ID: 1163525925

View in Genome Browser
Species Human (GRCh38)
Location 19:17821412-17821434
Sequence TTCTCACGCATCTCTGGGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 100}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163525916_1163525925 23 Left 1163525916 19:17821366-17821388 CCCGCACACGCGCACTAGCGCGC 0: 1
1: 0
2: 0
3: 15
4: 78
Right 1163525925 19:17821412-17821434 TTCTCACGCATCTCTGGGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 100
1163525914_1163525925 25 Left 1163525914 19:17821364-17821386 CCCCCGCACACGCGCACTAGCGC 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1163525925 19:17821412-17821434 TTCTCACGCATCTCTGGGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 100
1163525917_1163525925 22 Left 1163525917 19:17821367-17821389 CCGCACACGCGCACTAGCGCGCG 0: 1
1: 0
2: 0
3: 8
4: 44
Right 1163525925 19:17821412-17821434 TTCTCACGCATCTCTGGGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 100
1163525915_1163525925 24 Left 1163525915 19:17821365-17821387 CCCCGCACACGCGCACTAGCGCG 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1163525925 19:17821412-17821434 TTCTCACGCATCTCTGGGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163525925 Original CRISPR TTCTCACGCATCTCTGGGGT GGG Exonic
903179350 1:21597584-21597606 TTCTGTCACCTCTCTGGGGTGGG - Intronic
905346216 1:37312885-37312907 TTTTGCTGCATCTCTGGGGTGGG - Intergenic
915800050 1:158781345-158781367 TTCTCACCTGTCTCTGGGGTTGG - Intergenic
917474028 1:175352927-175352949 TTCTCTCACCTCTCTGGGGATGG + Intronic
917912677 1:179667066-179667088 TTATCCAGCATATCTGGGGTAGG + Intronic
923125643 1:231032397-231032419 TTCTCATGCATTGCTGGGGGTGG - Intronic
1067116278 10:43437437-43437459 TTGTCTCGCTTCTCTAGGGTGGG - Intronic
1067990102 10:51202191-51202213 TTCCCATGCATCTCTGGGCTGGG - Intronic
1069223870 10:65916813-65916835 ATCTCACCCACCTCTGGGCTAGG - Exonic
1075330845 10:121573000-121573022 TTCTCACCCATCTCAGCGGGAGG + Intronic
1078100525 11:8327912-8327934 TTCTGAGTCATCTCAGGGGTTGG - Intergenic
1083721566 11:64606203-64606225 TTCCCACACATTTCCGGGGTTGG + Exonic
1083789835 11:64977265-64977287 TTCTGAAGGATCTCTGTGGTTGG - Intergenic
1084007241 11:66329909-66329931 TTCTCAAGAAACTCTGGGCTGGG - Intergenic
1084604254 11:70163066-70163088 TTCTGACCCCTCTCTGGGTTTGG + Intronic
1085975268 11:81645437-81645459 TTCTTACCAATCTATGGGGTAGG - Intergenic
1086938095 11:92766316-92766338 TTCCCACGCTTCTCTGTGGGAGG + Intronic
1089575156 11:119436921-119436943 TTCTCAGTCTGCTCTGGGGTTGG + Intergenic
1091889207 12:4039669-4039691 TGCTCATGCATCTTTGAGGTAGG - Intergenic
1092330225 12:7580326-7580348 GTATCACTCATCTCTGGGATTGG + Intergenic
1095971901 12:47907716-47907738 TTCTCACTTATCCCTGGGATGGG + Intronic
1097780920 12:63703572-63703594 TTCTAACACAGCTCTGGGCTGGG - Intergenic
1100332712 12:93599865-93599887 TTCTCACACTTCTATGGGCTGGG - Intergenic
1102126437 12:110485459-110485481 TTCTTGAGCATCTCTGTGGTTGG - Intronic
1103448249 12:121009050-121009072 TTCTCACGCTTCTTTGCTGTTGG + Intronic
