ID: 1163528579

View in Genome Browser
Species Human (GRCh38)
Location 19:17836169-17836191
Sequence CTGTATGAACAGAGGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 8, 3: 16, 4: 260}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163528579_1163528589 30 Left 1163528579 19:17836169-17836191 CCCTGCTGCCTCTGTTCATACAG 0: 1
1: 0
2: 8
3: 16
4: 260
Right 1163528589 19:17836222-17836244 AATGATTTGCCTGGAATGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 184
1163528579_1163528588 21 Left 1163528579 19:17836169-17836191 CCCTGCTGCCTCTGTTCATACAG 0: 1
1: 0
2: 8
3: 16
4: 260
Right 1163528588 19:17836213-17836235 CCATCTCTGAATGATTTGCCTGG 0: 1
1: 0
2: 0
3: 15
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163528579 Original CRISPR CTGTATGAACAGAGGCAGCA GGG (reversed) Intronic
900317735 1:2067777-2067799 CTGTGTGACCAGATACAGCAAGG - Intronic
900502890 1:3015295-3015317 CTGGAGGAACACAGGCAGGAGGG - Intergenic
901668250 1:10838582-10838604 TTCTAGGAACAAAGGCAGCACGG + Intergenic
902782472 1:18713305-18713327 CAGTAGGACCACAGGCAGCATGG + Intronic
902885552 1:19402274-19402296 TTGTCTCAACAGAGGCAACAAGG + Intronic
904415719 1:30360043-30360065 CTGCATGACCAGAGGCTCCAGGG - Intergenic
904781973 1:32956629-32956651 TTGTATGAACTTAAGCAGCAGGG - Intronic
905813476 1:40930168-40930190 CTCATTGAACAGAGGCACCATGG + Intergenic
906163169 1:43666193-43666215 CTATAAGAACAGAGGCAGCTTGG + Intronic
906243454 1:44256904-44256926 CTGCAGGGACTGAGGCAGCATGG - Intronic
906713819 1:47952321-47952343 CTAGATGAGCAGAGGCAGGAGGG - Intronic
906834055 1:49063843-49063865 CTGGAGGAACAGAAGCAACAGGG - Intronic
907832523 1:58078548-58078570 TTGTTTGAGCAGAGGCTGCAGGG - Intronic
909318285 1:74251109-74251131 CTCTCTGCACAGAGGCATCATGG - Intronic
909882134 1:80892739-80892761 CTGTCTGAACAGAGAATGCAAGG + Intergenic
911315722 1:96354511-96354533 CTGAATGAGATGAGGCAGCATGG - Intergenic
911709836 1:101057827-101057849 CAGAATGCAAAGAGGCAGCAAGG - Intergenic
912451796 1:109771990-109772012 GTGTGTGCACAGAGCCAGCATGG + Intronic
917213568 1:172655592-172655614 ATGAATCAACAGAAGCAGCAGGG + Intergenic
917618496 1:176770422-176770444 CGGTTTGAACAGAGGCAGTTTGG - Intronic
919472777 1:197999484-197999506 TTGTATGAAAAAAGGCAGGATGG + Intergenic
920202945 1:204271325-204271347 CTTTATCACCAGAGCCAGCAAGG + Intronic
920240959 1:204550077-204550099 CTGTCTGAAGAGGGGCAGAAGGG - Exonic
921813773 1:219544169-219544191 CTGGGTGAGCACAGGCAGCAGGG + Intergenic
922844056 1:228668972-228668994 CTGAATGAAAAGGGGCAGGATGG + Intergenic
924019007 1:239760742-239760764 AATTATGAACAGAGGCATCAAGG - Intronic
924246852 1:242093635-242093657 CTTTAGGATCAGAGGCAACATGG - Intronic
924353322 1:243141507-243141529 CTGTATTAAAACTGGCAGCAAGG + Intronic
924418260 1:243882563-243882585 CCGTATGTACAGTGTCAGCAGGG - Intergenic
1063842650 10:10089488-10089510 CTGCAGGAACAGAGCCAGGATGG - Intergenic
1067221203 10:44345616-44345638 CTGCATGAACTGAGACAGCCAGG - Intergenic
