ID: 1163517945

View in Genome Browser
Species Human (GRCh38)
Location 19:17776088-17776110
Sequence CGCTGCTGCCTCGGGGCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 301}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163517945_1163517953 0 Left 1163517945 19:17776088-17776110 CCTGCAGCCCCGAGGCAGCAGCG 0: 1
1: 0
2: 1
3: 27
4: 301
Right 1163517953 19:17776111-17776133 GCACAGCTCAGGGCCACCGCGGG 0: 1
1: 0
2: 0
3: 18
4: 193
1163517945_1163517956 21 Left 1163517945 19:17776088-17776110 CCTGCAGCCCCGAGGCAGCAGCG 0: 1
1: 0
2: 1
3: 27
4: 301
Right 1163517956 19:17776132-17776154 GGCAGCCTCATCCTTCCTCCTGG 0: 1
1: 0
2: 5
3: 82
4: 448
1163517945_1163517952 -1 Left 1163517945 19:17776088-17776110 CCTGCAGCCCCGAGGCAGCAGCG 0: 1
1: 0
2: 1
3: 27
4: 301
Right 1163517952 19:17776110-17776132 GGCACAGCTCAGGGCCACCGCGG 0: 1
1: 0
2: 1
3: 23
4: 252
1163517945_1163517959 28 Left 1163517945 19:17776088-17776110 CCTGCAGCCCCGAGGCAGCAGCG 0: 1
1: 0
2: 1
3: 27
4: 301
Right 1163517959 19:17776139-17776161 TCATCCTTCCTCCTGGCCCAGGG 0: 1
1: 0
2: 2
3: 54
4: 451
1163517945_1163517951 -10 Left 1163517945 19:17776088-17776110 CCTGCAGCCCCGAGGCAGCAGCG 0: 1
1: 0
2: 1
3: 27
4: 301
Right 1163517951 19:17776101-17776123 GGCAGCAGCGGCACAGCTCAGGG 0: 1
1: 0
2: 2
3: 20
4: 241
1163517945_1163517960 29 Left 1163517945 19:17776088-17776110 CCTGCAGCCCCGAGGCAGCAGCG 0: 1
1: 0
2: 1
3: 27
4: 301
Right 1163517960 19:17776140-17776162 CATCCTTCCTCCTGGCCCAGGGG 0: 1
1: 0
2: 8
3: 42
4: 349
1163517945_1163517958 27 Left 1163517945 19:17776088-17776110 CCTGCAGCCCCGAGGCAGCAGCG 0: 1
1: 0
2: 1
3: 27
4: 301
Right 1163517958 19:17776138-17776160 CTCATCCTTCCTCCTGGCCCAGG 0: 1
1: 0
2: 10
3: 62
4: 557

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163517945 Original CRISPR CGCTGCTGCCTCGGGGCTGC AGG (reversed) Exonic
900168758 1:1255899-1255921 CTCCCCTGCCTCGGGGCTCCTGG + Intronic
900193579 1:1362138-1362160 CCCTGCCTCCTCGGGGCTGCAGG - Intergenic
900287810 1:1909864-1909886 CGCTGCTGGTCCGGGGCTGCTGG + Intergenic
900335473 1:2160923-2160945 TGCTGCCTCCTCAGGGCTGCAGG + Intronic
900488142 1:2933191-2933213 CTCTGGGGCCTCGGGGGTGCAGG + Intergenic
900687576 1:3958456-3958478 CGATGCAGCCTGGGGTCTGCAGG + Intergenic
901057478 1:6455384-6455406 CGGTGCTGGCCCGGGGCTGGAGG + Intronic
902546628 1:17194355-17194377 CTCTGGGGCCTCGGGGCTCCTGG + Intergenic
903299960 1:22371783-22371805 CTTTGCTGCCTCAGGGCTGGGGG - Intergenic
906103885 1:43280085-43280107 GGGAGATGCCTCGGGGCTGCTGG - Intergenic
906762265 1:48386875-48386897 CCCTGCTGCCACTGGGCTCCAGG - Intronic
906896427 1:49778319-49778341 TGCTACTGCATCAGGGCTGCGGG - Intronic
906964224 1:50440813-50440835 TGCTGCTGCCTTGGGTCTCCAGG - Exonic
913069583 1:115286622-115286644 CGCCGCTGCCGGGGCGCTGCGGG + Exonic
913112961 1:115672403-115672425 CACTCGTGCCTCGGGCCTGCTGG - Intronic
913961947 1:143346399-143346421 GGCTGCTGCCTCGGTTGTGCCGG - Intergenic
914056302 1:144171973-144171995 GGCTGCTGCCTCGGTTGTGCCGG - Intergenic
914122844 1:144794389-144794411 GGCTGCTGCCTCGGTTGTGCCGG + Intergenic
