ID: 1163520280

View in Genome Browser
Species Human (GRCh38)
Location 19:17787932-17787954
Sequence TGGGGATCCTTGGGAAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 210}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163520270_1163520280 4 Left 1163520270 19:17787905-17787927 CCCGGGGTGTGGGGAGGGATTGG 0: 1
1: 0
2: 7
3: 77
4: 565
Right 1163520280 19:17787932-17787954 TGGGGATCCTTGGGAAAGATAGG 0: 1
1: 1
2: 0
3: 21
4: 210
1163520269_1163520280 5 Left 1163520269 19:17787904-17787926 CCCCGGGGTGTGGGGAGGGATTG 0: 1
1: 0
2: 0
3: 36
4: 277
Right 1163520280 19:17787932-17787954 TGGGGATCCTTGGGAAAGATAGG 0: 1
1: 1
2: 0
3: 21
4: 210
1163520260_1163520280 26 Left 1163520260 19:17787883-17787905 CCGAGATCTTACAGGGGCAAGCC 0: 1
1: 0
2: 0
3: 14
4: 89
Right 1163520280 19:17787932-17787954 TGGGGATCCTTGGGAAAGATAGG 0: 1
1: 1
2: 0
3: 21
4: 210
1163520272_1163520280 3 Left 1163520272 19:17787906-17787928 CCGGGGTGTGGGGAGGGATTGGG 0: 1
1: 1
2: 3
3: 71
4: 583
Right 1163520280 19:17787932-17787954 TGGGGATCCTTGGGAAAGATAGG 0: 1
1: 1
2: 0
3: 21
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163520280 Original CRISPR TGGGGATCCTTGGGAAAGAT AGG Intronic
900543990 1:3218387-3218409 TGGGGATACCTGGGGAAGCTGGG - Intronic
901922158 1:12545081-12545103 TGGGGAACTGTGGGAAAGACAGG + Intergenic
902727424 1:18346551-18346573 TGGGGACCAATTGGAAAGATGGG + Intronic
902775013 1:18669078-18669100 TGGGGGCCCTTGGGAGGGATCGG + Intronic
904558885 1:31383696-31383718 TGGGGGTCCTGGGAAAAGAAAGG + Intergenic
904976725 1:34462181-34462203 CTGGGATCTTTGGGAGAGATGGG + Intergenic
906248980 1:44296726-44296748 AGGTGCTCCTTGGCAAAGATGGG + Intronic
906680174 1:47720951-47720973 TGGAGAACCTTGGGAAGGAGAGG + Intergenic
910023770 1:82624062-82624084 AGGGGTACCTTAGGAAAGATTGG + Intergenic
910146242 1:84084062-84084084 TGGGGAACCAAGGGAAAGAATGG + Intronic
911223696 1:95279563-95279585 TGGGGATCATTGGGCAATAGGGG + Intergenic
914825080 1:151133933-151133955 GGGGGCTACTTGGGAGAGATAGG - Intronic
915018004 1:152754538-152754560 TGGGGACTCAGGGGAAAGATGGG - Intronic
915894673 1:159802591-159802613 TGGGCATGCTTGGGAGAGATGGG + Intronic
919967364 1:202541476-202541498 TGTGGCTCCTTGGGAAAAAAAGG - Intronic
920060689 1:203225096-203225118 TTGGGATTCCTGGGAAAGACAGG + Exonic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
922759621 1:228119241-228119263 TGGAGCTCCTTGGGAAAAACAGG - Intergenic
923821218 1:237444610-237444632 TGGTGAACCTTGTGAAGGATAGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1065260164 10:23915579-23915601 TGTGCATGCTAGGGAAAGATGGG + Intronic
1065560992 10:26963599-26963621 TGTGGATCCTGGGGAATGAATGG - Intergenic
1066419146 10:35248071-35248093 TGGGGTTCCTTGGAAAAGCAAGG + Intronic
1067059353 10:43069992-43070014 TGGGGGTGCCTGGGGAAGATGGG - Intergenic
1067767371 10:49097176-49097198 AGGGGCTCCTGGTGAAAGATGGG - Intronic