1104090257 12:125510727-125510749 TTCTCTCCCTTCTCTGAGGTAGG + Intronic
1106699071 13:32209545-32209567 TTTTCACACATCTCTTGGGCCGG + Intronic
1117026280 14:51623523-51623545 TTCTCATGCTTCTCTGTGTTTGG + Intronic
1117568539 14:57021871-57021893 TTCTCAAGCATCTTTGGAGAAGG + Intergenic
1119523501 14:75303541-75303563 TTCTGAGGCAGATCTGGGGTAGG + Intergenic
1121892264 14:97605251-97605273 TTCTCACTACTCTCTGAGGTAGG - Intergenic
1128264802 15:66256299-66256321 TTAGCAAGCATCTCTGAGGTTGG + Intergenic
1130370421 15:83281827-83281849 TTCTCTCTCATCTATCGGGTTGG + Intronic
1130910812 15:88269719-88269741 TCCTCCTGCAGCTCTGGGGTTGG + Intergenic
1130999268 15:88925447-88925469 TTCTCTAGCACCTCTGGGTTAGG + Intergenic
1132729658 16:1355150-1355172 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729666 16:1355182-1355204 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1141509161 16:84501489-84501511 TTCTCCCGGCTGTCTGGGGTTGG - Intronic
1142068094 16:88074212-88074234 TTCCCAAGCATGACTGGGGTGGG - Intronic
1143922743 17:10343727-10343749 TTCACAAGCAGCTCTGGGTTAGG + Intronic
1147048903 17:37776374-37776396 TTCTAACACATCTCTTGAGTGGG + Intergenic
1152407692 17:80107139-80107161 TTCTCAGGCATGGCTGGGCTGGG + Intergenic
1153178438 18:2405659-2405681 ATCTCACCAATCTCTGTGGTCGG - Intergenic
1155621572 18:27785927-27785949 GTCTTAAGCTTCTCTGGGGTGGG - Intergenic
1156038250 18:32790213-32790235 TTCTGACTCAGGTCTGGGGTGGG - Intergenic
1159083812 18:63764474-63764496 TTCTCACTCATCTCTCAGGAGGG + Intronic
1163525925 19:17821412-17821434 TTCTCACGCATCTCTGGGGTGGG + Exonic
1167234822 19:48307909-48307931 TTCTGCCCCATCCCTGGGGTTGG - Intronic
1168513194 19:56989826-56989848 TTCTCAGGACTCTCTGGGGTAGG + Intergenic
925184643 2:1838724-1838746 TTCTCATGCATCTTTGGTGCAGG + Intronic
927052220 2:19341600-19341622 TTCTCAGGCATCACTTGGGTGGG - Intergenic
935579916 2:104747640-104747662 TTTTCACGCTTCTCAGAGGTAGG + Intergenic
935861654 2:107337594-107337616 TTCTCAGTCTTCTCTGGAGTTGG + Intergenic
946227068 2:218269793-218269815 TTCTCAGGCCTGGCTGGGGTGGG - Intronic
946745403 2:222840338-222840360 GTTTCAGGTATCTCTGGGGTTGG - Intergenic
947346713 2:229199140-229199162 GTCTCAGGCATATTTGGGGTGGG - Intronic
948314175 2:237014455-237014477 TTCTTATGGATCTCGGGGGTAGG + Intergenic
1169208685 20:3753954-3753976 TCCTCGCCCCTCTCTGGGGTGGG - Exonic
1169703513 20:8475967-8475989 TTCTGACGCAGGTCTGGTGTGGG + Intronic
1173312419 20:41909793-41909815 TTGACACGCAGCTCTGGGGAGGG + Intergenic
1181457760 22:23069585-23069607 CTCTCACGCTTGTCTGGGCTGGG + Intronic
1181931637 22:26406326-26406348 GTCACATGCACCTCTGGGGTTGG + Intergenic
952422620 3:33145388-33145410 ATCTGACGCATCGCTGGGATTGG - Exonic
953136807 3:40188874-40188896 TTCCCACGTGTCTGTGGGGTGGG - Intronic
964199103 3:154098078-154098100 TCCTCAGGCAGCCCTGGGGTGGG - Intergenic
966923521 3:184629790-184629812 TTCTCCCGCCTGTCGGGGGTAGG + Intronic
967513422 3:190338975-190338997 TTCTCAGGCATTTCTGGGTGAGG - Intronic
968079607 3:195836913-195836935 TTCCCAGGCCTCTCTGAGGTGGG + Intergenic
