic
1016373233 6:143395293-143395315 CTTTTTTCTTCTACTCTCAATGG - Intergenic
1018423549 6:163661029-163661051 ATTTTTTCAGACACCCTCAAGGG - Intergenic
1018480938 6:164189601-164189623 ACTTTTTTAGTAACTCTCAAAGG - Intergenic
1018646012 6:165949133-165949155 ATCTTTTCTTCCACCCTCAATGG + Intronic
1019225031 6:170502091-170502113 ACATGTTCTGCCACTGTCAGGGG + Intergenic
1021852887 7:24825884-24825906 AGCTTTTCTGACACTGTCAAGGG + Intronic
1022422896 7:30240855-30240877 ACTTTCTCTCTCTCTCTCAATGG + Intergenic
1022483887 7:30763019-30763041 AGTTTTTCTGTCACTCTGAATGG + Intronic
1026505090 7:70975839-70975861 ACTTTTTGTGTCACTCTAGAGGG - Intergenic
1027292176 7:76726033-76726055 AATTTTTCTGCAACTCTCTAGGG + Intergenic
1027713875 7:81644560-81644582 ACTTTTTCTGCCAGAAACAAAGG - Intergenic
1028428254 7:90715614-90715636 ACTTTTTCTCCCTCTCCCACAGG - Intronic
1030074033 7:105721295-105721317 CCTTTTTCTGCCTCCCTCAAGGG - Intronic
1035861407 8:3032347-3032369 ACCTTTTCTACCACTCTTTAGGG - Intronic
1036599684 8:10248874-10248896 TTTTATACTGCCACTCTCAATGG - Intronic
1036721969 8:11184458-11184480 ACATTTTCTGACATTCTTAATGG - Intronic
1039009047 8:33073263-33073285 CCTGTTTCTGACTCTCTCAAAGG - Intergenic
1041598419 8:59685772-59685794 TCTTTTTCTGCCATTTTCAGGGG - Intergenic
1044261341 8:90126445-90126467 ACTATTTCTCCCTCTGTCAAAGG - Intergenic
1046355295 8:113076304-113076326 TCTTTTGCTGCCACTGTCAAGGG + Intronic
1048302858 8:133264486-133264508 CCTTTTTCCGCCACTCTCTTGGG + Intronic
1048608843 8:135999935-135999957 ACTTTTACTCCCACTCCTAAAGG - Intergenic
1050120411 9:2301816-2301838 ATTTCTTCTGCAGCTCTCAAAGG + Intergenic
1050650652 9:7772335-7772357 CCTTTTTCCACCACTCTCCATGG + Intergenic
1050949870 9:11575003-11575025 ACCTTTTCAGTCTCTCTCAAGGG + Intergenic
1051184750 9:14448464-14448486 AATATTACTGCCACTCTCATGGG - Intergenic
1051428074 9:16954409-16954431 ACCTTTTCTGCCACTCACACTGG - Intergenic
1052433534 9:28397200-28397222 ACTTTTACTGCCTCTTTCATAGG - Intronic
1057656613 9:96958949-96958971 AAATTTTCTGCCTCTCTTAATGG + Intronic
1058294037 9:103282914-103282936 ACTTTTTTTTCCCCTCTCACTGG - Intergenic
1061674147 9:132206280-132206302 AGTTTTTGTTCCATTCTCAAAGG + Intronic
1061895521 9:133645013-133645035 ACTTTTTCTCTCTCTCTGAATGG + Intronic
1062327257 9:136018214-136018236 AGTTTTTCTGTGACTCTCCAAGG - Intronic
1185835493 X:3342783-3342805 TCTTCTTCTACCACTGTCAATGG + Intronic
1186131595 X:6472229-6472251 GCTTTTCCTGCCACTGTTAAGGG + Intergenic
1186374767 X:8987784-8987806 ACTTGTTTTGCAACTCTCCATGG + Intergenic
1191858137 X:65644061-65644083 CCTTGTTCTGCCTCTCTCACTGG + Intronic
1192484624 X:71514359-71514381 TCTTTTCCTTCCCCTCTCAATGG - Intronic
1192563499 X:72143294-72143316 ACTCGTTCTGCCACCCACAAAGG - Intergenic
1194121693 X:89971190-89971212 GCTTGTTTTGTCACTCTCAAGGG + Intergenic
1194846265 X:98813034-98813056 TATTTTTCTGCCATTCTTAATGG + Intergenic
1195496839 X:105546078-105546100 AGCTGTTCTGCCACTATCAAAGG - Intronic
1197811113 X:130443913-130443935 ACTATCCCTGCCACTCTAAATGG - Intergenic
1197858845 X:130948424-130948446 ACTTTTTCTAATTCTCTCAAAGG + Intergenic
1199405167 X:147448997-147449019 ACTTTTTCTGGGACTCTCACAGG + Intergenic
1200474549 Y:3628641-3628663 GCTTGTTTTGTCACTCTCAAGGG + Intergenic