914428279 1:147599168-147599190 CGCTGATGCGCCGGGGGTGCAGG - Intronic
915333491 1:155127777-155127799 CGCGGCTGCCTGGGGGCTTGGGG - Exonic
915605026 1:156945025-156945047 CTCTGCTGCCAGGGGGTTGCTGG + Exonic
918423816 1:184388061-184388083 CGCGGCTGCCTTTGGTCTGCTGG + Intronic
919640305 1:200039539-200039561 CTCCGCCTCCTCGGGGCTGCCGG - Intronic
919872043 1:201829230-201829252 TGGTGCGGCCTCCGGGCTGCCGG + Exonic
920444150 1:206002942-206002964 CGCTGCTGCCTCAAACCTGCAGG - Intronic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
922991976 1:229921829-229921851 GGCTTCTGCCCCGGGGCTCCAGG - Intergenic
1064090052 10:12375548-12375570 GGATGCTGCCTTGGTGCTGCTGG + Intronic
1064128060 10:12681456-12681478 CGCTCCTGCAGCAGGGCTGCTGG + Intronic
1065100515 10:22326106-22326128 TGCAGCAGCCTTGGGGCTGCTGG + Intronic
1065214814 10:23439301-23439323 GGCTGCTGACTCGCGGCGGCCGG + Intergenic
1065844956 10:29736408-29736430 CGCTGCAGCCCCGGAGATGCGGG + Intronic
1066180551 10:32957827-32957849 CGCTGTCACGTCGGGGCTGCCGG - Exonic
1066406904 10:35127071-35127093 CGCTGCCGGCTCCGGGTTGCTGG + Intronic
1067732150 10:48820262-48820284 AGCTGCGGCCTCAGGACTGCTGG - Exonic
1067883490 10:50067692-50067714 CGCCGCTGCCTCGGGCCTTGGGG + Intergenic
1069773469 10:70913692-70913714 TGCTGCTGGCCCTGGGCTGCAGG - Intergenic
1070569152 10:77627974-77627996 CTCTGCTGGCTGGGGGCTTCAGG - Intronic
1073144024 10:101267515-101267537 GGCTGCTGCTCCAGGGCTGCAGG + Intergenic
1073474582 10:103744505-103744527 CTCTGCAGCCTGGGGACTGCAGG + Intronic
1075334435 10:121598263-121598285 AGCTGCGGCCTCGGGGCCCCCGG + Exonic
1075492139 10:122880197-122880219 CGCTCATGCCTCGGGGCCTCGGG - Intergenic
1075645416 10:124093157-124093179 CGCTGAAGCCTCGGGGAGGCCGG + Intronic
1076372915 10:129966730-129966752 CGCTGCTGGCTCCGAGCTGTGGG + Intergenic
1076374234 10:129972834-129972856 CGCGGCCGCCTGGGGGCCGCGGG + Intergenic
1076475426 10:130748510-130748532 CGCTCCTGCATCTGGGCTGCAGG + Intergenic
1076610547 10:131723406-131723428 CGCAGGTGCCTCATGGCTGCAGG + Intergenic
1076904008 10:133353305-133353327 CGCTGCAGCATTGGGCCTGCTGG - Intergenic
1076919250 10:133442753-133442775 CTCTGCTGCCGTGGGGCTGTGGG + Intergenic
1077047753 11:553854-553876 GACCACTGCCTCGGGGCTGCAGG + Intronic
1077052751 11:575159-575181 CGCTGCTCCTCGGGGGCTGCTGG + Intergenic
1077102273 11:827548-827570 CCCTGCTGCCGCGCGGCTTCCGG + Intronic
1079451177 11:20601166-20601188 CGCCGCCGCCTCCGGGCTGTTGG - Exonic
1080606824 11:33870476-33870498 GGCTGCGGGCTCCGGGCTGCGGG + Intronic
1083596257 11:63919425-63919447 CCCTGCCGCCCCGGGGCTGCGGG + Intergenic
1083871946 11:65493933-65493955 CACTGCGGCCTCTGGGCTCCAGG + Intergenic
1083922317 11:65787508-65787530 CGCGGCGGCGTCGAGGCTGCGGG + Intronic
1085020003 11:73200615-73200637 CTTTGCTGCCTAGGGTCTGCAGG + Intergenic
1085052873 11:73388795-73388817 TGCTGATGCCTCGGGGCACCTGG + Intronic
1085640282 11:78188914-78188936 CGGCGCGGCCCCGGGGCTGCGGG - Exonic
1089025599 11:115266389-115266411 TGCTACTGCCTGGGGCCTGCTGG + Intronic
1089161962 11:116445248-116445270 TCCTGCTACCTCTGGGCTGCTGG + Intergenic
1090403772 11:126465405-126465427 TGCTGCAGCCCCGGGGGTGCTGG + Intronic