969547557 4:7841456-7841478 TGCTCAGGTAGCTCTGGGGTGGG - Intronic
970504931 4:16718670-16718692 TTGTCATGAATCTCTAGGGTAGG - Intronic
973295937 4:48520769-48520791 TACAGACGCTTCTCTGGGGTTGG - Intronic
983099241 4:163604769-163604791 ATCTCACTCATCTCTGGTCTGGG + Intronic
984529166 4:180894998-180895020 TTCTCACAGTTCTCAGGGGTGGG + Intergenic
985019384 4:185671179-185671201 TTGTCACCCAGCTCTTGGGTGGG - Intronic
985569595 5:637805-637827 TTCTCTCACCTCTCTGGTGTCGG - Exonic
985572827 5:659170-659192 CTCTCACCCACCTCTGGGGTTGG + Intronic
994944460 5:106368213-106368235 TTCTGTGGCATCTCTAGGGTTGG - Intergenic
996164513 5:120208814-120208836 TTCTCACACTTCTCTTGGCTAGG - Intergenic
997304412 5:132827235-132827257 TTCTCAGGAAGCTCAGGGGTGGG - Intronic
997777987 5:136628958-136628980 TTCTGAGGAAGCTCTGGGGTGGG + Intergenic
1002994876 6:2273258-2273280 TTCTGACCCTTCTCTGGGATGGG - Intergenic
1004734894 6:18395460-18395482 TTCACAGGCATCTCAGGTGTGGG + Intronic
1007395348 6:41574686-41574708 TTCCCACGTCTCTCTGAGGTGGG + Intronic
1007779643 6:44245702-44245724 TTCCCAAGCATCCCAGGGGTGGG + Intergenic
1014254908 6:119151187-119151209 TGTTCACGCATCTCTGGGGAGGG + Intergenic
1014474271 6:121853578-121853600 TTCTCAGGCATCTCTGTGGGTGG - Intergenic
1014771721 6:125465148-125465170 TTCTCACAAATCTCTAGGGCAGG - Intergenic
1017428527 6:154347114-154347136 TCCTCTGGCCTCTCTGGGGTTGG + Intronic
1023043079 7:36189654-36189676 TTCTCAGGCATCTCTGGGCAGGG - Intronic
1028258866 7:88635763-88635785 TTCTCACACATTTCTGTGGGAGG - Intergenic
1029104076 7:98160452-98160474 TTCTCACTCATCTTAGGTGTTGG + Intronic
1030788643 7:113695184-113695206 GTCTGCCCCATCTCTGGGGTTGG - Intergenic
1033151242 7:138916712-138916734 TCCTGCCGCCTCTCTGGGGTGGG - Intronic
1036500810 8:9312206-9312228 TTCTCACACATCCCTGAGTTTGG + Intergenic
1038441923 8:27576624-27576646 TTGTCAGGCAGCTATGGGGTTGG - Intergenic
1044878656 8:96699796-96699818 CTCTCACTGATCTCTGGGGGAGG - Intronic
1047473706 8:125204683-125204705 TTCTTACCCATCTCTGCAGTAGG - Intronic
1048527921 8:135221524-135221546 TTCCCACTCATCTCTGGGCCGGG - Intergenic
1051209383 9:14725727-14725749 TTCTCATGCATGTCTAGGGTTGG - Intergenic
1051727305 9:20101587-20101609 AACTCAGACATCTCTGGGGTGGG + Intergenic
1058524234 9:105840884-105840906 TTCTCAGGCATCTTTGGGCAGGG + Intergenic
1061574513 9:131497662-131497684 TTCCCAGGCAGCTCTGGGGTGGG - Exonic
1062277351 9:135737159-135737181 GCCTCACTCACCTCTGGGGTGGG - Intronic
1062338700 9:136083971-136083993 TTCTCCCGCATCACTGGGTGGGG + Intronic
1186157481 X:6740654-6740676 TTCTCAGGGATCTCTGCAGTGGG - Intergenic
1187394333 X:18906724-18906746 TCCTCACGCAGGTCTGGGGCTGG - Exonic
1188158846 X:26775969-26775991 ATCTCACAGATCTCTGGGGCAGG - Intergenic
1188622574 X:32244179-32244201 TTCTCACTCATAGGTGGGGTGGG - Intronic
1190481415 X:50880851-50880873 TTCTCACCCATCTCTGATTTAGG - Intergenic
1192564412 X:72151722-72151744 TTCTCCCTCATATCTGTGGTTGG + Intergenic
1194414164 X:93590125-93590147 TTCTCAAGCCGCTCTGGGCTGGG + Intergenic