ID: 1163527503

View in Genome Browser
Species Human (GRCh38)
Location 19:17830602-17830624
Sequence GAGGGATTCGGGGGCATACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 59}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163527491_1163527503 23 Left 1163527491 19:17830556-17830578 CCCCGAAGCTCCAGACGTCTGAC 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1163527503 19:17830602-17830624 GAGGGATTCGGGGGCATACCTGG 0: 1
1: 0
2: 1
3: 6
4: 59
1163527492_1163527503 22 Left 1163527492 19:17830557-17830579 CCCGAAGCTCCAGACGTCTGACT 0: 1
1: 0
2: 0
3: 9
4: 88
Right 1163527503 19:17830602-17830624 GAGGGATTCGGGGGCATACCTGG 0: 1
1: 0
2: 1
3: 6
4: 59
1163527495_1163527503 13 Left 1163527495 19:17830566-17830588 CCAGACGTCTGACTGGCGAGAGA 0: 1
1: 0
2: 1
3: 5
4: 91
Right 1163527503 19:17830602-17830624 GAGGGATTCGGGGGCATACCTGG 0: 1
1: 0
2: 1
3: 6
4: 59
1163527493_1163527503 21 Left 1163527493 19:17830558-17830580 CCGAAGCTCCAGACGTCTGACTG 0: 1
1: 0
2: 3
3: 16
4: 161
Right 1163527503 19:17830602-17830624 GAGGGATTCGGGGGCATACCTGG 0: 1
1: 0
2: 1
3: 6
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163527503 Original CRISPR GAGGGATTCGGGGGCATACC TGG Exonic
906507408 1:46390437-46390459 GAAGGAGTCGGGGGGACACCAGG + Intergenic
914863312 1:151404716-151404738 TAGGGAAAAGGGGGCATACCAGG - Exonic
1063377338 10:5562036-5562058 GGGGGATCTGGGGGTATACCAGG - Intergenic
1066247383 10:33596562-33596584 GGGGGATACGGGGGCAGAGCAGG - Intergenic
1069835025 10:71302739-71302761 GTGGGATTGGGGGCCATCCCTGG - Exonic
1071512052 10:86268201-86268223 GAGGAGTTGGGGAGCATACCGGG - Intronic
1071518781 10:86316212-86316234 GGGGGATTCTGGGGCACACCTGG - Intronic
1077059548 11:611821-611843 GCGGGAATCGGGGCCATGCCCGG + Exonic
1077059562 11:611860-611882 GCGGGAATCGGGGCCATGCCCGG + Exonic
1085350675 11:75796266-75796288 GAGGGATACCGGGGCATACCCGG - Intronic
1089169718 11:116503556-116503578 GAGGGAGTCCTGGGCAAACCAGG - Intergenic
1091777084 12:3191597-3191619 GAGGGCTTCCGGGGCTTTCCAGG - Intronic
1095983306 12:47984642-47984664 GAGGGAGTTGGGGGCAGAGCGGG + Intronic
1097377381 12:58856647-58856669 GAAGGAGTCGGGGGCATGCTGGG + Intergenic
1104826360 12:131711962-131711984 GAGGGCTCTGGGGGCATAACAGG - Intronic
1119415651 14:74467692-74467714 GAGGGATTGGGGGGAAGCCCTGG + Intergenic
1122049823 14:99048698-99048720 GAGAGATGCAGGGGCATATCGGG + Intergenic
1122757839 14:103996898-103996920 GAGGGAGTCGGGTCCATACCTGG + Intronic
1132974354 16:2704088-2704110 AAGGGATTTGGGGTCATGCCTGG - Intronic
1141096739 16:81168305-81168327 GAAGGATTCAGAGGCAGACCAGG - Intergenic
1143097733 17:4487420-4487442 GAGGGATACGGGGCCAGAGCAGG + Intronic
1143479812 17:7221704-7221726 CAGGGATTGGGGGGCACACTGGG + Intronic
1144942622 17:18952150-18952172 GAGGGACTGAGGGGCAAACCAGG - Exonic
1145986453 17:29050303-29050325 GAGGGATTCTGGGACAGACCTGG - Intronic
1148050926 17:44769647-44769669 GTGGGAGTCGGGGGGATCCCGGG - Intronic