1070982711 10:80662574-80662596 TGAAGATCCTTAGGTAAGATAGG - Intergenic
1071233023 10:83611279-83611301 TGGGGATCTTTAGAAAACATTGG - Intergenic
1072736628 10:97883514-97883536 TGGGGATTGTTGGGGAAGAGGGG + Intronic
1073002314 10:100294861-100294883 TATGTATCCTTGGGGAAGATGGG - Intronic
1073067382 10:100770923-100770945 AGGGGATCCTTGGAAGAGCTGGG - Intronic
1076217885 10:128710701-128710723 TGGGGATCCTGGGCCAAGTTAGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081278136 11:41176388-41176410 TGGGAATTATTGTGAAAGATAGG - Intronic
1082728894 11:56771061-56771083 TGGGGACTCTGGGGAAAGAGTGG - Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083591765 11:63899654-63899676 TGGGCAGCCATGGGAGAGATGGG - Intronic
1083738564 11:64695390-64695412 TGGGGTTCCTGGAGAAAGCTAGG + Intronic
1084041990 11:66547678-66547700 TGGGGTATCTTGGGAAAGAATGG - Intronic
1088504832 11:110517503-110517525 TGGGAATCTTTGGGAAAGACTGG - Intergenic
1088526407 11:110760947-110760969 TTGGGAAGCTTGGGCAAGATGGG - Intergenic
1089638609 11:119832459-119832481 TGGGGATCCCTGGAAAGGCTGGG + Intergenic
1092904745 12:13091104-13091126 TGGCTAGCCTTGGGAAAGAGTGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1097223918 12:57465773-57465795 AGGGGATCCTAGGGCAAGAGAGG - Exonic
1098878540 12:75892262-75892284 GGGGGATCCTTGAGAAAAACTGG + Intergenic
1099400260 12:82194837-82194859 TGGGTCTCCTTGGGAAAGGATGG - Intergenic
1099575848 12:84380803-84380825 TGGGGACTCTTGGGAAAGGGTGG - Intergenic
1100312844 12:93413618-93413640 GGTGGATCATTTGGAAAGATGGG - Intronic
1100535286 12:95503250-95503272 GGTGGATCCTTGGCAGAGATTGG - Intronic
1101053936 12:100893112-100893134 TGGGGATGCTTGGTAGAGTTAGG + Intronic
1101318257 12:103649701-103649723 TGGGATGCCTTGGGAAAAATGGG - Intronic
1101413020 12:104484875-104484897 TGGGGATTGTTGGAAAAGAGTGG + Intronic
1105824359 13:24108774-24108796 TTGGGATTTTTCGGAAAGATTGG + Intronic
1106066256 13:26354467-26354489 TGGGGACCCCTGTGCAAGATGGG - Intronic
1107765483 13:43730001-43730023 TGGGGATCCTCTGGAGAGAGGGG - Intronic
1109456841 13:62604011-62604033 TTGGCATCCTTGGAAAAGTTGGG + Intergenic
1111981554 13:95021417-95021439 TGGAGATCCTTGGATAAGTTGGG + Exonic
1113797456 13:113066728-113066750 TGGGGAGTCTTGGGGAGGATGGG - Intronic
1114650202 14:24279913-24279935 TGTGGGTCCTGGGGAAGGATGGG + Intergenic
1119175341 14:72564507-72564529 CGGGGATCCTTGGGCAAGGCTGG - Intronic
1120092970 14:80355271-80355293 TGGAAAGCCTTGTGAAAGATTGG + Intronic
1120737246 14:88066643-88066665 TGGGGTTCCTTGGGGAGGGTGGG - Intergenic
1121219533 14:92275264-92275286 TGGGGTTCCTGGGGAAAGTGTGG - Intergenic
1122274518 14:100584907-100584929 TAAGGATCCCTGGGACAGATGGG - Intronic
1124619250 15:31264729-31264751 TGGGGACCCTAGGGAAGGAGTGG + Intergenic
1125414860 15:39441976-39441998 TGGGGATCCCTGGGGGAGAAGGG + Intergenic