1067571376 10:47373824-47373846 CTGAATAAACGCAGGCAGCATGG + Intronic
1068150048 10:53120030-53120052 CAGTGTGAACAAAGGCAGAAAGG + Intergenic
1072616162 10:97050002-97050024 CTGTACAAACCGAGGCAGCCTGG + Intronic
1074223305 10:111459625-111459647 CTGTGGGAAGAGAGGCTGCAAGG - Intergenic
1074515216 10:114161076-114161098 CTGTCAGAACAGTGACAGCACGG - Intronic
1075370763 10:121932939-121932961 TTGTATGAGCAGAGGCAGGGAGG + Intergenic
1076194916 10:128510929-128510951 CTGTCTGACAAGAGGCAGCTGGG - Intergenic
1076721251 10:132394314-132394336 CTGTAGGCACAGCCGCAGCAAGG - Intergenic
1077791254 11:5442477-5442499 CTGAAGGAAAAGAGGCAGAAAGG - Intronic
1079478488 11:20857088-20857110 CTGTATGCACAGCATCAGCAGGG - Intronic
1079995516 11:27291379-27291401 CTGTATGTACAGCAACAGCAGGG + Intergenic
1080174354 11:29343886-29343908 GCGTATGCACAGAGGCAGCCTGG - Intergenic
1083314281 11:61804727-61804749 CTGGAAGTAGAGAGGCAGCAAGG + Exonic
1083935121 11:65865963-65865985 CTGCAGGAAGAGAGGCAGCGAGG - Intronic
1085013912 11:73159948-73159970 CTGAATTAACAAAGGCAGCTGGG - Intergenic
1085656284 11:78318220-78318242 CTGGTGGAACAGAGGCAGAAGGG + Intronic
1087919499 11:103849985-103850007 CTTCATAAACAGAAGCAGCAAGG - Intergenic
1090762494 11:129849588-129849610 CTGTATGAGCTGTGGGAGCACGG - Intronic
1090896496 11:130980684-130980706 CAGCATGAACAGCAGCAGCAGGG + Intergenic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1092121575 12:6047932-6047954 CTATCTGCACAGAGGCAGAAGGG + Intronic
1092389708 12:8065221-8065243 CTGCATGAACTGAAGTAGCAGGG + Intronic
1092918165 12:13206860-13206882 CTGCCTGAACAAAGGCAACAAGG + Intronic
1094090680 12:26645592-26645614 TTGAATGCCCAGAGGCAGCATGG + Intronic
1096554131 12:52393081-52393103 CTGTATGGACAGGGGCTGAAGGG - Intergenic
1097894440 12:64810266-64810288 CTGTAAGAACAGAGAAAACATGG - Intronic
1098701555 12:73634746-73634768 CTCTATAAATAGAGGCAGTATGG - Intergenic
1098867578 12:75780430-75780452 CTGTCTGGAGGGAGGCAGCAGGG + Intergenic
1099943567 12:89218927-89218949 ATGTTTGAACAGATGAAGCATGG - Intergenic
1100195905 12:92244149-92244171 CTGCAGGAACAGTGGCAGGAGGG - Intergenic
1102462448 12:113108273-113108295 CTGCGTAAACTGAGGCAGCAAGG + Intronic
1107343418 13:39434087-39434109 TTGCATGCTCAGAGGCAGCATGG + Intronic
1107553316 13:41496570-41496592 CTCTATGCCCAGAGGCTGCAGGG + Intergenic
1107566543 13:41611042-41611064 CTAAATGAGCAGAGGCACCAGGG - Intronic
1110332515 13:74288838-74288860 CTGACAGAACAGAGGCAGGAAGG - Intergenic
1111966738 13:94869024-94869046 CTGAATTAACTGAGACAGCAAGG + Intergenic
1112267588 13:97939314-97939336 CTGCATGCACAGATGCACCAGGG - Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1117212378 14:53513908-53513930 ATGTGTGAACAAAGGCAGTACGG + Intergenic
1117320331 14:54616175-54616197 GTGCATGAGCAGAGGGAGCAAGG - Intronic
1118789093 14:69072677-69072699 CTGTAAGAATAGTGGCAGAAGGG + Intronic
1119534504 14:75392034-75392056 CAGTCTGGACAGAGGCAGCCTGG + Intergenic
