ID: 1163529066

View in Genome Browser
Species Human (GRCh38)
Location 19:17839092-17839114
Sequence TGCTCATTAAAGCCCCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 143}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163529066_1163529075 23 Left 1163529066 19:17839092-17839114 CCTGCAGGGGGCTTTAATGAGCA 0: 1
1: 0
2: 1
3: 14
4: 143
Right 1163529075 19:17839138-17839160 ATCGGTTCTACCAGGGATTCTGG 0: 1
1: 0
2: 1
3: 2
4: 50
1163529066_1163529068 -10 Left 1163529066 19:17839092-17839114 CCTGCAGGGGGCTTTAATGAGCA 0: 1
1: 0
2: 1
3: 14
4: 143
Right 1163529068 19:17839105-17839127 TTAATGAGCAAGTGGCACTGTGG 0: 1
1: 0
2: 1
3: 13
4: 147
1163529066_1163529073 16 Left 1163529066 19:17839092-17839114 CCTGCAGGGGGCTTTAATGAGCA 0: 1
1: 0
2: 1
3: 14
4: 143
Right 1163529073 19:17839131-17839153 ACCAGGGATCGGTTCTACCAGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1163529066_1163529069 -1 Left 1163529066 19:17839092-17839114 CCTGCAGGGGGCTTTAATGAGCA 0: 1
1: 0
2: 1
3: 14
4: 143
Right 1163529069 19:17839114-17839136 AAGTGGCACTGTGGACAACCAGG 0: 1
1: 0
2: 2
3: 11
4: 136
1163529066_1163529072 15 Left 1163529066 19:17839092-17839114 CCTGCAGGGGGCTTTAATGAGCA 0: 1
1: 0
2: 1
3: 14
4: 143
Right 1163529072 19:17839130-17839152 AACCAGGGATCGGTTCTACCAGG 0: 1
1: 0
2: 0
3: 3
4: 50
1163529066_1163529070 0 Left 1163529066 19:17839092-17839114 CCTGCAGGGGGCTTTAATGAGCA 0: 1
1: 0
2: 1
3: 14
4: 143
Right 1163529070 19:17839115-17839137 AGTGGCACTGTGGACAACCAGGG 0: 1
1: 0
2: 1
3: 17
4: 167
1163529066_1163529071 5 Left 1163529066 19:17839092-17839114 CCTGCAGGGGGCTTTAATGAGCA 0: 1
1: 0
2: 1
3: 14
4: 143
Right 1163529071 19:17839120-17839142 CACTGTGGACAACCAGGGATCGG 0: 1
1: 1
2: 1
3: 21
4: 210
1163529066_1163529076 24 Left 1163529066 19:17839092-17839114 CCTGCAGGGGGCTTTAATGAGCA 0: 1
1: 0
2: 1
3: 14
4: 143
Right 1163529076 19:17839139-17839161 TCGGTTCTACCAGGGATTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163529066 Original CRISPR TGCTCATTAAAGCCCCCTGC AGG (reversed) Intronic
902504242 1:16929125-16929147 TGCATATTAATGCCCCCTTCTGG - Intronic
902724244 1:18324444-18324466 GGCTCATGACCGCCCCCTGCAGG - Intronic
903749067 1:25608536-25608558 CTCTCATTTAAGCCCCATGCCGG + Intergenic
906717999 1:47984538-47984560 TGCTGCATAAAGCCGCCTGCTGG - Intronic
916074899 1:161194688-161194710 TGCCCATTAAAGCCTCTTACAGG - Intronic
919970977 1:202578377-202578399 TGCTCTTTAACGCCCCATGCTGG - Intronic
924195101 1:241598450-241598472 TGCTCATCAAGGCCAGCTGCAGG - Intronic
1064393196 10:14959299-14959321 TGCGCATAAAAGCCCACTCCCGG + Intergenic
1068701846 10:60028744-60028766 TGCTCATAAAAGGCCCCAGTCGG - Exonic