1161800307 19:6413947-6413969 GGGGGACTTGGGGGCATGCCGGG - Exonic
1161962733 19:7531620-7531642 GAGGGAGTCGGGGGCATGGCTGG - Intronic
1162398201 19:10430217-10430239 CAGAGATTTGGGGGCATCCCTGG + Intronic
1163527503 19:17830602-17830624 GAGGGATTCGGGGGCATACCTGG + Exonic
1165764678 19:38343351-38343373 GAGGGAGTCGGAGGCCTTCCTGG - Intronic
1166434445 19:42755542-42755564 GAGGGACTGGGAGGGATACCAGG - Intronic
925062704 2:905355-905377 GAGGGGGTCTGGGGCATCCCTGG - Intergenic
925991165 2:9255665-9255687 AAGGGAGTCGGGGGCAGAGCTGG + Intronic
933633137 2:84678838-84678860 GAGAGATTCTGGGGGCTACCAGG + Intronic
948883749 2:240872997-240873019 GGTGGATTCGGTGGCATCCCTGG + Exonic
1177263612 21:18757528-18757550 GAAGGAGTCGGGGGCATGCTGGG + Intergenic
950621802 3:14211974-14211996 GAGGGATTCCGGGGGCTCCCAGG - Intergenic
953747350 3:45585343-45585365 GAGGGATTCGCGTGGATATCTGG + Intronic
957000379 3:74877181-74877203 GAAGGAGTCGGGGGGATGCCCGG + Intergenic
959100343 3:102002592-102002614 GATAGGTTCAGGGGCATACCAGG + Intergenic
967405746 3:189114610-189114632 GAGGAATTCGGGGGCATGAGAGG - Intronic
967904902 3:194491540-194491562 GAGAGATGAGGGGGCATGCCAGG - Intronic
967904931 3:194491663-194491685 GAGAGATGAGGGGGCATGCCAGG - Intronic
967904960 3:194491786-194491808 GAGAGATGAGGGGGCATGCCAGG - Intronic
967904966 3:194491810-194491832 GAGAGATGAGGGGGCATGCCAGG - Intronic
967904982 3:194491883-194491905 GAGAGATGAGGGGGCATGCCAGG - Intronic
968891821 4:3373389-3373411 GAGGGTTTCGGGGGCGTGCCTGG + Intronic
969056566 4:4406315-4406337 GAGGGTTTCAGGGGCAGACGTGG - Intronic
969690394 4:8701146-8701168 TAGGGACTCGGGGGCAAACTTGG - Intergenic
993026058 5:82648212-82648234 GAAGGATTCTTGGACATACCAGG - Intergenic
993141476 5:84039223-84039245 GAGTCATTCAGGGGCATTCCTGG + Intronic
1002303169 5:178268955-178268977 GAGGGATACGGGGGAATTGCGGG + Intronic
1002347110 5:178555787-178555809 TAGTGACTCGGGGGCATCCCAGG - Intronic
1018127653 6:160697028-160697050 GAGGGAGGCGGGGCCATACAAGG - Intergenic
1023820626 7:43978679-43978701 GAGGGCTTTAGGGGCATTCCAGG - Intergenic
1029748905 7:102532122-102532144 GAGGGCTTTAGGGGCATTCCAGG - Intergenic
1029766848 7:102631228-102631250 GAGGGCTTTAGGGGCATTCCAGG - Intronic
1032389664 7:131547760-131547782 GAGGGCTTGGGGTGCATACCTGG - Intronic
1034164069 7:149012468-149012490 GAGGCATTCGGAGGCTTACTGGG - Intronic
1038020804 8:23550661-23550683 GAGGGATTGGGTGGCAGAGCTGG + Intronic
1048851756 8:138652115-138652137 GAGGGACTCGGGGGGCTCCCAGG - Intronic
1062328598 9:136025115-136025137 GAGGGGTTCTGGGGAACACCAGG + Intronic
1062612231 9:137380412-137380434 GAGGGATTGGGGGGGACGCCTGG - Intronic
1062612256 9:137380465-137380487 GGGGGATTGGGGGGGATGCCCGG - Intronic
1189538712 X:41963952-41963974 GAGGGACTTGGGGACAGACCAGG + Intergenic
1190581593 X:51896325-51896347 GAGGGTTTAGAGGGCATTCCTGG + Intronic
1196045828 X:111255339-111255361 GAGGGGTACGGTGGCATAACAGG + Intronic