1122449843 14:101796839-101796861 CTTGAGGAGCAGAGGCAGCAGGG - Intronic
1123663505 15:22587184-22587206 TGTTATGACCAGAGGCAGCAAGG + Intergenic
1124317335 15:28681636-28681658 TGTTATGACCAGAGGCAGCAAGG + Intergenic
1124566108 15:30815867-30815889 TGTTATGACCAGAGGCAGCAAGG - Intergenic
1125828721 15:42696051-42696073 ATGAATGAACAGAAGGAGCAGGG - Intronic
1128901683 15:71428307-71428329 TAGTCTGAACAGAGACAGCATGG - Intronic
1129231426 15:74199172-74199194 CTGTATGAAGAGAGGCATCAAGG + Intronic
1129960916 15:79682877-79682899 ATGTCTGAACAGACTCAGCAGGG - Intergenic
1129968538 15:79757813-79757835 CTGGGGGACCAGAGGCAGCACGG + Intergenic
1130261873 15:82360827-82360849 ATTTATAAAAAGAGGCAGCATGG - Intergenic
1130279362 15:82508184-82508206 ATTTATAAAAAGAGGCAGCATGG + Intergenic
1131057909 15:89386936-89386958 CTGTATGAAGAGAGGCAGCTGGG - Intergenic
1132375345 15:101325047-101325069 CTGTAGGAGCAAAGGCAGGAGGG + Intronic
1132556971 16:576812-576834 CTGAAGGCCCAGAGGCAGCATGG - Intronic
1134766805 16:16766343-16766365 ATGTATAGAGAGAGGCAGCAAGG + Intergenic
1135267421 16:21039621-21039643 GTGTATGTAAAGAGACAGCAGGG + Intronic
1136057103 16:27698627-27698649 CTGTCTGAACAGTGGAAACACGG - Intronic
1136547996 16:30966075-30966097 CTATATGCACAGGGGCAGGAGGG + Exonic
1137404011 16:48176044-48176066 CTGAATGAATATAGGCAGTAGGG + Intronic
1137714688 16:50591582-50591604 CTGTACAAAAAGAGGAAGCATGG - Intronic
1138189819 16:55005368-55005390 AGGGATGAATAGAGGCAGCATGG - Intergenic
1139959917 16:70711523-70711545 CTGTTTGAACAGAGGAGGCCAGG - Intronic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140774190 16:78235195-78235217 CTGTTTGAAGAAAGGAAGCATGG - Intronic
1141358992 16:83376996-83377018 CTGTATGAACAGAGAGGTCAAGG + Intronic
1141365129 16:83435504-83435526 CAGAGTGAAGAGAGGCAGCAGGG - Intronic
1142278670 16:89136720-89136742 CTGTAGGCACAGAGGCAGGTGGG - Intronic
1143013299 17:3878278-3878300 GTGGATGAACAGAGGCACGAGGG - Intronic
1149957675 17:61070743-61070765 CTGTATTTACACAGGCAGCCTGG + Intronic
1150125160 17:62630468-62630490 CTGTCTGGAGAGAGGCAGGAAGG + Intronic
1151353782 17:73546554-73546576 CTGGCTGACCAGAGGGAGCAAGG + Intronic
1152236819 17:79143261-79143283 CTGTAAGGACAGAGGCAGGGTGG - Intronic
1152436969 17:80282222-80282244 CTGTATGAACAGTTGCTACACGG + Intronic
1153922591 18:9804719-9804741 CTGTCCTAACAGAGGCAGCTGGG + Intronic
1155319880 18:24608806-24608828 CTGTATGTACAGCATCAGCAAGG + Intergenic
1155535124 18:26809075-26809097 ATGTATGCACAGAGGCTGAAGGG + Intergenic
1155680616 18:28481762-28481784 CAGGATTAACAGTGGCAGCATGG - Intergenic
1156446138 18:37238357-37238379 CTGACTGAGCAGAGGCATCAGGG - Intergenic
1157618606 18:49002438-49002460 CAGCAGAAACAGAGGCAGCAGGG - Intergenic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158119695 18:54035234-54035256 CTGTATAAACAGAGATATCATGG + Intergenic
1158358050 18:56642066-56642088 CTGTATGTACAGTGTCAGCAGGG - Intronic