1073035768 10:100563173-100563195 TGCTCAGTGAAGCCCCATGGGGG + Intergenic
1074095868 10:110311961-110311983 TGCTCATGAAAGGCTCCTGGTGG + Intergenic
1075297590 10:121291935-121291957 TGCACATTGAAGCCACTTGCGGG - Intergenic
1076474861 10:130744785-130744807 AGGTCATTTAAGCCACCTGCTGG + Intergenic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1077179580 11:1206296-1206318 TGCTCATAAAACCCACCTGGAGG + Intergenic
1080498957 11:32849797-32849819 TGGTCATTCTAGCCCCATGCTGG + Intronic
1089660551 11:119982629-119982651 TGCTCAGCACAGCTCCCTGCAGG + Intergenic
1093643323 12:21553542-21553564 TGCCCATTAAAGGCACCTGTTGG - Intronic
1095865412 12:46966369-46966391 AGCTCATCAAATCCACCTGCAGG - Intergenic
1096571277 12:52524658-52524680 TGCTCCCCACAGCCCCCTGCAGG - Intergenic
1099584370 12:84497997-84498019 TGCCCACTAGAGCCCCCTGTTGG + Intergenic
1104093708 12:125537392-125537414 GACTCATTAAAGCCACCTGCTGG + Intronic
1104278632 12:127353504-127353526 TGCACATGAAAGACCCGTGCAGG - Intergenic
1104429468 12:128705083-128705105 TGCTGAATACAGCCTCCTGCAGG - Exonic
1104585848 12:130047476-130047498 TGCTCACTCATGCCACCTGCAGG - Intergenic
1105022492 12:132826544-132826566 TGCTCACTTAATTCCCCTGCTGG + Intronic
1105375686 13:19842246-19842268 GGCTCTTGACAGCCCCCTGCGGG - Intronic
1106038096 13:26063736-26063758 TACTCATTATAGCCCCCTCCAGG - Intergenic
1110333073 13:74294944-74294966 TCCTGATTAAAGGCCCCTGCTGG + Intergenic
1111979754 13:95003291-95003313 TGGTCATTGAAGCTCCCCGCTGG - Intergenic
1113493549 13:110711843-110711865 TGCTCATTCCAGGGCCCTGCCGG - Intronic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1115183419 14:30656356-30656378 TGCTCACTAATGCCACCTGCAGG - Intronic
1115876151 14:37864355-37864377 TGCTGATTAAAGCCACTTGGGGG + Intronic
1121665021 14:95665738-95665760 TGCTCAGTAAAGCCCCCTACTGG + Intergenic
1122095013 14:99364159-99364181 TCCTCACAAAAGGCCCCTGCGGG - Intergenic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1202859512 14_GL000225v1_random:72602-72624 AGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1131033372 15:89205068-89205090 TGCACATTTGAGCCACCTGCTGG + Intergenic
1134397270 16:13876716-13876738 TACTCATGGAAGCCCCATGCTGG - Intergenic
1135467273 16:22697900-22697922 TTCTCCTTAAAGCCCCCAGAAGG - Intergenic
1138560677 16:57799194-57799216 TGCTCAATAAAGACTTCTGCAGG - Intronic
1140401011 16:74671597-74671619 TGCCCACTGAAGCCCCCTCCAGG + Intergenic
1141480046 16:84300384-84300406 TGCTCATTAACACTCCCTGAAGG + Intronic
1142873112 17:2834117-2834139 TGGTCAGTAAAGCCCTCTGGAGG - Intronic
1146395498 17:32461908-32461930 TCCTCATTGGAGCCCCCTGGTGG - Intronic
1147881469 17:43656848-43656870 TGGGGATTAAAGACCCCTGCTGG - Intronic
