ID: 1163516026

View in Genome Browser
Species Human (GRCh38)
Location 19:17764369-17764391
Sequence TCTCCTCGATGGTGGCCCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163516026_1163516035 23 Left 1163516026 19:17764369-17764391 CCCCAGGGCCACCATCGAGGAGA 0: 1
1: 0
2: 0
3: 13
4: 113
Right 1163516035 19:17764415-17764437 CTCTCCAAGCTGGCCAGCAACGG 0: 1
1: 0
2: 1
3: 14
4: 314
1163516026_1163516034 13 Left 1163516026 19:17764369-17764391 CCCCAGGGCCACCATCGAGGAGA 0: 1
1: 0
2: 0
3: 13
4: 113
Right 1163516034 19:17764405-17764427 GATGGCGAAACTCTCCAAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 61
1163516026_1163516036 24 Left 1163516026 19:17764369-17764391 CCCCAGGGCCACCATCGAGGAGA 0: 1
1: 0
2: 0
3: 13
4: 113
Right 1163516036 19:17764416-17764438 TCTCCAAGCTGGCCAGCAACGGG 0: 1
1: 0
2: 1
3: 19
4: 193
1163516026_1163516032 -5 Left 1163516026 19:17764369-17764391 CCCCAGGGCCACCATCGAGGAGA 0: 1
1: 0
2: 0
3: 13
4: 113
Right 1163516032 19:17764387-17764409 GGAGACCTACTCGAAGGCGATGG 0: 1
1: 0
2: 0
3: 2
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163516026 Original CRISPR TCTCCTCGATGGTGGCCCTG GGG (reversed) Exonic
900385025 1:2406603-2406625 TCTCCTCCAAGGAGGCCCTGGGG + Exonic
900485036 1:2918607-2918629 CTTCCCCGCTGGTGGCCCTGGGG + Intergenic
901068630 1:6506426-6506448 TCTCCTCGGTGGGGGCTCCGAGG - Intronic
906132976 1:43472374-43472396 ATGCCTCCATGGTGGCCCTGAGG - Intergenic
912486091 1:110029664-110029686 TGTCCTGGGTTGTGGCCCTGAGG + Intergenic
920431062 1:205919485-205919507 TCTCCCCGAACGTGGCCATGCGG + Intronic
920704517 1:208241955-208241977 TCTCCTTGGTGGTGGCCTGGAGG - Intronic
923498125 1:234542398-234542420 CCACCCCGAGGGTGGCCCTGTGG + Intergenic
1063472279 10:6297711-6297733 GCTCCTTGATGATGACCCTGTGG + Intergenic
1063665106 10:8056110-8056132 TCTCCCGGCTGGTGGCCCTGGGG + Intronic
1065773640 10:29100261-29100283 TCTCCTTGATCGTGGCAGTGGGG - Intergenic
1066059193 10:31707315-31707337 TGACCTCGATGGTGGGCCAGGGG - Intergenic
1067799720 10:49350685-49350707 CCTCCTCCATGCTGTCCCTGAGG - Intergenic
1068691303 10:59918196-59918218 TGTCTTCTATGGTGGCCTTGGGG - Intergenic
1070575371 10:77673271-77673293 TCTCTTGGTTGGTGACCCTGTGG - Intergenic
1071076465 10:81759441-81759463 TCTTCTCCATGGTGGCCAGGTGG - Intergenic
1072621684 10:97083953-97083975 GCTCCTGGGTGGTGGCCCAGAGG - Intronic
1073111254 10:101064343-101064365 TCCACTCGATGGAGGCCATGGGG - Exonic
1075316144 10:121455171-121455193 TCTCCTTCCTGGTGGCCTTGTGG + Intergenic
1077711502 11:4541652-4541674 TCTCCTTGTTTGTGGCTCTGTGG - Intergenic
1078362055 11:10676633-10676655 TCTCCTGTGTGGTGGCACTGTGG - Intronic
1081813840 11:45927914-45927936 GCTGCTCAATGGAGGCCCTGAGG - Exonic
1083246761 11:61434546-61434568 TCTCCTTGATGGAGTCCCTAAGG + Intronic
1083264044 11:61537958-61537980 CCACCTCGGTGGTGTCCCTGGGG - Intronic
1084123484 11:67083243-67083265 CCTCCTGGATGGTGGGCCTGAGG - Intergenic
1084661880 11:70550848-70550870 CCTGCTCCATGGAGGCCCTGAGG - Intronic
1091637317 12:2207097-2207119 GCTCCTCGAATGTGGTCCTGGGG - Intronic
1102206787 12:111096394-111096416 TCTGCTCTGTGGTGGCCATGGGG - Intronic
1103783566 12:123415582-123415604 TCTGCACGCTGGAGGCCCTGGGG + Exonic
1106781227 13:33060971-33060993 TCACCCCAGTGGTGGCCCTGTGG + Exonic
1107026282 13:35804871-35804893 TCTCCCCGATGCTGCCTCTGTGG - Intronic