1090619711 11:128549742-128549764 CCCTCCTTCCTCGGGGCTGTTGG + Intronic
1090716158 11:129433315-129433337 AGCTGCTGCCTCTGGTCTACTGG + Intronic
1091546942 12:1507506-1507528 AGGTGCTGCCTCCGGACTGCGGG - Intergenic
1091759604 12:3077869-3077891 CGCGGGTGCCGGGGGGCTGCAGG - Intronic
1093082180 12:14825260-14825282 TGCTGCTGCCTCCTGGCTTCTGG + Intronic
1093308444 12:17547640-17547662 TGCTGCTGCCTCTGGGGTGAAGG + Intergenic
1094375522 12:29784117-29784139 CGCGGCTGCCCGGGAGCTGCGGG + Intronic
1094469774 12:30793323-30793345 TGTTGCTGACTCAGGGCTGCAGG - Intergenic
1094470282 12:30796241-30796263 TGCTGCGGCCGCGGGGCGGCGGG - Intergenic
1095099195 12:38163299-38163321 CCAGGCTGCTTCGGGGCTGCAGG + Intergenic
1095964342 12:47857052-47857074 CGCACCTGCCCTGGGGCTGCTGG - Intronic
1098898067 12:76084867-76084889 CGCCTGGGCCTCGGGGCTGCAGG - Exonic
1102492172 12:113296031-113296053 GGCGGCTGCCTGGGGGCTGCTGG - Exonic
1103325312 12:120116527-120116549 CGCGGGGGCCTCGGGGCGGCAGG - Intronic
1103986187 12:124768970-124768992 TGAAGCTGCCTAGGGGCTGCTGG - Intergenic
1104719123 12:131034867-131034889 CGCTCTTGCCTGGGGCCTGCAGG + Intronic
1104946116 12:132415570-132415592 AGCTGCTGCCTCAGGGCTATGGG - Intergenic
1105389150 13:19959026-19959048 CGCTGCCGCGTCGGGGCCTCGGG + Intronic
1105843072 13:24272277-24272299 CGGTGCTCCCTCGGTGCTGCTGG + Intronic
1105865685 13:24457326-24457348 AGCTGCTGCCTCGTGGCAGGAGG - Intronic
1106407538 13:29487084-29487106 GGCTGCTGCCTCCCAGCTGCAGG - Intronic
1107604025 13:42040805-42040827 CGCCGCTGCGCCGGGGCTCCTGG - Intronic
1107605108 13:42048854-42048876 CGCCGCTGCCTCGGCGGGGCCGG + Exonic
1108322977 13:49304710-49304732 GGCTGCTGCCTCTGGGCTCTGGG + Intergenic
1109745891 13:66622365-66622387 GGCTCCTGCACCGGGGCTGCAGG - Intronic
1112163450 13:96893018-96893040 TGCTCCTGCCTCAGGGCTTCTGG - Intergenic
1112561725 13:100521311-100521333 CGCTGCCGGCTCGGGACTTCAGG - Intronic
1112650313 13:101389555-101389577 CTCTGCTGCCTCTGGACTGCTGG - Intronic
1113053195 13:106237078-106237100 CACTGCCGCCTCGTGGCTCCAGG + Intergenic
1117092989 14:52268667-52268689 CCCTGCTGCCTCGGGGCCCGGGG - Intronic
1118319276 14:64743629-64743651 CCCTGCTGGCTCGGGTCTGCCGG - Exonic
1118748345 14:68789889-68789911 CGCCGCTGCCACCGGGCTGCTGG - Exonic
1121042223 14:90758587-90758609 GGCGGCTGCCGAGGGGCTGCGGG + Intronic
1121048404 14:90804365-90804387 AGCTGAAGCCTCGAGGCTGCAGG + Intronic
1121137207 14:91509895-91509917 CGCGGCCCCCTCGGGGCTGCCGG - Exonic
1121552757 14:94814750-94814772 TGCTTCTGCCTCAGGGATGCTGG - Intergenic
1122119057 14:99542188-99542210 AGCTGCAGCCTCAGGGCTGGTGG + Intronic
1122384349 14:101333804-101333826 TGGTGCTGACTTGGGGCTGCTGG - Intergenic
1122657919 14:103274182-103274204 CGGGGCTGCTGCGGGGCTGCTGG - Intergenic
1122697542 14:103563263-103563285 TGCGGGAGCCTCGGGGCTGCGGG - Intronic
1122826829 14:104374634-104374656 CCCTGCTGGCTGGGTGCTGCTGG + Intergenic
1122896616 14:104760742-104760764 CGCTGCCCCCTCGGGCCTGTCGG + Intronic
1123019895 14:105392774-105392796 GGCTGCAGCCTCGCCGCTGCTGG - Exonic
1124023445 15:25944302-25944324 CTCTGCTTCCTCTGGGCTGCTGG - Intergenic