1127494285 15:59495187-59495209 TGGGGAGGCTGGGGAAAAATGGG - Intronic
1128731380 15:70023768-70023790 TGGGGATCTATGGGACAGCTGGG + Intergenic
1129853175 15:78806698-78806720 CTGTGATCCTTGGGAAAGTTAGG - Intronic
1130294714 15:82637496-82637518 TGGGGATGCTAGGGAAAGACAGG - Intronic
1131629533 15:94161615-94161637 TGGGGACCCCTGGGCAACATGGG - Intergenic
1132223479 15:100123075-100123097 GTGGGGTCCTTGGGAAAGTTGGG - Intronic
1132590545 16:724547-724569 GGGGGATGGTTGGAAAAGATGGG - Intronic
1132649734 16:1015029-1015051 TAGGGATCCATGGGAAACAGTGG - Intergenic
1133048803 16:3105010-3105032 TAGGGATTCGTGGGAAAGAATGG + Intergenic
1133499563 16:6353169-6353191 AGATGATCTTTGGGAAAGATGGG - Intronic
1134607517 16:15582759-15582781 TGGTGATCCTTGGAAGAGCTGGG + Intronic
1137687222 16:50394522-50394544 TGGGCACCCCTGGGAAAGAAGGG - Intergenic
1138095278 16:54206578-54206600 TAGGCATCTTTTGGAAAGATAGG - Intergenic
1140318554 16:73924025-73924047 TGGTGATCCTGGGGAGAGACTGG - Intergenic
1140382728 16:74505111-74505133 TGGGCATGCTTGTGATAGATAGG - Intronic
1140841762 16:78846098-78846120 TGTGGGACCTTGGGAAAGGTTGG + Intronic
1142693692 17:1621757-1621779 TGGGGGTCCCTGGGGAAGCTGGG + Intronic
1143407297 17:6685950-6685972 TGGCAAGGCTTGGGAAAGATGGG + Exonic
1143988836 17:10939240-10939262 GGGGGCTCCTTGGAAAAAATTGG + Intergenic
1144481326 17:15631800-15631822 TGGGCTTCCTGGGGAAAGAAGGG + Intronic
1144916979 17:18731931-18731953 TGGGCTTCCTGGGGAAAGAAGGG - Intronic
1147739237 17:42660943-42660965 TGAGGCTCCTTGGGAAGGTTTGG - Intronic
1148120017 17:45203113-45203135 TGGGGACTCTAGGGGAAGATTGG - Intergenic
1150930874 17:69583790-69583812 AGGAGATTCTTGGGAAAGAAGGG + Intergenic
1151767769 17:76140937-76140959 AGGGGATCATTGGGAAGGAAGGG + Intronic
1152045728 17:77934153-77934175 TGGGAAGCTTTGGGAAAGACTGG - Intergenic
1153024756 18:662132-662154 TGTGGATCCCTGGAAGAGATGGG - Exonic
1157396510 18:47346051-47346073 TGCTGCTCCTTGGGAAAGAGGGG + Intergenic
1157673107 18:49547222-49547244 TGGGGACACTTTGGAAAGGTTGG + Intergenic
1158626056 18:59072473-59072495 TGGGGACTTCTGGGAAAGATGGG + Intergenic
1158811776 18:61046543-61046565 TGGGGATTGTGGGGAAGGATGGG + Intergenic
1159393761 18:67830258-67830280 TGGGGAATCCTGGCAAAGATTGG + Intergenic
1161579233 19:5071596-5071618 TGGGGACTCTTGGGAAAGAAGGG + Intronic
1162937825 19:13990324-13990346 AGGGGATCTTTGGGAAAAAGGGG + Intronic
1163520280 19:17787932-17787954 TGGGGATCCTTGGGAAAGATAGG + Intronic
1164613490 19:29649624-29649646 TGGGGACTCATGGGAAAGAGTGG + Intergenic
1164731800 19:30511107-30511129 AGGGGAGCCGTGGGTAAGATGGG + Intronic
1165988263 19:39789704-39789726 TGGGGATTCAGGGGAAAGAATGG + Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1167671351 19:50855468-50855490 TGGGTATCCTAGGGCAAGATTGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168127302 19:54292363-54292385 TGGGGGTCCATGGGAAAGGCTGG + Intergenic
