ID: 1163524867

View in Genome Browser
Species Human (GRCh38)
Location 19:17814670-17814692
Sequence TCCAGGGCTTTGGGAGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163524860_1163524867 4 Left 1163524860 19:17814643-17814665 CCAAACACAGTGACTCATGCCTA No data
Right 1163524867 19:17814670-17814692 TCCAGGGCTTTGGGAGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163524867 Original CRISPR TCCAGGGCTTTGGGAGGCAG AGG Intergenic
No off target data available for this crispr