1124983174 15:34582939-34582961 CCTTGTTGCCCCGGGGCTGCAGG - Intronic
1125502619 15:40248858-40248880 CTCTGCTGCTTAGAGGCTGCTGG - Intronic
1125717894 15:41830088-41830110 GTCGGCTGCCTCGGGGATGCAGG - Intronic
1128073390 15:64811177-64811199 TGAAGCTGCCTAGGGGCTGCCGG - Intergenic
1129669551 15:77599656-77599678 AGCTGCTGCCTAGGGGCTGAGGG + Intergenic
1130348142 15:83067361-83067383 CGCCCCTGCCCTGGGGCTGCCGG - Intergenic
1130370873 15:83284547-83284569 CGCTGCGGTGCCGGGGCTGCCGG + Exonic
1131107314 15:89743956-89743978 CACTGCTGCCCCTGGCCTGCTGG + Intergenic
1132055948 15:98650075-98650097 CGCTGCTGCCTGCGCGCCGCAGG - Intronic
1132458363 16:36678-36700 AGCTGCAGACTCGTGGCTGCAGG + Intergenic
1132497194 16:269451-269473 GGCTGTGGCCTGGGGGCTGCTGG - Intronic
1132580928 16:684323-684345 CGCGGCTGCCTGAGGGCGGCAGG - Exonic
1132643816 16:989780-989802 CTCGGCTGCCTGGGAGCTGCAGG + Intergenic
1132708891 16:1257919-1257941 CGCCCCTTCCCCGGGGCTGCAGG + Intronic
1133259468 16:4538706-4538728 GGCCGCTGCCCCAGGGCTGCGGG - Intronic
1133858855 16:9575164-9575186 CGCTGCTGGATTGGGGCTGCTGG + Intergenic
1134049355 16:11126076-11126098 CGCTGCTGCCCCGGCGCCCCTGG - Exonic
1134609735 16:15598601-15598623 GGCTGGTGGCTCGGGGCTGTGGG - Intronic
1135280933 16:21153014-21153036 GGCTCCTGCACCGGGGCTGCAGG - Intronic
1137714817 16:50592229-50592251 TGCCGCCGCCTGGGGGCTGCTGG + Intronic
1138130227 16:54472973-54472995 CTCTGCTGCTTGGGGGCTGAAGG + Intergenic
1140295116 16:73702297-73702319 AGGGGCTGCCTGGGGGCTGCAGG + Intergenic
1142125739 16:88409455-88409477 GGCTGCTGCCCCGAGGATGCAGG - Intergenic
1142237539 16:88929335-88929357 GGCTGCTCCCACGGGCCTGCGGG + Intronic
1142605286 17:1078038-1078060 CGCAGCTGGCTGGGGGCTGGGGG - Intronic
1143009453 17:3857864-3857886 CCTCTCTGCCTCGGGGCTGCCGG - Intergenic
1144794561 17:17882337-17882359 CGCTGCTCTCTCGGAGCAGCAGG - Intronic
1144945869 17:18969223-18969245 GGCTGCTCCCTCGGGCCTGTAGG - Exonic
1145043056 17:19591116-19591138 CGCTGCTCCCTAGTGGCTGTAGG - Intergenic
1145077465 17:19867676-19867698 CGAAGCGGCCTCGGCGCTGCCGG + Exonic
1146000547 17:29127961-29127983 CGCTGCTTCTTTGGGGCTTCAGG + Intronic
1146358939 17:32158987-32159009 CTCAGCTGCCTCAGGGATGCAGG - Intronic
1148217308 17:45840177-45840199 ACCTGCTGCCTGGGGCCTGCTGG + Intergenic
1148451135 17:47778452-47778474 CTCGGCTTCCTGGGGGCTGCCGG + Intergenic
1148844987 17:50524589-50524611 TGCTGCTGCCTGGGGCCTGGTGG - Intronic
1148978287 17:51548541-51548563 CTCTCCTGCCCTGGGGCTGCAGG - Intergenic
1150228213 17:63535156-63535178 GGCTGCTGCCTGTGGGCTTCAGG - Intronic
1150228938 17:63539336-63539358 CTCTGCTTCCTCTGGACTGCTGG + Intronic
1151653832 17:75486216-75486238 AGCTGTGGCCTGGGGGCTGCTGG + Intronic
1152336504 17:79702265-79702287 TGCCCCTGCCTCGGGCCTGCAGG - Intergenic
1152525621 17:80886810-80886832 CGCAGCTGTCTCGGGGATGCTGG + Intronic
1152720741 17:81922707-81922729 GGCTGGCGCCACGGGGCTGCGGG + Exonic
1152805927 17:82356360-82356382 CCCAGCTACCTCGGGGGTGCAGG - Intergenic
1152852697 17:82647485-82647507 CGCAGGTGCTTCGGAGCTGCGGG - Intronic