926825783 2:16903772-16903794 AGGGTCTCCTTGGGAAAGATGGG + Intergenic
928228502 2:29475974-29475996 TGGGGCTGCTTCGGACAGATGGG + Intronic
929086391 2:38171600-38171622 TGTAGATCCTAGTGAAAGATGGG - Intergenic
931651447 2:64472450-64472472 TGATAATCCTTGGGAAACATAGG - Intergenic
933142525 2:78811848-78811870 TAGGGATACTTGGAAAACATGGG + Intergenic
937962396 2:127470170-127470192 TGGGGATCCTGGGAAAAAGTTGG - Intronic
938899704 2:135789661-135789683 TGGGGATCCTTGGCAGAGAAGGG + Exonic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
943720063 2:191194647-191194669 TGGGGTTCCTTGGGAAGAAAAGG - Intergenic
944248797 2:197560509-197560531 TAGGAATCCCTGGGAAAGAATGG - Intergenic
944833636 2:203557257-203557279 TGGGAATCCTGGGGAAAAAAAGG + Intergenic
945055690 2:205866963-205866985 TGGGGAACCTAGGAAAACATAGG - Intergenic
947634033 2:231671180-231671202 TGGGGATCATTGTGACAGAGAGG + Intergenic
1169191551 20:3661547-3661569 TGGCGATGCTTGGGAAGGAGGGG - Intronic
1170128862 20:12997212-12997234 TGGGTATCCTTAGGAAAGCTGGG + Intergenic
1170409178 20:16069902-16069924 TGGGGACCCTTGGGGAAACTGGG + Intergenic
1171124732 20:22591582-22591604 AGGGGATGCTTGGGAGAGGTCGG - Intergenic
1171403021 20:24891817-24891839 TCGGGATCCTGGGGAAAGGCAGG - Intergenic
1174287008 20:49481005-49481027 TGGGGTTGCCTGGGAAAGATGGG - Intronic
1174586050 20:51609168-51609190 TGAGGACCCACGGGAAAGATGGG + Intronic
1177180740 21:17742188-17742210 TGGCTAGCCTTGGGAAAGAATGG + Intergenic
1178361409 21:31951534-31951556 TGGGGGTCCCTGGGATGGATGGG + Intronic
1179528433 21:42000176-42000198 AGGGCATCCTTAGGAGAGATGGG + Intronic
1181438476 22:22923653-22923675 TCGGGACACTTGGAAAAGATAGG + Intergenic
1181957974 22:26602014-26602036 TGGGCATCCTGGGGAAAGAGAGG + Exonic
1182062952 22:27410873-27410895 TGGGGCTTCTGGGGATAGATGGG + Intergenic
1185279512 22:49964098-49964120 TGGGCATCCTGGGGGAAGAGAGG + Intergenic
949761749 3:7478661-7478683 TGGGCATCCCAGGGAAAGGTTGG + Intronic
950145080 3:10643262-10643284 TGTGGATCCATGGGAGAGAACGG + Intronic
957726247 3:84071137-84071159 GGGGATTCCTTGGGAAAAATAGG - Intergenic
958077958 3:88708853-88708875 TAAGGTTCCTTAGGAAAGATAGG - Intergenic
959131139 3:102357487-102357509 TGGGGATCAGTGGGAAACAGTGG + Intronic
959908379 3:111735135-111735157 TTGAGTTCCTTGAGAAAGATTGG - Intronic
961481780 3:127185036-127185058 TGGGGAACCGTGGGAAAGGGCGG - Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
961822793 3:129583785-129583807 CGGGGCTGCCTGGGAAAGATTGG + Intronic
962494136 3:135922578-135922600 TGGGGATCCTTGACAGAGATTGG - Intergenic
962908313 3:139825225-139825247 TGGGAAGCCTTGGGAAGAATTGG + Intergenic
963563977 3:146904201-146904223 TAGGGACACTTGTGAAAGATGGG - Intergenic
964753069 3:160069871-160069893 TAAGAATCCTTGGGAAAAATAGG - Intergenic
966823679 3:183945296-183945318 AGGGGTTCCTGGGGAAAGGTGGG + Intronic
