ID: 1163516026

View in Genome Browser
Species Human (GRCh38)
Location 19:17764369-17764391
Sequence TCTCCTCGATGGTGGCCCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163516026_1163516036 24 Left 1163516026 19:17764369-17764391 CCCCAGGGCCACCATCGAGGAGA 0: 1
1: 0
2: 0
3: 13
4: 113
Right 1163516036 19:17764416-17764438 TCTCCAAGCTGGCCAGCAACGGG 0: 1
1: 0
2: 1
3: 19
4: 193
1163516026_1163516035 23 Left 1163516026 19:17764369-17764391 CCCCAGGGCCACCATCGAGGAGA 0: 1
1: 0
2: 0
3: 13
4: 113
Right 1163516035 19:17764415-17764437 CTCTCCAAGCTGGCCAGCAACGG 0: 1
1: 0
2: 1
3: 14
4: 314
1163516026_1163516032 -5 Left 1163516026 19:17764369-17764391 CCCCAGGGCCACCATCGAGGAGA 0: 1
1: 0
2: 0
3: 13
4: 113
Right 1163516032 19:17764387-17764409 GGAGACCTACTCGAAGGCGATGG 0: 1
1: 0
2: 0
3: 2
4: 53
1163516026_1163516034 13 Left 1163516026 19:17764369-17764391 CCCCAGGGCCACCATCGAGGAGA 0: 1
1: 0
2: 0
3: 13
4: 113
Right 1163516034 19:17764405-17764427 GATGGCGAAACTCTCCAAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163516026 Original CRISPR TCTCCTCGATGGTGGCCCTG GGG (reversed) Exonic