1153225732 18:2898310-2898332 TGCTGCTGCCACTGGGCTGCAGG - Intronic
1153923630 18:9813231-9813253 AGCAGCTGCCTCGGGTCTGGAGG - Intronic
1155633332 18:27921661-27921683 TCCTGCTGCCTCTAGGCTGCTGG - Intergenic
1156489152 18:37486042-37486064 CGCTGCTCCCTCAGGGATGGTGG + Intronic
1160521079 18:79508355-79508377 CGCCGCTGCCCTGTGGCTGCTGG - Intronic
1160523896 18:79524443-79524465 AGCTGCTGCCATGGGGCAGCGGG + Intronic
1160579591 18:79875999-79876021 AGCTCCTGCCACTGGGCTGCTGG - Intronic
1160693420 19:470792-470814 CGCTGCTACCACGGGCCAGCAGG - Intronic
1160861164 19:1237728-1237750 CGCGGCGGGCTCGGGGCTGCGGG - Intronic
1160927887 19:1555803-1555825 GGCGGCGGCCGCGGGGCTGCTGG + Exonic
1160939553 19:1613973-1613995 TGCTGCTGCCGCAGGGGTGCGGG + Intronic
1161315078 19:3613991-3614013 CGCTGCTGCCTCCCGGCCTCTGG - Intronic
1161468324 19:4444280-4444302 CACTGCTGACTTGGGGATGCAGG - Intronic
1161724323 19:5919478-5919500 TACTGCTGCCACGGGGCTACAGG + Intronic
1162744205 19:12789897-12789919 CGCTTCTGGCTCGGGGCCCCAGG + Intronic
1163103060 19:15109140-15109162 CCTTGATGCCTCGGGGCTGGAGG - Exonic
1163513075 19:17747710-17747732 CGCGGCTGCGGCGCGGCTGCCGG - Exonic
1163517945 19:17776088-17776110 CGCTGCTGCCTCGGGGCTGCAGG - Exonic
1163721276 19:18899333-18899355 CTGTGCTGCCTCTGGCCTGCAGG + Intergenic
1165595291 19:37007709-37007731 CGCGGCGGCCTCGGGGTTGGGGG - Intergenic
1165829557 19:38723760-38723782 CCCTGCTGCCCCGGGGCTGGTGG + Intronic
1166546942 19:43639642-43639664 CTCTGCGGCCCCGAGGCTGCCGG + Intronic
1166824279 19:45599448-45599470 GGCTGGTCCCTTGGGGCTGCAGG - Intronic
1166883068 19:45940582-45940604 CGCCGCCGCCTCCGGCCTGCTGG - Exonic
1167074990 19:47243228-47243250 CGCCGCAGCCGCGGGGCTCCGGG + Intergenic
1167171636 19:47836239-47836261 CGCTGCTTCCTGGGGGCGCCTGG - Exonic
1167880554 19:52453954-52453976 CGCTGATGCATCGAGACTGCGGG - Intronic
1168471725 19:56645726-56645748 CTCTGCTGCCTCGGGAGAGCCGG + Exonic
1168598350 19:57696900-57696922 GGGAGCTGCCTTGGGGCTGCTGG - Intronic
1202695785 1_KI270712v1_random:124660-124682 GGCTGCTGCCTCGGTTGTGCCGG - Intergenic
925036391 2:690086-690108 CTCCTCTGCCCCGGGGCTGCCGG + Intergenic
927201527 2:20581138-20581160 AGCTGCTGCCTCTGGCCTGATGG + Intronic
927990335 2:27442742-27442764 CTCTGTCGGCTCGGGGCTGCTGG + Exonic
930411213 2:51028202-51028224 CGCTGCTGCTCCTGGGCTGCTGG - Exonic
932097317 2:68863014-68863036 CGCTGCTGGCTCCGGGCTTCTGG - Intergenic
932714361 2:74090656-74090678 CCCTGCTGTCTTGGGGCTGGGGG - Intronic
933703457 2:85272860-85272882 CGCTCCTGCCCTGTGGCTGCAGG - Intronic
934276947 2:91581698-91581720 GGCTGCTGCCTCGGTTGTGCCGG - Intergenic
934763816 2:96869638-96869660 CCCTCCGGCCCCGGGGCTGCGGG + Intronic
935605585 2:104969608-104969630 CTCTCCTGCCTCGGACCTGCTGG + Intergenic
936141477 2:109945796-109945818 CGCTGTTGCCTCGAGGATGAAGG - Intergenic
936178166 2:110243744-110243766 CGCTGTTGCCTCGAGGATGAAGG - Intergenic
937986970 2:127642306-127642328 CGCTGCCGCCTCGGCTCTGCAGG - Intronic
938376257 2:130808642-130808664 CCCTGCTGCCTCCTGGCTGCTGG + Intergenic
938397854 2:130963965-130963987 TGCGGCGGCCGCGGGGCTGCCGG - Intronic