974510698 4:62836676-62836698 TGTGGATCCCTAGGAAAGAATGG - Intergenic
975179183 4:71323889-71323911 TTGGCATCCTTGGGAACGTTGGG + Intronic
975713498 4:77183641-77183663 TGGGGAGCCCTGGCAGAGATTGG - Intronic
976982525 4:91248453-91248475 TGTGAATCCTTGGATAAGATTGG + Intronic
979315961 4:119263554-119263576 TGGGGTTAGTTGGGAAAGATGGG + Intronic
981130140 4:141149390-141149412 TGGGGACTCTGGGGAAAGAGTGG - Intronic
981258060 4:142687032-142687054 TGGGGATTCTTGCGAAAACTGGG + Intronic
982605582 4:157512921-157512943 GGGGGATCCTTGCTAAAGACAGG - Intergenic
983394432 4:167175653-167175675 TGTGGAGGCTTGGGAAAGACAGG + Intronic
984001159 4:174246862-174246884 TGGGGAGCATTGGAAAAGAGAGG + Intronic
984965692 4:185137801-185137823 TGTGGATCCCTGGGAAGGAGGGG - Intergenic
985483435 5:134310-134332 TGGGGATTCATGGGAAAGGGTGG + Intergenic
985487724 5:161232-161254 TGAGGCTGCCTGGGAAAGATGGG - Intronic
987301947 5:16605293-16605315 TGGGGACCCAGGGGAAAGATGGG - Intronic
987924179 5:24318401-24318423 TGGGGAAGCTTGGGCAAGATGGG - Intergenic
989283370 5:39670416-39670438 TGGGGATTCTGGGGAAAGCGTGG - Intergenic
992545610 5:77811524-77811546 TGTGGATTCTTGGGCAAGAGGGG + Intronic
994352208 5:98759217-98759239 TGGGGATGCTTGAGAAAAAGAGG - Intergenic
994606873 5:101979059-101979081 TGGGGATCCTTGAGAAACAAAGG - Intergenic
995155379 5:108905582-108905604 TGGGGTTTTTTGGGAAAGGTGGG + Intronic
996077008 5:119207967-119207989 TGGGAATCCTTTGGTAAAATAGG + Intronic
996314912 5:122150772-122150794 TGGGGATCCTTGGGGAATCCAGG + Intronic
997785938 5:136713935-136713957 TGGAGATTCTTGGGAAGCATTGG - Intergenic
997797222 5:136822391-136822413 TGGGGATGCTGGGGAAAGGGTGG - Intergenic
999672387 5:153969137-153969159 TGGGGATCGGGGGGAAAGGTTGG - Intergenic
1001421426 5:171590076-171590098 TGGGGATCTTTGGGTAGGAATGG + Intergenic
1002441582 5:179267131-179267153 AGGGGATCCTGGGGGAAGAGTGG - Intronic
1003579077 6:7322992-7323014 TCAGAATCCTTGGGAAACATGGG + Intronic
1005022027 6:21427442-21427464 AGGGGATTCTGGGGAAAGACAGG - Intergenic
1005197351 6:23303148-23303170 TGGGTATCTTTGGGAAGGAGAGG + Intergenic
1005724156 6:28632472-28632494 TGTGGTTCCGTGGTAAAGATTGG - Intergenic
1007411991 6:41669779-41669801 TGGGGACTCTTGGGAAAGGGTGG - Intergenic
1007423146 6:41731698-41731720 TGGGGATCATTGGGTGAGAATGG - Intronic
1007485012 6:42174909-42174931 TGGGGCTTCTTGGGAAAGCTGGG + Intronic
1010104069 6:72147530-72147552 TGGGACTCCTTGGGAAACAGAGG - Intronic
1010562455 6:77367487-77367509 AGGGGATACTTGGTAAAGTTTGG - Intergenic
1010588490 6:77684480-77684502 TGGGGGACCTGGGGAAAGGTGGG - Intergenic
1010702197 6:79063954-79063976 AGAGGATTCTTGGGAAAGAGAGG - Intronic
1010976377 6:82319099-82319121 GGGGAATTCTGGGGAAAGATGGG + Intergenic
1011811363 6:91135709-91135731 TGGTGATCCATGGCAGAGATGGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015894794 6:138006994-138007016 TGGGGCTCCTTGGGAAAGATGGG - Intergenic