1111798675 13:92956399-92956421 TCTCTTCTATGTTGGCCCTATGG + Intergenic
1119437097 14:74604799-74604821 ACTCCTTGATGTTGGCTCTGAGG + Intronic
1120186363 14:81397527-81397549 TCTCCAATATGGTGGCCATGTGG - Intronic
1121839467 14:97120674-97120696 TCTCCAGGAAGGGGGCCCTGTGG - Intergenic
1122369622 14:101222113-101222135 TCTCCTGGGCTGTGGCCCTGAGG + Intergenic
1126420276 15:48465129-48465151 TCTCCTAGAAGGCGGCCCTTTGG - Intronic
1129257071 15:74339594-74339616 TCTCCTTGATGCTGGCTTTGAGG + Exonic
1132088981 15:98932439-98932461 GCTCCTGGCTGGTGGCACTGGGG + Intronic
1132598979 16:765547-765569 TCTCCACGATGGACGCTCTGCGG + Exonic
1132880030 16:2158109-2158131 TCTCCTGGATGGACACCCTGCGG + Intronic
1134205513 16:12234523-12234545 TTTTCTCGATGGTGTCCTTGAGG + Intronic
1135285527 16:21189557-21189579 TCCCATAGATGGTGGACCTGAGG + Intergenic
1138345025 16:56315517-56315539 TCTCCTGGATGGGGGCTCTCTGG - Intronic
1139268586 16:65661800-65661822 GCTCTTTGATGGTGGCACTGGGG - Intergenic
1144862968 17:18317313-18317335 TGTCCTCGCTGATGGTCCTGTGG - Exonic
1144947444 17:18977127-18977149 TCCCTTTGATTGTGGCCCTGAGG - Intronic
1148991698 17:51671800-51671822 TCTCCTCCATGCTGGCCTTCTGG + Intronic
1151498629 17:74474638-74474660 CCTCCTGGATGCTGGCACTGTGG - Exonic
1160570051 18:79810002-79810024 GCTCCGCGAGGCTGGCCCTGTGG - Intergenic
1163516026 19:17764369-17764391 TCTCCTCGATGGTGGCCCTGGGG - Exonic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
927524139 2:23721636-23721658 TCTTCTGGGTGGTGGCCCAGAGG - Intergenic
930030956 2:47057695-47057717 TCTCCTCTCTCGTGACCCTGGGG + Intronic
930759838 2:55022143-55022165 TCTAGTAGATGGTGGCCCTTAGG - Intronic
931859252 2:66336566-66336588 TCTGCTCAAAGGTGACCCTGAGG + Intergenic
933686886 2:85148476-85148498 TCTCCCTGAGGGGGGCCCTGGGG - Intronic
933829455 2:86195211-86195233 TCCCGACGAGGGTGGCCCTGAGG + Intronic
934661142 2:96144361-96144383 TTCCCTCCAGGGTGGCCCTGTGG - Exonic
946410839 2:219514466-219514488 TCTCCTCGATCGTCTCCTTGTGG - Exonic
948012777 2:234663184-234663206 GCTCCTCTCTGGTGGCTCTGAGG - Intergenic
1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG + Intronic
1170317949 20:15062893-15062915 TCCTCTTGATGGTGTCCCTGGGG - Intronic
1170605326 20:17871333-17871355 TGTACTCGATGGTTGCCCTGTGG - Intergenic
1172842407 20:37909843-37909865 TCTCCTAGCTGCTGGTCCTGGGG + Intronic
1175790435 20:61737118-61737140 CCTGCTGGATGCTGGCCCTGGGG + Intronic
1175832880 20:61976654-61976676 TCACATGGAGGGTGGCCCTGGGG - Intronic
1176331665 21:5553964-5553986 GGTCCTCGATGCTGGCCCAGCGG - Intergenic
1176396092 21:6266987-6267009 GGTCCTCGATGCTGGCCCAGCGG + Intergenic
1176441065 21:6722117-6722139 GGTCCTCGATGCTGGCCCAGCGG - Intergenic
1176465327 21:7049186-7049208 GGTCCTCGATGCTGGCCCAGCGG - Intronic
1176488888 21:7430964-7430986 GGTCCTCGATGCTGGCCCAGCGG - Intergenic
1176519634 21:7814903-7814925 TGTCCTCGAGTGTGGTCCTGGGG - Intergenic
1178504520 21:33151974-33151996 TCTCCTCGATGGTTGTCTTTGGG - Intergenic
1178653662 21:34444916-34444938 TGTCCTCGAGTGTGGTCCTGGGG - Intergenic
1179831752 21:44001272-44001294 TCTCCACGATGGCCGCCCTGGGG - Intergenic
1180005210 21:45017619-45017641 TCTCCCCCATGGTGGGCCAGAGG - Intergenic
1180917696 22:19500218-19500240 TGTCCTGGTTGGTGGCCCTTTGG + Intronic
1181174745 22:21029117-21029139 TCTCCTCCAGGCTGCCCCTGGGG + Exonic