939004105 2:136765877-136765899 CGCCTCTGGCTTGGGGCTGCGGG + Intronic
943639541 2:190343642-190343664 CGCTGCCGCCTCGGGGCTCCCGG - Exonic
944474319 2:200088246-200088268 CTCAGCTGCCTTGGTGCTGCTGG + Intergenic
947387523 2:229606437-229606459 TGCTGTTACCTCGGGACTGCTGG - Intronic
948611926 2:239175413-239175435 CCCTGCTGACTGTGGGCTGCTGG - Intronic
948718183 2:239879744-239879766 CGCAGCTTCCTCCAGGCTGCAGG + Intergenic
948788405 2:240364924-240364946 CGCTGCTGCCTTGGGGCGGAGGG + Intergenic
948867314 2:240782556-240782578 CGCACCTGCCCCGGGGCTGAAGG + Intronic
1170150388 20:13221392-13221414 CCCTGCTGGCAGGGGGCTGCGGG - Intergenic
1170889177 20:20364609-20364631 CGCTGGTCCCTCCGGGCGGCGGG + Intergenic
1171423068 20:25032020-25032042 CAGTGCTGTCTCGGGGCTGCAGG - Intronic
1172194461 20:33082868-33082890 AGGTGCTGCCTGGGGGCTGGAGG + Intronic
1172844254 20:37920368-37920390 AGATGATGCCACGGGGCTGCTGG + Intronic
1173985620 20:47259417-47259439 CCCTGCTGCCTCTGGGATCCTGG + Intronic
1174358722 20:50015110-50015132 CGCGGCTGCTGCGGGGCCGCTGG - Intergenic
1174540835 20:51288163-51288185 AGATCCTGGCTCGGGGCTGCTGG + Intergenic
1174609852 20:51790235-51790257 CTCTGCTGCCCTGGCGCTGCAGG + Exonic
1174868650 20:54163178-54163200 TGCTGATGCCACTGGGCTGCAGG + Intronic
1175254223 20:57629205-57629227 GGATCCTGCCCCGGGGCTGCAGG - Intergenic
1175742644 20:61430897-61430919 CCCTGAAGCCTGGGGGCTGCAGG - Intronic
1176125884 20:63474437-63474459 GGCTGCTCCCTCGGGTCTTCTGG - Intergenic
1176151014 20:63590714-63590736 CACTGCTGCTCCAGGGCTGCAGG + Exonic
1179930499 21:44568236-44568258 CACGGCTGCCTCTGAGCTGCAGG + Intronic
1180155149 21:45974010-45974032 CGCCGCTGTCTGGGGGCCGCAGG + Intergenic
1180180938 21:46118456-46118478 AGATGCTGGCTGGGGGCTGCTGG - Intronic
1180899378 22:19359558-19359580 TGCTGCTGCCTTGGGGCCCCAGG - Intronic
1180938636 22:19642247-19642269 CGCTGCTGCGTGGGCACTGCAGG - Intergenic
1181021653 22:20106712-20106734 CTCTGCTGCCTGGTGGCCGCTGG + Intronic
1181478234 22:23181352-23181374 CGCGGCTGCCCCGGGCCTGCGGG - Exonic
1181497343 22:23295002-23295024 CCCTTCTCCCTTGGGGCTGCAGG + Exonic
1183405307 22:37627619-37627641 AGCTGCTGGCTGGGGGCTGGTGG - Intronic
1183654374 22:39176380-39176402 TCCAGCTGCCTCGGCGCTGCCGG + Intergenic
1183862814 22:40681848-40681870 CGAAGCTGCCCCTGGGCTGCAGG - Exonic
1184089588 22:42285164-42285186 CCCTGGTGCCACGGGGCAGCTGG + Intronic
1184680649 22:46070903-46070925 CGCGGCGCGCTCGGGGCTGCGGG + Intronic
1184867126 22:47207884-47207906 CTCTGCTCCCTGTGGGCTGCTGG - Intergenic
1185349438 22:50326930-50326952 CGCGGCTGCCTGGGCGCGGCTGG - Exonic
1185397611 22:50600862-50600884 CGCTGTCGCCGCCGGGCTGCAGG + Exonic
950198933 3:11029111-11029133 CTCTCCTGGCTCGGTGCTGCTGG + Intronic
953466896 3:43129902-43129924 TGCTGCTGCCACTGGGATGCCGG + Intergenic
953856388 3:46502675-46502697 AGCTGCTGCCTAGTGTCTGCAGG + Intergenic
953878690 3:46680603-46680625 CTCTGCTGGCACGGGGCGGCAGG + Intronic
954838943 3:53494694-53494716 CGCCGCTGGCTCGGGACCGCGGG - Intronic
961816926 3:129555920-129555942 GGCTGCAGCCTCCGGGCTGGCGG + Exonic
966696330 3:182793705-182793727 CGCGGGGGCCGCGGGGCTGCAGG - Exonic