1016043535 6:139457791-139457813 TGGGGAACCTGGGGAAAGACTGG + Intergenic
1019920522 7:4160573-4160595 TGGGGAACCCTCGGCAAGATAGG + Intronic
1020856220 7:13427661-13427683 TTGGGATCCTTGGAGAAGACAGG + Intergenic
1023860245 7:44214009-44214031 TGAGGACCCTGGGGAGAGATGGG + Exonic
1024827170 7:53404194-53404216 TGGGCGTCCTTGGAAAAAATAGG + Intergenic
1026550558 7:71364877-71364899 TGGGAATGCAGGGGAAAGATAGG - Intronic
1027886223 7:83909305-83909327 TGGGGACACTGGGGAAAGTTTGG - Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030216535 7:107048738-107048760 AAGGGATCCTTTGGAAAGGTAGG - Intronic
1034185986 7:149177539-149177561 TGGGTATAATTTGGAAAGATGGG + Intronic
1034519951 7:151612197-151612219 TGGGCATCCTGGGGAGAGACAGG - Intronic
1035050465 7:155995832-155995854 GGGAGATGCTTGGGAAAGAAAGG + Intergenic
1035824101 8:2626572-2626594 TGGGGATCCCTGAGAAAAAGAGG + Intergenic
1045700457 8:104860794-104860816 TGTGGATCCATGGGAAAGTTGGG + Intronic
1046910558 8:119621738-119621760 TTGGGTTCCTTTGGAAAAATGGG + Intronic
1047202935 8:122781802-122781824 TCGGGCTCCGTGGGAAAGAGGGG - Exonic
1049614993 8:143572178-143572200 TGGGGAACCTAGGGCAGGATGGG + Exonic
1051529005 9:18078977-18078999 TGGGGAACCTTGAGATAGACAGG - Intergenic
1053160292 9:35809301-35809323 TGGGAATCATAGGGAAAGAGAGG + Intronic
1056007054 9:82284017-82284039 TGGGGATCTTTGGCACAGATGGG - Intergenic
1056726926 9:89127441-89127463 TGGGGCTCCTTGAGAAAAACAGG + Intronic
1057805932 9:98220047-98220069 GGGGAAGCCTAGGGAAAGATAGG + Intronic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058893732 9:109382590-109382612 TGGGGATCTTTGGGGAAGGAGGG - Intronic
1060184871 9:121558200-121558222 TGGGTTTCCTTGGGACAGTTGGG + Intergenic
1061006201 9:127929657-127929679 TGGAGATTCGTGGGACAGATGGG + Intronic
1061085256 9:128394315-128394337 TGAGGTTCATTGGGAAAGACAGG - Intergenic
1186346451 X:8698057-8698079 TTGGGATCCTTGGGAATCTTTGG - Intronic
1189177797 X:38975388-38975410 TGGGGATGCTTGGGACAGCTGGG + Intergenic
1190119997 X:47651424-47651446 TGGGGTACCTGGGGAATGATTGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1191887488 X:65903714-65903736 TGAGGAAACTTGGGAATGATGGG - Intergenic
1192238889 X:69314149-69314171 TTGGGAAACTTGGGAAAGCTTGG + Intergenic
1193206803 X:78759052-78759074 TGGGAAGCCTGGGAAAAGATAGG + Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1195223778 X:102771375-102771397 TGGGGTTCCTTGGGCAGGAATGG + Intergenic
1197267462 X:124390601-124390623 TGGGGGACCTGTGGAAAGATTGG + Intronic
1197521828 X:127508482-127508504 TGGGGATACTTTAGAAAGAAAGG - Intergenic
1201130899 Y:10951185-10951207 GGGAGATCCTTTGGAAAGAAAGG - Intergenic
1202302964 Y:23437238-23437260 TGTGGCTCCTTGGGAAAAAGAGG - Intergenic
1202567847 Y:26233356-26233378 TGTGGCTCCTTGGGAAAAAGAGG + Intergenic