1158964699 18:62612153-62612175 CTGCAGGAACGGAGGCAGCCAGG - Intergenic
1162054009 19:8052162-8052184 CTCTATGAATATAGTCAGCACGG - Intronic
1162805315 19:13135265-13135287 CTCAATGAACAGCGGCTGCAGGG + Exonic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1163737173 19:18988518-18988540 CTGTGTGGAGGGAGGCAGCAAGG + Intergenic
1163750635 19:19075385-19075407 CTGCATGAACAGAAGCAGCATGG + Intronic
1164411402 19:28008828-28008850 CAGTATGCAAAGAGCCAGCAGGG + Intergenic
1165380472 19:35476044-35476066 CTGGATGAAGTGAGGGAGCAAGG + Intergenic
1166154252 19:40899041-40899063 CTGTATGAACACAAGCAGCAGGG + Intergenic
1166173856 19:41051541-41051563 CTGTATGAACACAAGCAGCAGGG - Intergenic
1167266125 19:48483589-48483611 CTGCATGAACCAAGGCAGCGGGG - Intergenic
925465959 2:4107700-4107722 CAGTAAGAAAAGAGGCAGCCCGG + Intergenic
926414299 2:12633897-12633919 CTGCATGAACAAAGATAGCAAGG + Intergenic
926444102 2:12923005-12923027 TAGTATGAACAGAGGCATGATGG + Intergenic
928200138 2:29242649-29242671 CTGTGTGACCTGAGGCAACATGG + Intronic
928856508 2:35808916-35808938 CTGTGTGCAAAGAGGAAGCAGGG - Intergenic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
934967881 2:98738619-98738641 CGGTGTGAACAGAGGCATCATGG + Intergenic
935437477 2:103050857-103050879 CTGTAGGAACAAAAACAGCATGG - Intergenic
937064154 2:119004679-119004701 CTGTATGTACAGTGTCTGCAAGG + Intergenic
937211330 2:120273690-120273712 CTGTAAGACCAGAGGCAAGATGG + Intronic
937504477 2:122521252-122521274 CAGTATGAAGAAAGTCAGCAGGG + Intergenic
939163947 2:138620333-138620355 CTGAATGAAAAGAGGCAAGAGGG + Intergenic
939614007 2:144342308-144342330 CTATAGGAACAAAAGCAGCATGG - Intergenic
940081296 2:149805040-149805062 CTGTATTAACTGAGGAAGCTAGG + Intergenic
940207182 2:151216090-151216112 CTGATTGAAAAGAGGCAGTAGGG + Intergenic
940238782 2:151540612-151540634 CTCTCTGATCAGAGGTAGCAGGG + Intronic
940480645 2:154226122-154226144 ATGAATGAACAGAGACAGGAGGG + Intronic
942334440 2:174867588-174867610 CTTTATGAACAGAGCCATGATGG + Intronic
943786857 2:191886778-191886800 CTGCATGAAGAGAGGCAGAAAGG + Intergenic
945804524 2:214474264-214474286 CTGAAAGCAAAGAGGCAGCATGG + Intronic
947982497 2:234422296-234422318 CTCAAGGAACAGAGACAGCATGG - Intergenic
948217715 2:236244241-236244263 CTATATGAGCAGAGGCTGGAGGG + Intronic
1169167202 20:3434273-3434295 TTGTATGAAAAGAGTTAGCATGG - Intergenic
1169707592 20:8523168-8523190 GTGGATGAATAAAGGCAGCAGGG - Intronic
1170910443 20:20561399-20561421 ATGTATGAAAGGAGGCAGGAAGG - Intronic
1171235456 20:23520779-23520801 GTGTATCTTCAGAGGCAGCAGGG + Intergenic
1172473111 20:35215594-35215616 ATGAATGAACAAAGGCACCAAGG + Intergenic
1172983608 20:38964231-38964253 CAGCATGAACAAAGGCAGAATGG + Intronic
1174051155 20:47768534-47768556 CTGTGTGAACAGAGGCCTCAGGG + Intronic
1175705095 20:61170952-61170974 CTGGATGGGCAGAGGCAGCTGGG - Intergenic
1176187759 20:63790675-63790697 CTCAACGAGCAGAGGCAGCACGG - Exonic
1177590262 21:23154857-23154879 CTGAATCAGAAGAGGCAGCAGGG + Intergenic