966982603 3:185152527-185152549 CTCTGCGGCCGCGGGGCTCCGGG - Intronic
967263579 3:187670153-187670175 GGCTGCTGCCGCGGGGAAGCAGG - Exonic
967840830 3:194003426-194003448 CGCGGCTGTCTGGAGGCTGCCGG + Intergenic
968457224 4:705950-705972 ACCTGCGGTCTCGGGGCTGCGGG - Exonic
968509962 4:991226-991248 TGCTGTTGGCTCCGGGCTGCAGG + Exonic
968579232 4:1382134-1382156 AGCTGCTGCCTCTGGGCATCAGG - Intronic
969053427 4:4387603-4387625 GGCTGCAGCCTCGGAGCTCCCGG + Exonic
969688444 4:8689948-8689970 CTCTCCTGCCCCGGGCCTGCTGG + Intergenic
971479537 4:27102037-27102059 GCCTGCTGGCTCAGGGCTGCAGG - Intergenic
971905117 4:32716168-32716190 GGCTCCTGCACCGGGGCTGCAGG + Intergenic
981067220 4:140498070-140498092 CGCGGGGGCTTCGGGGCTGCAGG - Intronic
981782376 4:148443714-148443736 AGCTGCCGCCGCCGGGCTGCGGG - Intronic
982460970 4:155667857-155667879 CCCTGCTGCCTCCGGGGTCCAGG - Intronic
982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG + Intergenic
983937080 4:173509547-173509569 CGCTTCGGCCTGGCGGCTGCCGG + Intergenic
985410576 4:189679495-189679517 GGCTGCCCCCTCTGGGCTGCTGG - Intergenic
985680603 5:1253816-1253838 CTCAGCTGCGTCTGGGCTGCGGG + Exonic
985682973 5:1266094-1266116 GGCTGCCGCCTCGGCCCTGCAGG + Intronic
989011376 5:36876592-36876614 AGCTGCCGCCTCCCGGCTGCTGG + Intergenic
990692807 5:58382618-58382640 GGCTATTCCCTCGGGGCTGCTGG - Intergenic
992105872 5:73448496-73448518 CGGAGCTGCGCCGGGGCTGCCGG + Intergenic
993503911 5:88689676-88689698 CTCATCTGCCGCGGGGCTGCCGG + Intergenic
999252305 5:150190173-150190195 CGCTGCCGTCTGGCGGCTGCGGG - Exonic
999731719 5:154480172-154480194 CGCTGCTGCGGCGGCTCTGCGGG + Intergenic
1002372879 5:178768884-178768906 CATGGCTGCCTGGGGGCTGCAGG + Intergenic
1002711026 5:181195128-181195150 AGCTCCTGTCTCTGGGCTGCCGG - Exonic
1002720873 5:181260926-181260948 CTCTTCTTCCTCGGGGCCGCAGG + Exonic
1006173893 6:32110285-32110307 GGCTGGTGCCTGGGTGCTGCGGG + Intronic
1007321304 6:41030613-41030635 GGCTGCTGCCTGGGGGATGTTGG - Intronic
1007387964 6:41532085-41532107 GACTGCTGCCGTGGGGCTGCCGG + Intergenic
1007605355 6:43114028-43114050 CCCTGCGGCCCCAGGGCTGCTGG + Intronic
1008070804 6:47097052-47097074 CGCCACTGACTTGGGGCTGCAGG + Intergenic
1008342861 6:50388766-50388788 TGATGCTGCCTCTGGGCTGAAGG + Intergenic
1009524544 6:64728027-64728049 GGCTGCTTCTTCGGGGCGGCAGG + Intronic
1018311164 6:162510482-162510504 CCCTGCTTCCTCGGTGCAGCTGG - Intronic
1019088295 6:169502082-169502104 GGCAGCCGCCCCGGGGCTGCGGG + Intronic
1019183716 6:170208804-170208826 CGATGCTGCATCAGGGTTGCAGG + Intergenic
1019339523 7:502357-502379 CCCTGCTGCCTGGGGCCGGCGGG - Intronic
1019437047 7:1027869-1027891 GGCTGCTGCATCGCGGCTGGGGG + Intronic
1020270173 7:6590095-6590117 CGCTGCTGCCGCCGGCCAGCAGG - Exonic
1020389238 7:7640912-7640934 AGCTGCTGCCGCGGTGCTGTGGG + Exonic
1021998521 7:26202230-26202252 CGCCGCAGCCTCGGGACAGCCGG - Intronic
1023358485 7:39391956-39391978 TGTTGCTGCCTGTGGGCTGCTGG + Intronic
1024096742 7:45988078-45988100 GGCTGCTGCCTCCAGGCTGAGGG - Intergenic
1025739670 7:64184394-64184416 CCCTGCTGCACCCGGGCTGCAGG + Intronic