1183569487 22:38641658-38641680 GCTTCTCGATGGTGGCTATGAGG - Intronic
951519512 3:23598236-23598258 ACTTCACGATGGTGGCCTTGGGG + Intergenic
956250647 3:67230718-67230740 ACTCCACGGTGGTGTCCCTGGGG + Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
969258741 4:6020866-6020888 CCTCCTCCTTGGTGGCCCTGGGG - Intergenic
982380361 4:154742738-154742760 CCTCCTCGAGGGTGGTCCTAGGG - Intronic
983718130 4:170811226-170811248 TCTCATCGTTGCAGGCCCTGTGG - Intergenic
990639211 5:57762609-57762631 CCTCCATGAAGGTGGCCCTGTGG - Intergenic
996835446 5:127786952-127786974 CCTGCTGGATGGTGGCTCTGAGG + Intergenic
997032075 5:130141920-130141942 CCTCTTCAATGGGGGCCCTGGGG - Intronic
997365271 5:133321505-133321527 ACTCCTCCCTGGTGCCCCTGTGG + Intronic
997380329 5:133431437-133431459 TCTCCTACATGGTGGCTCAGGGG - Intronic
1001158819 5:169296557-169296579 TGTCCTCTAAGCTGGCCCTGAGG + Intronic
1001855036 5:175003682-175003704 TCTCCTCCTCTGTGGCCCTGTGG - Intergenic
1003097272 6:3152355-3152377 TCTCCTCGATAGTGGTCATGGGG + Intronic
1005505955 6:26468961-26468983 TCTCCTCTCTGGTGGTCCTGTGG - Exonic
1005806246 6:29476624-29476646 TCACCTGGAAGGTGACCCTGAGG - Intergenic
1006387067 6:33737150-33737172 TCTCCCTGAGGGTGGGCCTGTGG + Intronic
1006636642 6:35466160-35466182 TCTCCTCAATAGAGCCCCTGGGG + Intronic
1006996263 6:38264199-38264221 TCTCCTCAGCGGTGGCACTGGGG + Intronic
1009702644 6:67202774-67202796 TCTCCTCCATGAAGGCCCTTTGG + Intergenic
1009900195 6:69800345-69800367 CCTCCTCCATGGAAGCCCTGGGG + Intergenic
1012829365 6:104186418-104186440 ACACCTCCATAGTGGCCCTGTGG - Intergenic
1020178143 7:5898961-5898983 TCCCCGGGAAGGTGGCCCTGTGG + Intronic
1020304784 7:6826014-6826036 TCCCCGGGAAGGTGGCCCTGTGG - Intronic
1020688282 7:11322909-11322931 TCTCCTGGATGGAGGCCTAGAGG + Intergenic
1023280508 7:38564549-38564571 TGTTCATGATGGTGGCCCTGAGG - Intronic
1023308520 7:38856763-38856785 TCCCCTGGATTGTAGCCCTGAGG - Intronic
1023811961 7:43918791-43918813 ACTCCTCCATGGTGCCCTTGGGG - Intronic
1023836029 7:44067666-44067688 CTTCCTGGATGGAGGCCCTGAGG - Intronic
1024563202 7:50661577-50661599 TCTTCTCTAGGGTGCCCCTGGGG + Intronic
1024627189 7:51218022-51218044 GCTCCTCAGTGGGGGCCCTGTGG - Intronic
1025030743 7:55554715-55554737 CCTCCTCCAGGGTGGCCCAGAGG - Intronic
1026378273 7:69773849-69773871 TCTCCTCCCTGGTGGCAGTGGGG + Intronic
1026911763 7:74095208-74095230 TCTCCTAGATTGTGGCCCTTTGG + Intronic
1037778526 8:21851571-21851593 TTTCCTCGAGGGTGGCACTCTGG - Intergenic
1043402141 8:79894206-79894228 CCTCCTGGATGGTGGACCTAGGG + Intergenic
1043625796 8:82256475-82256497 TGTTCTCCATGGTGGCCATGTGG - Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045390000 8:101705727-101705749 TCTCCTCCATGGTGGCTTTGGGG - Intronic
1049206873 8:141367615-141367637 TCTCCTGGATGGTGCAGCTGAGG - Intergenic
1049642104 8:143720463-143720485 GCTCCTAGAGGGTGGCCCAGAGG + Intronic
1049771931 8:144386825-144386847 TGTTTTCCATGGTGGCCCTGAGG - Intronic
1056901945 9:90608043-90608065 TCTGCAGGGTGGTGGCCCTGAGG - Intergenic
1057208633 9:93187654-93187676 TCTCCTCACTGGTGACCTTGGGG - Intronic
1061897993 9:133658467-133658489 CCTCCTCCATGCTGTCCCTGTGG + Exonic
1203430434 Un_GL000195v1:86370-86392 GGTCCTCGATGCTGGCCCAGCGG + Intergenic
1200167700 X:154048600-154048622 TCTCCTCTCTGGATGCCCTGCGG - Intronic