1179591961 21:42414899-42414921 CAGCATGAACCCAGGCAGCATGG - Intronic
1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG + Intronic
1182059761 22:27388524-27388546 CTCTCTGAACAGAGACAGGAAGG + Intergenic
1182732881 22:32509521-32509543 GTGTATGAACATAGGAACCAAGG - Intergenic
1183099231 22:35573737-35573759 CTGTGTGAACAGAGGGGGCTGGG + Intergenic
1185108696 22:48888724-48888746 CTGTGGAAACAAAGGCAGCAAGG + Intergenic
950516660 3:13470878-13470900 CTGGATGAACACAGCCTGCATGG - Intergenic
950689908 3:14647392-14647414 CTGGATTTAGAGAGGCAGCAGGG - Intergenic
950797749 3:15524087-15524109 CTGTATGTGCAGAGGCTCCAAGG - Intergenic
951081602 3:18456390-18456412 CTGTGTGAACTGAGGAGGCAGGG - Intergenic
951712038 3:25592898-25592920 CCGTGTGATCAGAGGCATCATGG + Intronic
953093107 3:39749255-39749277 ATCTATGAACAGTGGAAGCATGG - Intergenic
953996092 3:47521180-47521202 CGGTCTCAGCAGAGGCAGCAGGG + Intergenic
954962485 3:54578589-54578611 CTGTATCACCAGAGGGAGCCGGG - Intronic
955656375 3:61249436-61249458 ATCTAAGTACAGAGGCAGCATGG + Intronic
956146606 3:66197289-66197311 CTGTATGAGGATAGGCATCAGGG + Intronic
956710880 3:72037718-72037740 ATGTATGAATAAAGGCATCAGGG - Intergenic
956931224 3:74045648-74045670 CTGTATGAGTAGGGGCAGTATGG + Intergenic
958595608 3:96217748-96217770 CAGGATTAACAGTGGCAGCATGG + Intergenic
958922058 3:100118563-100118585 GTGCTTGAACAGAGGCCGCATGG - Intronic
961450004 3:126998409-126998431 CTGTGGGGACACAGGCAGCAGGG - Intronic
962941374 3:140127670-140127692 CTTTATGGACAGAGACAGCCAGG + Intronic
963318525 3:143786792-143786814 ATGAATGCACAGAGGAAGCATGG + Intronic
964184197 3:153923209-153923231 CTGTTATATCAGAGGCAGCATGG + Intergenic
966385144 3:179388218-179388240 CTGAATGAATAGAGGTAGCCTGG + Intronic
967220494 3:187244156-187244178 CTGCCTGTAGAGAGGCAGCAGGG - Intronic
968563902 4:1299308-1299330 CTGTGACAACAGAGGCATCAAGG - Intronic
968695658 4:2024957-2024979 CAGGATAAACAGTGGCAGCATGG + Intronic
969210273 4:5681943-5681965 CTGTATGAACTTAGACAGCCTGG - Intronic
970252311 4:14128804-14128826 TTGAAAGAACAGAGGCAGAAGGG + Intergenic
972239884 4:37178864-37178886 CTGAGTGAACAGAGGTAGCTGGG - Intergenic
972724345 4:41733108-41733130 GTGTATGACCAGATGCAGTAGGG + Intergenic
976342615 4:83962534-83962556 CTGTATGTACAGTGTTAGCAGGG + Intergenic
977764877 4:100785327-100785349 CTGGGTGAACAGGGGCAGGAGGG + Intronic
978370957 4:108029228-108029250 CTGTATGAACGGAGATGGCACGG - Intronic
978784237 4:112591720-112591742 CTGAATGAAGAGAGGGAGAAAGG - Intronic
979248614 4:118538790-118538812 CTGTATTAAAACTGGCAGCAAGG - Intergenic
979389571 4:120112238-120112260 CTGTAAGGACAGGGGAAGCAAGG + Intergenic
980267629 4:130539091-130539113 CTGTAGTTTCAGAGGCAGCAAGG + Intergenic
982090367 4:151875259-151875281 CTGCATGAACAGGGGAGGCATGG + Intergenic
982103446 4:151990910-151990932 TTGAATGCACAGAGACAGCAGGG - Intergenic
983771026 4:171549246-171549268 CAGTATGAAGAAAGGCATCATGG + Intergenic
984934785 4:184880670-184880692 CCTTATGAAAAGAGGCAACATGG - Intergenic
985952816 5:3236460-3236482 CTCTTTGAACAGAGGAGGCAAGG - Intergenic
986713499 5:10505026-10505048 CTGTTTGCAAGGAGGCAGCAGGG + Exonic
988780517 5:34516934-34516956 CTGAAGGAAATGAGGCAGCAAGG - Intergenic
994616038 5:102106280-102106302 CTGAATGAACTAAGGCATCAGGG - Intergenic
994796169 5:104302508-104302530 CTGTGTGAACAGAGGAAGCATGG - Intergenic
997487669 5:134245358-134245380 CTGTATGCACAGTGTCAGCAAGG + Intergenic
997745680 5:136298308-136298330 CTGAAGGAACAGAGGCAGGCAGG + Intronic
999065544 5:148682003-148682025 CTGTACAAAAACAGGCAGCAGGG - Intergenic
999371716 5:151059491-151059513 CTTTGTGAAGGGAGGCAGCAGGG + Intronic
1001923244 5:175617190-175617212 CTGGATGCACAGAGCCAGAAAGG + Intergenic
1002772374 6:300984-301006 CTTTGGCAACAGAGGCAGCAGGG - Intronic
1003573184 6:7269238-7269260 GTGGCTGGACAGAGGCAGCAGGG + Intronic
1003776731 6:9375198-9375220 CTGTATAAACACATGCACCATGG + Intergenic
1004543462 6:16573777-16573799 TTGTAGGCACAGTGGCAGCAGGG - Intronic
1006391071 6:33759017-33759039 GTGTAAGTACAGAGGCAGGATGG + Intergenic
1009681761 6:66902675-66902697 CTGTATGACCATAGGCAGCACGG - Intergenic
1009712684 6:67346212-67346234 CTGTATGTACAGTGTTAGCAGGG - Intergenic
1010869661 6:81021788-81021810 CAGGATTAACAGAGGCAGCATGG + Intergenic
1011113835 6:83867853-83867875 CTGTATGTACAGCGTAAGCAGGG - Intronic
1011445342 6:87433146-87433168 CTGAATAAAATGAGGCAGCAAGG - Intronic
1012416516 6:99019427-99019449 CTGTATGTACAGTGTTAGCAGGG + Intergenic
1014415119 6:121174414-121174436 CTGAATCAAAAGAGTCAGCACGG + Intronic
1014541192 6:122678300-122678322 CTGAATGAAAAGAGGCAGGAGGG + Intronic
1016507009 6:144793866-144793888 ATGTGTGACCAGAGGCAGCTGGG + Exonic
1016556976 6:145349787-145349809 CTGTCTGAAGAGAAGCAGGATGG + Intergenic
1017569655 6:155731092-155731114 CTATAAGAACAGGGGCAGGATGG + Intergenic
1017869468 6:158474555-158474577 CTTTTTGAAGAGAGGGAGCAGGG - Intronic
1018475074 6:164132449-164132471 CTGTATGCACATGGGCAGCCAGG - Intergenic
1019115542 6:169758500-169758522 GTGGTTAAACAGAGGCAGCAGGG - Intronic
1020007244 7:4789367-4789389 CTGAATTATCAGGGGCAGCAGGG - Intronic
1021842163 7:24729613-24729635 CTGTCTGCACAGAGGCATGAAGG - Intronic
1022865037 7:34408986-34409008 CTGTATGCATTGAGGCAGCAGGG + Intergenic
1024657008 7:51459425-51459447 CTGAATGAACAGACGCAGACTGG - Intergenic
1025626454 7:63226717-63226739 CAGAATGAACAAAGGCAGCTTGG - Intergenic
1027754999 7:82202180-82202202 CCGTATGTACAGCGTCAGCAGGG - Intronic
1027755435 7:82205022-82205044 CTGCATGTACAGTGTCAGCAGGG - Intronic
1028456460 7:91043229-91043251 TTGTAGAAACAGAGGCAGCCAGG + Intronic
1030161324 7:106511257-106511279 CAGCATGAAGAGAGGAAGCATGG + Intergenic
1030187729 7:106779972-106779994 CTGTGGGAAAAGAGGGAGCATGG - Intergenic
1033014777 7:137661217-137661239 CAGTAGGAAAAGAGCCAGCATGG + Intronic
1033314476 7:140286054-140286076 CTCTATGAACTATGGCAGCACGG - Intergenic