1026001000 7:66558708-66558730 CCCTGCTGCATCTGGCCTGCAGG + Intergenic
1029256558 7:99273455-99273477 TGCTGCTGCCTATGGGCTGGGGG + Intergenic
1029280641 7:99433320-99433342 CGGTGCTGATTGGGGGCTGCGGG - Exonic
1030093379 7:105876842-105876864 CGCCGCTGCATCCCGGCTGCCGG - Intronic
1031317514 7:120274714-120274736 CTCTCCTGCCTCGGGGGAGCCGG - Exonic
1031970347 7:128060583-128060605 AGCTGCTGCCTAGAGGCAGCAGG - Intronic
1032020706 7:128405964-128405986 CGCTGCTGCCGCGGGCCGGGCGG + Intronic
1033147504 7:138883944-138883966 TGCAGCTACCTTGGGGCTGCTGG - Intronic
1034860160 7:154587956-154587978 CAGTGCTGCCTGAGGGCTGCAGG - Intronic
1035166424 7:156993120-156993142 CGCAGCTCCCTAGGGGCAGCTGG + Intergenic
1036673186 8:10806746-10806768 CGCTGCATCCTAGGGCCTGCCGG - Intronic
1036910541 8:12754583-12754605 CTCTGCTTCCCCGGGGCCGCTGG - Intronic
1037725142 8:21477151-21477173 CGCTGCAGCCGCTGGGCTGACGG + Intergenic
1039527859 8:38232033-38232055 TGCTGCTGTCGCGGGGCTGCGGG + Intronic
1040598251 8:48860776-48860798 CGGTGCTGCTTCTGGTCTGCAGG + Intergenic
1044434735 8:92148740-92148762 CACTACTGCCCCTGGGCTGCAGG + Intergenic
1045473057 8:102529405-102529427 CACTGCTGCCTCTGGACTGTGGG - Exonic
1046731126 8:117727520-117727542 TGCTGCAGCCTCAGGGCTCCTGG + Intergenic
1047929501 8:129712820-129712842 CTCTCCTGCCTTGGGGCAGCAGG + Intergenic
1048297194 8:133223142-133223164 CCTTGCTGCCCTGGGGCTGCTGG - Intronic
1048975752 8:139672235-139672257 TGCTCCTGCCTCTGGGCAGCTGG - Intronic
1049402508 8:142435873-142435895 CCCTGCTGCCTGGGGGCTGGTGG - Intergenic
1049479634 8:142815714-142815736 CCCTGCTGCCTCTGGCCTCCTGG + Intergenic
1053055243 9:34989930-34989952 CTCTGCTGCCTTGGGGATGCGGG + Intronic
1056249441 9:84732986-84733008 CTGTGCTGCCTCTGGACTGCAGG + Intronic
1056810984 9:89763757-89763779 CGCTGCTGCCTTGGCCCTGTGGG - Intergenic
1060474592 9:123977191-123977213 CTCTGCTGCACCGCGGCTGCCGG - Intergenic
1060476770 9:123992932-123992954 CTCTGCTGCACCGCGGCTGCCGG + Intergenic
1061015975 9:127980933-127980955 GGCTGCAGCGTCGGGGCCGCAGG - Intergenic
1061226378 9:129283290-129283312 CCCTGCTGCCAAGGGGCGGCTGG + Intergenic
1061781107 9:132996546-132996568 AGCAGCTCCCTCGGGGCTTCGGG - Intergenic
1061929239 9:133824018-133824040 CCCTGCTGCCACGTGGCTGGGGG - Intronic
1062216320 9:135391583-135391605 CACTCCTGCCTCGGGGCGCCGGG + Intergenic
1062435968 9:136546682-136546704 GGCTGCTCCCTCGGGGCGCCCGG - Intergenic
1062562617 9:137148420-137148442 CGCGCCTGCCTCGAGGGTGCAGG - Intronic
1203672186 Un_KI270755v1:25931-25953 GGCTGCCCCCTCTGGGCTGCCGG + Intergenic
1187398709 X:18940551-18940573 CGCTGCTGGTTTTGGGCTGCAGG + Intronic
1187679980 X:21758113-21758135 TGCTCCTGGCTCGGGGCTGGAGG + Exonic
1189137173 X:38561762-38561784 GGGTGCTGGGTCGGGGCTGCAGG + Intronic
1189659335 X:43279757-43279779 CGCTGCAGCCTCGGGCCGGGCGG + Intergenic
1190191348 X:48279812-48279834 CGCTGCAGCCTTGGGACTACAGG + Intergenic
1198574714 X:137997580-137997602 TGCTGCTGCTTTGTGGCTGCAGG - Intergenic
1200062109 X:153488306-153488328 CCCCTCTGCCTCCGGGCTGCTGG + Intronic
1201489580 Y:14525328-14525350 GGCTGCTATCTCGGGGATGCAGG + Intronic