1148889418 17:50797261-50797283 TGCTCATGAAAGCCTTCTACAGG + Intergenic
1152182976 17:78836189-78836211 TGCTCTTTAAGGCCTCCAGCTGG + Exonic
1157428173 18:47601804-47601826 TGCACATTACACCCCCCTGCAGG + Intergenic
1159951454 18:74487130-74487152 TGCTCATAAATGCTCTCTGCAGG + Intergenic
1163311353 19:16516823-16516845 TGCTCATTGCAGCCCTCTGGGGG + Intronic
1163495928 19:17646660-17646682 TGCTCGTTGGTGCCCCCTGCAGG + Intronic
1163529066 19:17839092-17839114 TGCTCATTAAAGCCCCCTGCAGG - Intronic
1163546964 19:17946475-17946497 TGCTCGTTGGTGCCCCCTGCAGG - Intergenic
1163757672 19:19116169-19116191 TGCTCATTGGTGCCCCCTGCAGG + Intergenic
1164413044 19:28021454-28021476 TGCTCATAAGAACCCCCTCCAGG - Intergenic
1164476138 19:28577418-28577440 TGCTTTTTAAAGCCAGCTGCAGG + Intergenic
1164517541 19:28948867-28948889 TGCTCATAAGAACCCCCTCCAGG - Intergenic
1165128281 19:33616486-33616508 GGGTCAGCAAAGCCCCCTGCAGG + Intergenic
1165730178 19:38140207-38140229 TGCTCATGAAATCCACCTCCTGG - Intronic
1167211982 19:48139238-48139260 GGGTGATTAATGCCCCCTGCAGG + Intronic
1168451078 19:56467109-56467131 TGCTAATTAGAGGCCCCTCCTGG - Intronic
925955681 2:8961778-8961800 TGGTCAATTATGCCCCCTGCGGG - Intronic
929433609 2:41909540-41909562 TGCTGAATAAAACCTCCTGCAGG + Intergenic
929433617 2:41909573-41909595 TGCTGAATAAAACCCCCTGCAGG - Intergenic
933757155 2:85648793-85648815 GCCTCCTTCAAGCCCCCTGCTGG - Exonic
934052877 2:88224993-88225015 TGGTCATCAAAGGCCTCTGCAGG - Intergenic
934880130 2:97969510-97969532 TGCTAATTAATGACACCTGCAGG + Intronic
937385568 2:121428860-121428882 TCCTCATTAAAACCCCATGAGGG + Intronic
938114724 2:128595328-128595350 TGCTCAGCAGAGCTCCCTGCTGG - Intergenic
942846530 2:180432705-180432727 TGCTCATTAAAGCTGCTTCCTGG - Intergenic
948173284 2:235923751-235923773 TGCTCATAACAGCCCCACGCTGG - Intronic
1169387670 20:5164978-5165000 TGCCCATTGAAGCCTCCTTCTGG - Intronic
1169491759 20:6077019-6077041 TCCTCATTCAAACCCACTGCTGG - Exonic
1170566638 20:17611542-17611564 TGCTCCTTCAGGCCACCTGCTGG - Intergenic
1171770389 20:29318928-29318950 CGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171906134 20:30900590-30900612 GGCTCATGAAAGCCCCATGTGGG + Intergenic
1173502499 20:43564288-43564310 TGCTCATTAAAGACCAAGGCAGG + Intronic
1174196505 20:48776200-48776222 TCCTCATTAGATGCCCCTGCAGG - Intronic
1175242101 20:57557179-57557201 TGCTCATACAAGGCCCCTGCAGG - Intergenic
1179106541 21:38405552-38405574 TGCTCATTAGAGTCACCTGGGGG - Intronic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG + Intergenic
950740284 3:15045453-15045475 TGCTCTTTAAGTCCCCTTGCTGG + Exonic
954108652 3:48422387-48422409 TGCTCACTGCAGACCCCTGCTGG + Exonic
962860444 3:139395087-139395109 TGCCCATTAAAACACCCTGCAGG - Intergenic