1035741496 8:1931183-1931205 TGGTAGGAACACAGGCAGCAGGG - Intronic
1036700094 8:11007740-11007762 GTGGAGGAACAGAGGCAGCAGGG + Intronic
1037819611 8:22129349-22129371 CTGCATGTGGAGAGGCAGCATGG - Intronic
1038018859 8:23536429-23536451 TGGCAGGAACAGAGGCAGCAGGG - Intronic
1038500142 8:28037023-28037045 CTGTATGTACAGCGTTAGCAGGG - Intronic
1040697753 8:50022749-50022771 CAGTGGGAACAGAGGCAACATGG - Intronic
1042423600 8:68620457-68620479 CTGTATTACCAGAGTGAGCAAGG + Intronic
1044571985 8:93730232-93730254 CTGCAAAAACAGAGGCAGCAAGG + Exonic
1045819407 8:106318494-106318516 CTTTGTGAACATAGGAAGCAGGG - Intronic
1046620623 8:116525893-116525915 CTGGAAGAATAGAGGCAGCTGGG + Intergenic
1048790741 8:138101048-138101070 CTGTATGTATAGCGTCAGCAGGG - Intergenic
1049426470 8:142540134-142540156 CTAAATGACCAGAGGGAGCATGG - Intronic
1050663062 9:7904968-7904990 CAGTATGAACCCAGGCAGCCTGG + Intergenic
1050795955 9:9541790-9541812 CTGGCTGAAGAGTGGCAGCAGGG + Intronic
1050889479 9:10806188-10806210 CTGAGTGAAAAGAGGCAGGAGGG - Intergenic
1050919737 9:11186436-11186458 CGGAATTAACAGAGGCAGCCTGG + Intergenic
1051816570 9:21114251-21114273 CTGTATCAATACAGGCTGCAAGG + Intergenic
1052254910 9:26444828-26444850 ATATATGAACAGGGGCATCAGGG + Intergenic
1052337845 9:27337941-27337963 CTCTAGGACCACAGGCAGCATGG - Intronic
1052423713 9:28276514-28276536 ATGTATCAACAAAGTCAGCATGG + Intronic
1052866075 9:33465396-33465418 CTGGATGAACAGTGGCAGTGGGG - Intronic
1053366778 9:37528434-37528456 CAGCATGAGCAAAGGCAGCAGGG - Intronic
1053416403 9:37949584-37949606 CAGCATGGACAGAAGCAGCAAGG + Intronic
1056062665 9:82900155-82900177 CTGAATAAACTGAGCCAGCAAGG - Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1057745394 9:97747103-97747125 CTTTATTAAAAGAGGCAGCAGGG - Intergenic
1058140824 9:101355354-101355376 CTGTATCAAAAGAGGAAGCTTGG - Intergenic
1058288559 9:103209919-103209941 CTGCATGAGCAGAGCCATCATGG - Intergenic
1059283582 9:113154433-113154455 CAGTTTGAACAGAGGCAGCAAGG - Intronic
1059792947 9:117660410-117660432 CTGCCTCCACAGAGGCAGCATGG - Intergenic
1059902640 9:118945346-118945368 CTGTGTGCACAGAGCCAGCACGG + Intergenic
1185721624 X:2387255-2387277 CCCTATCAACTGAGGCAGCAGGG + Intronic
1186363965 X:8872496-8872518 CTTTGTGAAGAGAGGCAGAAGGG + Intergenic
1187722804 X:22169639-22169661 CTGGAGGAACAGAGGCATCAGGG + Intronic
1188293491 X:28417393-28417415 CTGAATGGACTGATGCAGCATGG - Intergenic
1193547110 X:82844357-82844379 CATAATTAACAGAGGCAGCATGG + Intergenic
1193913005 X:87328141-87328163 CTGTAGCAGCAGAGGCAGAAGGG - Intergenic
1196109388 X:111929995-111930017 ATGTTTGAGCAGAGGCAGAATGG - Intronic
1196616581 X:117773106-117773128 CTCTATGAAATGAGGAAGCAAGG + Intergenic
1196756997 X:119166727-119166749 CTGTATGTGCAAAGGCTGCATGG - Intergenic
1198227332 X:134657511-134657533 CTGTTACTACAGAGGCAGCAGGG - Intronic
1198272450 X:135067355-135067377 CAGGATTAACAGTGGCAGCATGG - Intergenic
1200914528 Y:8559806-8559828 CTGGATGAAGGGAGGCAGCAAGG + Intergenic