968001330 3:195208859-195208881 TCCTCTTGCAAGCCCCCTGCTGG - Intronic
975022773 4:69510330-69510352 TGCTCATTAAAGACTCATGAAGG - Intronic
975857334 4:78638544-78638566 TAGTCATAAAAGCCCCCAGCTGG - Intergenic
976161292 4:82201903-82201925 TGCTAACTAAAGACCCCTGGGGG + Intergenic
984708276 4:182863650-182863672 TGCTCATTCATGCCTCCTCCAGG + Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
992960252 5:81950847-81950869 TGCTCATGAAATCCAGCTGCTGG - Intergenic
998261494 5:140635161-140635183 GGCTCATCACTGCCCCCTGCGGG + Intergenic
999125355 5:149242175-149242197 TGCTCAGCAGAGCCCCATGCAGG - Intronic
1001320187 5:170674472-170674494 TGCTCATTATTCCTCCCTGCCGG + Intronic
1002145724 5:177179649-177179671 TGCTCATGAGAGCCCCTTGTAGG - Intronic
1007095164 6:39208434-39208456 TTCTTCTCAAAGCCCCCTGCAGG + Intronic
1008136138 6:47779465-47779487 TGCTTATTAAAGCCCCTTGGGGG + Intergenic
1008619915 6:53261701-53261723 TGCTCAGGAAAGCTGCCTGCAGG - Intergenic
1016465648 6:144322453-144322475 TGCTCCACAAAGTCCCCTGCAGG - Intronic
1017642449 6:156507435-156507457 TGCTCATTGACGCCCAGTGCTGG - Intergenic
1024642109 7:51338276-51338298 TGCTCATTGAAAGACCCTGCAGG + Intergenic
1026569625 7:71517985-71518007 AGCTCATGAAAGGCCCCTGGGGG + Intronic
1026967561 7:74450106-74450128 TGCTCAATACTGCCCTCTGCAGG - Intergenic
1029972852 7:104806020-104806042 TGGTAATTAAAGCCTGCTGCAGG + Intronic
1030468970 7:109939095-109939117 TGCACATCAAAGCCTACTGCAGG - Intergenic
1040452599 8:47563117-47563139 TTCTCACTAAAGCCCACTGAGGG + Intronic
1041027619 8:53703345-53703367 TGCTCCTTGAATGCCCCTGCTGG - Intergenic
1047692203 8:127367190-127367212 TGCTCAGTAGAGTCCCCTGAAGG + Intergenic
1048112244 8:131481004-131481026 TGCTCATCAAAGCCAACAGCTGG - Intergenic
1049556454 8:143284802-143284824 TGCTCCACAATGCCCCCTGCTGG + Intergenic
1050800539 9:9607145-9607167 TGCACATCAAAGCCCTCTGAGGG + Intronic
1052404152 9:28038275-28038297 TTCTCATTAGAGGCCCCTTCTGG - Intronic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1057891774 9:98875102-98875124 GGCTCATTAAGGCTCCCTCCAGG + Intergenic
1062497846 9:136839981-136840003 TGCTCCTGGCAGCCCCCTGCAGG + Intronic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1186715978 X:12251743-12251765 TGCTCATTAGAGCCCCTGCCTGG - Intronic
1187514472 X:19954992-19955014 TGATTCTTAAAGCCCCCTGAGGG - Intronic
1188949948 X:36358799-36358821 TACTCATCAAAGCAGCCTGCAGG - Intronic
1195388403 X:104335251-104335273 TGCTAATTAGAGCCTCCTTCTGG + Intergenic
1199373503 X:147080293-147080315 TGCTCATTAAAATCACCTGTAGG + Intergenic
1201175736 Y:11307522-11307544 GGCTCATGAAAGCCCCTTGTGGG - Intergenic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic