ID: 1163529790

View in Genome Browser
Species Human (GRCh38)
Location 19:17842603-17842625
Sequence CTCCAACCCCTGCAGCTACA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 324}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163529790_1163529806 19 Left 1163529790 19:17842603-17842625 CCTTGTAGCTGCAGGGGTTGGAG 0: 1
1: 0
2: 1
3: 30
4: 324
Right 1163529806 19:17842645-17842667 GCGTCGGGAGGGGTCCCCGCGGG 0: 1
1: 0
2: 1
3: 11
4: 124
1163529790_1163529805 18 Left 1163529790 19:17842603-17842625 CCTTGTAGCTGCAGGGGTTGGAG 0: 1
1: 0
2: 1
3: 30
4: 324
Right 1163529805 19:17842644-17842666 AGCGTCGGGAGGGGTCCCCGCGG 0: 1
1: 0
2: 1
3: 6
4: 124
1163529790_1163529807 20 Left 1163529790 19:17842603-17842625 CCTTGTAGCTGCAGGGGTTGGAG 0: 1
1: 0
2: 1
3: 30
4: 324
Right 1163529807 19:17842646-17842668 CGTCGGGAGGGGTCCCCGCGGGG 0: 1
1: 0
2: 1
3: 7
4: 72
1163529790_1163529800 8 Left 1163529790 19:17842603-17842625 CCTTGTAGCTGCAGGGGTTGGAG 0: 1
1: 0
2: 1
3: 30
4: 324
Right 1163529800 19:17842634-17842656 GCCGGCCCTCAGCGTCGGGAGGG 0: 1
1: 0
2: 1
3: 6
4: 75
1163529790_1163529799 7 Left 1163529790 19:17842603-17842625 CCTTGTAGCTGCAGGGGTTGGAG 0: 1
1: 0
2: 1
3: 30
4: 324
Right 1163529799 19:17842633-17842655 AGCCGGCCCTCAGCGTCGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 70
1163529790_1163529796 -10 Left 1163529790 19:17842603-17842625 CCTTGTAGCTGCAGGGGTTGGAG 0: 1
1: 0
2: 1
3: 30
4: 324
Right 1163529796 19:17842616-17842638 GGGGTTGGAGGGGAGGGAGCCGG 0: 1
1: 1
2: 21
3: 277
4: 2338
1163529790_1163529797 3 Left 1163529790 19:17842603-17842625 CCTTGTAGCTGCAGGGGTTGGAG 0: 1
1: 0
2: 1
3: 30
4: 324
Right 1163529797 19:17842629-17842651 AGGGAGCCGGCCCTCAGCGTCGG 0: 1
1: 0
2: 0
3: 11
4: 125
1163529790_1163529802 9 Left 1163529790 19:17842603-17842625 CCTTGTAGCTGCAGGGGTTGGAG 0: 1
1: 0
2: 1
3: 30
4: 324
Right 1163529802 19:17842635-17842657 CCGGCCCTCAGCGTCGGGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 103
1163529790_1163529798 4 Left 1163529790 19:17842603-17842625 CCTTGTAGCTGCAGGGGTTGGAG 0: 1
1: 0
2: 1
3: 30
4: 324
Right 1163529798 19:17842630-17842652 GGGAGCCGGCCCTCAGCGTCGGG 0: 1
1: 0
2: 0
3: 9
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163529790 Original CRISPR CTCCAACCCCTGCAGCTACA AGG (reversed) Exonic
900209210 1:1445289-1445311 CTCCAAGCACTGCAGCTCCGAGG - Intergenic
900219023 1:1497124-1497146 CTCCAAGCACTGCAGCTCCGAGG - Intronic
900780721 1:4615667-4615689 CTACAGCCCCTGCACCTCCAGGG - Intergenic
901828478 1:11878226-11878248 CACCAACTGCTGCAGCTACCCGG + Intergenic
905209137 1:36361452-36361474 CTCCAACTCCTCCTGCTACCAGG + Intronic
905889931 1:41512758-41512780 TTGCAACCCCTGCACCCACAGGG + Intronic
906626579 1:47330825-47330847 CTCCAAACCCTTCAGCTTCTGGG - Intergenic
907409115 1:54272442-54272464 CTCAAACCTCTTCTGCTACAAGG + Intronic
912934546 1:113991732-113991754 CTCCATGCCCTTCAACTACATGG - Intergenic
913552464 1:119929039-119929061 CTCCAACCCCTGCAGCTCTGAGG - Exonic
916725197 1:167517194-167517216 CAGAAACCCCTGCAGCTGCACGG + Intronic
916924211 1:169500533-169500555 CTCAAAACCATGCAACTACATGG + Intergenic
918547014 1:185696522-185696544 CTCCTTCTGCTGCAGCTACATGG + Intergenic
919881769 1:201905717-201905739 CTTCCTCCCTTGCAGCTACATGG - Intronic
920197929 1:204241907-204241929 CTCAAACCCTTGCAGATACAAGG + Intronic
920457245 1:206110446-206110468 CTGCAACCCCTGGATCTACATGG - Exonic
920921322 1:210299756-210299778 CTCCCACACCCACAGCTACAGGG - Intergenic
922084979 1:222337931-222337953 CTCCAACCCCTGCAATGACCTGG - Intergenic
1064285603 10:13988901-13988923 CTCCAGCCTCAGCAACTACACGG + Intronic
1064772547 10:18738427-18738449 CTAGAACCCCTGCAGTTCCAAGG + Intergenic
1065637002 10:27743541-27743563 CTCAGACCCCTGCAGGTTCAGGG + Intronic
1067176931 10:43956713-43956735 TACCAATCCCTGCAGCTACAGGG + Intergenic
1069421819 10:68253304-68253326 CTCCAAGGCCGGCAGCTACCCGG - Intergenic
1071213367 10:83370068-83370090 CTCAAACCTATTCAGCTACATGG - Intergenic
1073102241 10:101012394-101012416 CTCCACCCCCAGCTGCCACAGGG + Intronic
1073311679 10:102547278-102547300 CTCCCAAACCTGCAGCTCCAGGG + Intronic
1074507466 10:114084393-114084415 CACCAGCCCCAGCAGCCACAGGG - Intergenic
1076595111 10:131620401-131620423 CCCCACCCTCTGCAGCTGCAGGG - Intergenic
1077145155 11:1041301-1041323 CTCCAGGCCCAGCAGCTACCAGG - Intergenic
1077184780 11:1231171-1231193 CTCCCACCCCGGCAGCGGCAGGG + Intronic
1077218085 11:1403400-1403422 CTCCAACCCCAGCACCAGCAGGG - Intronic
1077280933 11:1745151-1745173 CCCCAACCCCTGCAGAAACCCGG + Intronic
1077540055 11:3142428-3142450 CTCCATGCCCTGCTGCCACAAGG + Intronic
1077915182 11:6607016-6607038 CCCCAACCCCTTCAGCTGTACGG + Intronic
1079442005 11:20524316-20524338 CTCCAACCCCAGAAGCAGCAAGG - Intergenic
1079968431 11:27006718-27006740 CCCCCATGCCTGCAGCTACATGG - Intergenic
1083722801 11:64611755-64611777 CTCCAACCCCAGCTGCTTCCTGG + Intronic
1084382604 11:68822767-68822789 CTCCGACACCTGCTGCAACATGG + Intronic
1084393967 11:68896830-68896852 CTCCACCCCCTGCAGGCACAAGG + Intronic
1084565127 11:69924262-69924284 CACCGACACCTGCAGCCACAAGG + Intergenic
1085458992 11:76681780-76681802 CTCCAACCCCTGCACCGGCCTGG - Intergenic
1086098254 11:83071860-83071882 CTCCACCCCCTGCTGCTGCTGGG - Exonic
1086240676 11:84686520-84686542 CTCCAATCCCTAAAGTTACATGG + Intronic
1089442425 11:118528642-118528664 CATCACCCCCTGCAGCTCCAGGG - Exonic
1090250097 11:125244999-125245021 CTCCTGCCTCTGCAGGTACATGG - Intronic
1090968254 11:131617016-131617038 CTCCAACTCCTGCATCTGGAGGG + Intronic
1092206274 12:6616007-6616029 CCCCAACCCCTACAGCCACATGG + Intergenic
1092763325 12:11829165-11829187 CTCCAGCTTCTGCAGCTCCAGGG + Intronic
1093197247 12:16143934-16143956 CTCCTTCCACTTCAGCTACATGG - Intergenic
1093896852 12:24583841-24583863 CTCCAAGCCCTCCAGGTCCATGG + Intergenic
1094269507 12:28596978-28597000 CTCCCACCTCTGCATTTACAGGG + Intergenic
1095038354 12:37418752-37418774 CGGCAACCCCTGAAGCTGCAGGG + Intergenic
1095542259 12:43324182-43324204 CTCAAATCCCTGCAGATTCATGG + Intergenic
1096428003 12:51520657-51520679 CTCCCACACCTGCAGCTTCCTGG - Intergenic
1096602813 12:52742353-52742375 CTCCAGTCCCTGCTGCTTCAGGG + Intergenic
1101687767 12:107042999-107043021 CTCCACACCCTGCAGCTACAGGG + Intronic
1102003179 12:109571372-109571394 CTGTAACCCCAGCAGCTACTTGG - Intronic
1102709627 12:114914743-114914765 CCTCAAGCCCTGCAGATACAAGG - Intergenic
1103272156 12:119682216-119682238 CTCCAAGCCCTGGGGCCACAGGG + Intergenic
1105037309 12:132935157-132935179 TTCCAGTCCCAGCAGCTACAAGG + Intronic
1108730796 13:53233599-53233621 CTGCAGCCCCTGCAGCTGAAGGG - Intergenic
1110516932 13:76424396-76424418 CTCAAAACCATGCAGCTACATGG + Intergenic
1112364127 13:98742288-98742310 CGCCAGCCCCTGCTGCTACAGGG + Intronic
1117271595 14:54149418-54149440 CTCAAAACCATGCAACTACATGG + Intergenic
1117752612 14:58939331-58939353 CTCCAAGCCAAGCAGCCACAAGG - Intergenic
1117892901 14:60445911-60445933 CTCAAACCCCCACAACTACATGG + Intronic
1117900381 14:60526543-60526565 CTCAAACCCCCACAACTACACGG - Intergenic
1119473825 14:74915675-74915697 CTCCACTCCCTGCTGCCACAGGG + Intronic
1120647673 14:87092855-87092877 CCCCAGCCCCTGAATCTACACGG - Intergenic
1121185594 14:91964967-91964989 TTCCTACCACTGCATCTACACGG + Intergenic
1121226687 14:92326405-92326427 GTCCCACCCCTGCAGCTGCCCGG - Intronic
1121536590 14:94695289-94695311 CTCCCACCCGTGCAGCTGCAGGG - Intergenic
1122969572 14:105147074-105147096 CTCCAACCCCCACAGCTCCCTGG + Intronic
1124200153 15:27672330-27672352 CTACAACCTCTGCAGCAACCAGG - Intergenic
1125432488 15:39609524-39609546 ACCCAACCCCAGCAGCTGCATGG + Intronic
1126292862 15:47100844-47100866 CTACAACCACTACATCTACAAGG - Intergenic
1126875911 15:53041116-53041138 CTCCAATCCCAGCTGATACAAGG + Intergenic
1127181000 15:56417483-56417505 CTCAAAACCATGCAGTTACATGG - Intronic
1128008773 15:64270907-64270929 CTCAAAACCATGCAGTTACATGG - Intronic
1128272274 15:66321009-66321031 ATCCATCCCCAGCAACTACAAGG + Intronic
1128866902 15:71120903-71120925 CTCCCACCCCTGTAGTCACATGG - Intronic
1130054006 15:80506986-80507008 CTCCACCCACTACAGCTCCATGG - Intronic
1131443438 15:92476051-92476073 CTCACAGCCCTGCAGCTAGAAGG - Intronic
1131513502 15:93062820-93062842 CTTCCACCCCTGCAGCCAGAGGG - Intronic
1133255867 16:4515222-4515244 CTCCATCCCCTGCAGGTGCTGGG - Intronic
1135114619 16:19714330-19714352 CTCCAAGCCCTCCAGGTCCATGG - Exonic
1135421533 16:22308550-22308572 CTCTAGCCCCTCCAGCCACATGG + Intronic
1136344433 16:29665721-29665743 CCACAGCCCTTGCAGCTACAGGG - Exonic
1137292099 16:47058739-47058761 CTCCAAACCCTGCAGCTCAGGGG + Intergenic
1138050075 16:53767079-53767101 CTCCCAGACCTGCAGCTACAGGG + Intronic
1138268936 16:55680878-55680900 CTCCCATCCCTGCAGCTCCCAGG - Intronic
1139582252 16:67880582-67880604 CTCCACTTCCTGCAGCTCCAGGG - Exonic
1140357528 16:74319177-74319199 CTGCATCCCCTCCAGCTCCAGGG + Intergenic
1140430289 16:74897226-74897248 CTGCAGTTCCTGCAGCTACATGG + Intronic
1140456950 16:75111250-75111272 CTCCATCCCCTGCAGGTCCCAGG - Intergenic
1141388628 16:83646036-83646058 CTCCAACCCATACAGCTCCAAGG - Intronic
1141745066 16:85920039-85920061 CTCCAACTCCCGCAGCAGCAGGG - Intronic
1141928367 16:87184167-87184189 CTGCAGCCCCTGCTGTTACAGGG + Intronic
1143786195 17:9257539-9257561 CACGTTCCCCTGCAGCTACAGGG - Intronic
1144899227 17:18568794-18568816 CTTCCACCCCTGCAGCCAGAGGG + Intergenic
1146198199 17:30831118-30831140 CTCCTCCTCCTGCAGCTTCATGG - Intergenic
1146271617 17:31488781-31488803 CTCCCACCACTGCAGCTTCTCGG - Intronic
1147322215 17:39653240-39653262 CCCCAAGCCCAGCAGCCACAGGG - Intronic
1147787703 17:42991578-42991600 CTACCAGCCCTGGAGCTACATGG + Exonic
1147965778 17:44193554-44193576 CTCCAGCCTCTACAGCTTCAAGG - Exonic
1148715900 17:49715658-49715680 CTTGAACCACTGCAGCCACAGGG + Intronic
1149996362 17:61408086-61408108 CCCCTACCCCTACACCTACATGG + Exonic
1151401164 17:73857002-73857024 CTCCCACCCCTGCATCTTCAAGG - Intergenic
1152896344 17:82913579-82913601 CTCCATCGCCGCCAGCTACAGGG - Intronic
1154315594 18:13301036-13301058 CTCCTTCCCCTTCAGCTGCAGGG - Intronic
1156393879 18:36680174-36680196 CACCATCCCTGGCAGCTACAGGG - Intronic
1156457445 18:37302678-37302700 CTCCATCCCCTGCAGCACCCAGG - Intronic
1156460237 18:37317661-37317683 CTCCAACCCCTCCAGAGGCAAGG + Intronic
1156520439 18:37717753-37717775 CTCCCACACCTGCAGAGACAGGG + Intergenic
1157796191 18:50577863-50577885 CTCCTATCACTGCAGATACAAGG - Intronic
1158592612 18:58790281-58790303 CTGCAAGCCCTGCAGCTTCACGG + Intergenic
1158728836 18:60000987-60001009 CTCAAAACCATGCAACTACATGG - Intergenic
1160810069 19:1009409-1009431 CTCCAGCTCCTGCAGCTCCCCGG - Exonic
1161124774 19:2549695-2549717 CTACCACCGCTGCAGCTACCAGG + Intronic
1161262330 19:3344942-3344964 CTCCCTCCGCTGCAGCCACACGG - Intergenic
1161646535 19:5456580-5456602 CTCCACCACCTACAGCTTCAGGG + Exonic
1163280808 19:16316136-16316158 CTCCAAGCATTGCAGCGACAAGG + Intergenic
1163529790 19:17842603-17842625 CTCCAACCCCTGCAGCTACAAGG - Exonic
1164656420 19:29925182-29925204 CTCCAATTCTTGCAGCTACAAGG + Intronic
1164663889 19:30009281-30009303 CTCCAACCCCTAAAGCCTCATGG - Exonic
1164900022 19:31910458-31910480 CTCCAGCCCCAGCAGCTGCATGG + Intergenic
1165773264 19:38390284-38390306 CCCCACCTCCTGCAGGTACATGG + Exonic
1165968465 19:39604790-39604812 CTCCAAGACCTGCACCTGCATGG - Intronic
1166331544 19:42080670-42080692 CTCCAGGCCCAGCAGCTGCATGG - Exonic
1167031756 19:46966863-46966885 CACTAACCCCTGCAGCCTCATGG - Intronic
1167380052 19:49133435-49133457 CTCCTACCCCTCCAGATTCACGG - Intronic
925183619 2:1832465-1832487 CCCCAGCCCCAGCAGCTGCACGG - Intronic
927966326 2:27271781-27271803 CTCCCACCTCTGCAGCTTCCTGG + Intronic
928180519 2:29065247-29065269 CGCCCACCCCTGCAGGCACACGG - Intronic
932497528 2:72153750-72153772 CCCCACCCCTTGCAGCTTCAGGG + Intergenic
932917975 2:75877601-75877623 CTCAAACCTGTGCAGCTAGAGGG + Intergenic
933987462 2:87603764-87603786 TTCCAAACCCTGGAGCTCCATGG - Intergenic
935146461 2:100398856-100398878 CTCCAACCCATGCACACACAAGG - Intronic
935225421 2:101048057-101048079 CTCCGACTCCTGCAACTACACGG + Intronic
936126312 2:109791562-109791584 CTCCAGCCCCTGCAGCGAGGTGG - Intergenic
936218381 2:110579906-110579928 CTCCAGCCCCTGCAGCGAGGTGG + Intergenic
936306377 2:111347044-111347066 TTCCAAACCCTGGAGCTCCATGG + Intergenic
937670855 2:124535851-124535873 CTCCAAACCCTGAACCAACAAGG - Intronic
937826681 2:126374274-126374296 CCCCGACGCCTGCAGCTGCATGG - Intergenic
938216823 2:129525082-129525104 CTCAAAACCATGCAACTACATGG + Intergenic
938329066 2:130436230-130436252 CTCTCACCCCTGCACCTTCAGGG + Intergenic
938360879 2:130685263-130685285 CTCTCACCCCTGCACCTTCAGGG - Intergenic
938437283 2:131291956-131291978 CTCTCACCCCTGCACCTTCAGGG - Intronic
940013239 2:149076994-149077016 CTACAAACCCTGCACCTACTGGG - Intronic
941805842 2:169711747-169711769 CCCCCACACCTGCAGCTGCATGG + Intronic
941806722 2:169717316-169717338 CCCCCACACCTGCAGCTGCATGG + Intronic
943558464 2:189433030-189433052 CTCGAAACCGTGCAACTACATGG + Intergenic
944764989 2:202854997-202855019 CTCAAAACCGTACAGCTACATGG + Intronic
945387249 2:209217292-209217314 CTCGAACCCATGCAAATACATGG + Intergenic
946010251 2:216558715-216558737 CTCCACCACCAGCAGCTACAAGG + Intronic
946610194 2:221449513-221449535 CTCCAACTCCTGCGGCTGAAAGG - Intronic
947286077 2:228516304-228516326 CACAAACCTCTGCAGCTCCAAGG - Intergenic
947954825 2:234179608-234179630 CTCCAACTCCTGCAGACATATGG - Intergenic
948109320 2:235441776-235441798 CTGCAATCCCACCAGCTACATGG + Intergenic
948161336 2:235827356-235827378 CTCCAAGCCCTTCAGCCACGTGG - Intronic
948465672 2:238150552-238150574 TTCCAACCCCTGCAGTCAGAGGG - Intronic
948788321 2:240364594-240364616 CCCCAGCCCCTGCAGCTGCCAGG - Intergenic
1169353126 20:4886117-4886139 CTCCCACCCAGGCAGCTCCAGGG + Intronic
1171292341 20:23989536-23989558 CTCCAGCTCCTGCAGCTCCACGG + Intergenic
1172316105 20:33955656-33955678 CTCCAACCACTGCCACTACCAGG + Intergenic
1172853495 20:37983520-37983542 CTCCACCCTGTGCAGCTGCACGG - Exonic
1175367831 20:58467651-58467673 CTTCCACCCCTGCAGCTGCGAGG - Exonic
1176032965 20:63022629-63022651 CCCCACCCCCTGCAGCCGCATGG - Intergenic
1176186429 20:63782438-63782460 CTGCATCCCCTGGAGCTCCAGGG - Intronic
1176300047 21:5095120-5095142 CCCCAAACCCTGCAGCTCCCGGG - Intergenic
1177074102 21:16550317-16550339 CTCCCACCCCTGAGGCGACAAGG - Intergenic
1177573446 21:22920548-22920570 CTCAAAACCATGCAACTACATGG + Intergenic
1178514726 21:33236825-33236847 CCCCAGGCCCTGCAGCTAGAAGG - Intronic
1179856975 21:44166791-44166813 CCCCAAACCCTGCAGCTCCCGGG + Intergenic
1179883912 21:44305426-44305448 CTCCAGCCTCTGCAAGTACAGGG + Intronic
1180823409 22:18847297-18847319 CTCCAGCTCCTACAGCTCCACGG + Exonic
1181123833 22:20690396-20690418 CTCCAGCTCCTACAGCTCCACGG + Intergenic
1181189333 22:21127249-21127271 CTCCAGCTCCTACAGCTCCACGG - Exonic
1181209865 22:21283246-21283268 CTCCAGCTCCTACAGCTCCACGG + Intergenic
1181399650 22:22643698-22643720 CTCCAGCTCCTACAGCTCCACGG - Intergenic
1181649766 22:24252370-24252392 CTCCAGCTCCTACAGCTCCACGG + Intergenic
1181674783 22:24444607-24444629 CTCCAAGCCCTGCAGCTCTGTGG + Intergenic
1181707608 22:24658376-24658398 CTCCAGCTCCTACAGCTCCACGG - Intergenic
1182383723 22:29916939-29916961 CTCAAACTACTGCAGTTACAGGG - Intronic
1182526985 22:30926738-30926760 CCCCTCCCCCTGCAGCTACAGGG + Exonic
1183023257 22:35044190-35044212 CTCCAACCCCAGCAAATTCATGG + Intergenic
1183041391 22:35181221-35181243 CTGGAAGCCCTGCAGATACAAGG + Intergenic
1183357063 22:37365212-37365234 CCCCAAACCCTGCAGCCACAAGG + Intergenic
1183955850 22:41380557-41380579 CCCCAACCCCTCCTGCTAGAAGG + Intronic
1185003097 22:48258176-48258198 CACCAAAACCTGCAGCTAAAGGG - Intergenic
1185227760 22:49662836-49662858 CGCCAACCCCTGCGGCTGCACGG + Intergenic
1185368709 22:50448633-50448655 CTCCAGCCTCTGCAGCTCCTGGG + Exonic
1203217081 22_KI270731v1_random:12187-12209 CTCCAGCTCCTACAGCTCCATGG - Intergenic
1203273550 22_KI270734v1_random:73203-73225 CTCCAGCTCCTACAGCTCCACGG + Intergenic
949456370 3:4243554-4243576 CTCAAAACCATGCAACTACATGG - Intronic
949532351 3:4968599-4968621 CTCAAAACCACGCAGCTACATGG + Intergenic
950626233 3:14249162-14249184 CACCAGCCCCAGCAGCTGCATGG + Intergenic
950678350 3:14568210-14568232 GTCCCTCCCCTGCAGCCACAGGG - Intergenic
950880058 3:16316387-16316409 GTCCATCCCCTGCAGCTACTTGG - Exonic
951474459 3:23090601-23090623 CTCAAAACCATGCAACTACATGG - Intergenic
951490624 3:23266903-23266925 CTCAAAACCATGCAACTACATGG + Intronic
951493511 3:23299576-23299598 CTCAAAACCGTGCAACTACATGG - Intronic
951498045 3:23352082-23352104 CTCAAAACCGTGCAACTACATGG + Intronic
952238491 3:31505679-31505701 CTCCAACTCCTGTCCCTACATGG + Intergenic
953024521 3:39137180-39137202 GTCTAACACCTGCAGCTACATGG + Exonic
953235486 3:41102810-41102832 CTCCAATCCCACCAGCTTCAGGG + Intergenic
953759372 3:45674659-45674681 CTCCTAGCTCTGCAGCTTCAGGG - Intronic
953792889 3:45962029-45962051 CTCCAGCGCCTGCAGGTACCAGG - Intronic
954461743 3:50630713-50630735 CTCCAAGCCTTGAAGCTGCATGG + Intronic
954491277 3:50908513-50908535 CTCCAACCCTCACAACTACAAGG - Intronic
954806451 3:53223674-53223696 CTCCCACCCCTGCTGGTAAAGGG - Intergenic
956057649 3:65317640-65317662 CCACAAACCCTGCAGCCACATGG + Intergenic
956695167 3:71912527-71912549 CTCCCACCCCTGCTGGTCCATGG - Intergenic
960545690 3:118912327-118912349 CTCCAAGTCCTGCAGCTTCTTGG - Intronic
960776797 3:121265322-121265344 CTCAAAACCATGCAACTACATGG + Intronic
961445548 3:126979366-126979388 CTCCAACCCCAGCTCCTCCAAGG + Intergenic
961458827 3:127037597-127037619 CTCAGACCCCTGAAGCTCCAAGG - Intergenic
961482603 3:127193571-127193593 CTCCACCCGCTGCAGCTGCGAGG + Intronic
961939183 3:130619741-130619763 CTCAAAACCCCTCAGCTACAAGG - Intronic
962199780 3:133391743-133391765 CTCCAACCCATCCTGCTGCAGGG + Intronic
962943492 3:140146822-140146844 CTCTAATCCCTCCAGCAACAGGG + Intronic
963481229 3:145877324-145877346 CTCAAAACCAGGCAGCTACATGG - Intergenic
963522294 3:146370593-146370615 CTCAAAACCCTGCAAATACATGG - Intergenic
964390991 3:156198080-156198102 CTCAAAACCATGCAACTACATGG - Intronic
964642944 3:158929395-158929417 CCCCAGCCCCTATAGCTACATGG - Intergenic
965649720 3:170920872-170920894 CTCAAAACCATGCAGTTACATGG + Intergenic
965855820 3:173086826-173086848 CTCAAAACCATGCAACTACATGG - Intronic
966152607 3:176880644-176880666 CTCCAAACCATGCAACTACATGG + Intergenic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
966850956 3:184164781-184164803 TTCCATCCCCTGCAGCAACCCGG + Exonic
968009847 3:195267110-195267132 CTGCAACCATTTCAGCTACAAGG + Intronic
968359469 3:198137254-198137276 CTCTGACCTCTGCAGCTACTCGG + Intergenic
968390124 4:185293-185315 CTCAAAACCATGCAACTACATGG - Intergenic
968783211 4:2598973-2598995 GTCAGACCCCTGCAGATACAAGG - Intronic
969182734 4:5454616-5454638 CTCTGACCACTGCTGCTACAGGG - Intronic
969314009 4:6370706-6370728 CTCCAGCCCCTGAAGCCACCTGG + Intronic
969544097 4:7812606-7812628 CTCAGCCCCCTGCAGCTAGAGGG + Intronic
970014922 4:11502885-11502907 CTCCAATGCCTGGAGCTAGAAGG - Intergenic
970728244 4:19072561-19072583 CTTCAACCCTTACAGCCACAAGG + Intergenic
972097116 4:35362031-35362053 CTCCAAACCATGCAAATACATGG - Intergenic
974086074 4:57262961-57262983 AGGCAGCCCCTGCAGCTACATGG + Intergenic
974836365 4:67256154-67256176 CTCAAAACCATACAGCTACATGG + Intergenic
975660253 4:76681540-76681562 CTGCAACCCCAGGAGCTAGAGGG - Intronic
975687020 4:76926971-76926993 CTCGCTCCGCTGCAGCTACAGGG + Intergenic
978929189 4:114289885-114289907 CTCAAAACCATGCAACTACATGG + Intergenic
979827640 4:125258951-125258973 CTCCAAACCATTCAACTACATGG - Intergenic
981775262 4:148359876-148359898 CTCCAGCCTCTGTAGTTACATGG - Intronic
982265183 4:153532057-153532079 ATATAACCCCTGCTGCTACAAGG - Intronic
987708641 5:21483747-21483769 CTCCAGCTCCTACAGCTCCACGG - Intergenic
988609712 5:32712743-32712765 CTCCAACCCCTTCACCTCCCTGG - Intronic
988750969 5:34190398-34190420 CTCCAGCTCCTACAGCTCCACGG + Intergenic
989083804 5:37654236-37654258 CTCAAAACCATGCAACTACATGG - Intronic
990528200 5:56649649-56649671 CTCCAACCCCTGCAGAACCTGGG + Intergenic
991736111 5:69632322-69632344 CTCCAGCTCCTACAGCTCCACGG + Intergenic
991739241 5:69653610-69653632 CTCCAGCTCCTACAGCTCCACGG + Intergenic
991758957 5:69902821-69902843 CTCCAGCTCCTACAGCTCCACGG - Intergenic
991788379 5:70215301-70215323 CTCCAGCTCCTACAGCTCCACGG + Intergenic
991790816 5:70233351-70233373 CTCCAGCTCCTACAGCTCCACGG + Intergenic
991812611 5:70487961-70487983 CTCCAGCTCCTACAGCTCCACGG + Intergenic
991815568 5:70508438-70508460 CTCCAGCTCCTACAGCTCCACGG + Intergenic
991818702 5:70529727-70529749 CTCCAGCTCCTACAGCTCCACGG + Intergenic
991838186 5:70777887-70777909 CTCCAGCTCCTACAGCTCCACGG - Intergenic
991880826 5:71215665-71215687 CTCCAGCTCCTACAGCTCCACGG + Intergenic
991883263 5:71233686-71233708 CTCCAGCTCCTACAGCTCCACGG + Intergenic
992196835 5:74348393-74348415 CTCAAAACCATGCAACTACATGG - Intergenic
993263768 5:85695071-85695093 CTCAAAACCATGCAGTTACATGG - Intergenic
994420700 5:99524773-99524795 CTCCAGCTCCTACAGCTCCACGG - Intergenic
994486343 5:100389541-100389563 CTCCAGCTCCTACAGCTCCACGG + Intergenic
997336908 5:133115002-133115024 CCCCAGCCCCTGCAGCTTGAAGG + Intergenic
998542869 5:142999340-142999362 CTCCTACCCCCTCAGCTAAAAGG - Intronic
998556506 5:143130076-143130098 CAGCAACACCTACAGCTACACGG - Intronic
999759125 5:154686811-154686833 CTGCAATCCCTGCAGTTACCAGG - Intergenic
1000218302 5:159186147-159186169 CTGCAACCCCTGCCCCTACCAGG - Intronic
1001124624 5:169008318-169008340 CTCCCAGCCTTGCAGCTTCATGG - Intronic
1001176931 5:169478607-169478629 CTCAAAACCTTGCAGATACATGG - Intergenic
1001392194 5:171388155-171388177 CTCCAATCCCTCCAGGTCCAGGG - Intronic
1003261509 6:4520980-4521002 CTCCAGCCCCAGCACCTAAAGGG + Intergenic
1005549118 6:26897027-26897049 CTCCAGCTCCTACAGCTCCACGG + Intergenic
1006421252 6:33935532-33935554 CTCCCGCCCCTGCAGCCACTGGG - Intergenic
1006828857 6:36956723-36956745 CTACAACCACTGTAGCTACAAGG - Intronic
1007194838 6:40051400-40051422 CTCCAACCCCTGGATCAACTGGG + Intergenic
1007219178 6:40265056-40265078 CTCCAACACCAGCACCTTCAGGG + Intergenic
1008175939 6:48268292-48268314 CTCAAAACCACGCAGCTACATGG - Intergenic
1009019861 6:57938137-57938159 CTCCAGCTCCTACAGCTCCACGG + Intergenic
1010172168 6:72987035-72987057 CTCCAAGCCCTTCAGGTCCATGG + Intronic
1013154731 6:107482441-107482463 CTACAACTGCTGCAGCAACAAGG + Intergenic
1013375450 6:109509922-109509944 CCCCAACCCCTGCAGGCTCAGGG + Intronic
1013907904 6:115238957-115238979 CTCCACCCCCTACAGCTTGAAGG + Intergenic
1015883353 6:137891667-137891689 CTCCAACCCCTTGAGCTTCCCGG + Intergenic
1016417790 6:143851179-143851201 CTCCAACACCCTCTGCTACATGG - Intronic
1016908485 6:149174265-149174287 GTGCAGCCCTTGCAGCTACAAGG + Intergenic
1016909896 6:149188104-149188126 CTCAAACCCATGCAAATACAAGG - Intergenic
1017326790 6:153150080-153150102 CCCCCACGCCTGCAGCTGCATGG - Intergenic
1017327184 6:153152738-153152760 CCCCCACACCTGCAGCTGCATGG - Intergenic
1017717883 6:157224713-157224735 CTCCAGCGCCTGCCGCTGCAGGG - Intergenic
1018955467 6:168407187-168407209 CTTCATCTCCTGTAGCTACAGGG - Intergenic
1019260531 7:79421-79443 CTCCGACCTCTGCAGCTACTCGG - Intergenic
1020355463 7:7271014-7271036 CTTCAAGACCTGCTGCTACATGG + Intergenic
1021551574 7:21876685-21876707 CTGCAACTCCTGCAGCCACCTGG - Intronic
1023086595 7:36576168-36576190 CTCCAACCCCAGCAGAAACGTGG + Intronic
1023671665 7:42583863-42583885 CTCAAAACCGCGCAGCTACATGG - Intergenic
1023689027 7:42766993-42767015 CTTCCACCTCTGCAGCTAGATGG + Intergenic
1026363681 7:69626124-69626146 CTGCCATCCATGCAGCTACAAGG - Intronic
1026896010 7:74010457-74010479 CACCAAGCCCAGCAGCCACAAGG + Intergenic
1029135194 7:98365594-98365616 ATCCACCCCCCGCAGCTACTTGG - Intronic
1030463541 7:109871454-109871476 CTCCATCCAATGCAGCCACATGG + Intergenic
1030646768 7:112070264-112070286 CTCCCACCCCTGTATCTAAAGGG - Intronic
1030702793 7:112659847-112659869 CTCAAAACCATGCAACTACATGG - Intergenic
1031002894 7:116438094-116438116 CTCCAATCACTGGATCTACAAGG + Intronic
1031920239 7:127595085-127595107 CTTCCACCCCTGCAGCCAGATGG - Intronic
1032075423 7:128833624-128833646 CCCCAACCCCTGCAGCCTCAAGG + Intronic
1032968773 7:137133970-137133992 CTCAAAACCATGCAACTACATGG + Intergenic
1034155705 7:148954790-148954812 CTCCAAACCCTGCAACAAGAAGG - Intergenic
1034427384 7:151021229-151021251 CTGCAACCTCTTCAGCTACTGGG - Exonic
1034983625 7:155494294-155494316 GTCCAACCACTGCATTTACAGGG + Intronic
1035972899 8:4271257-4271279 CACCAACCCCTACAGCTTCATGG - Intronic
1037696707 8:21230020-21230042 CTCAAACCCATGTAGCTACTGGG + Intergenic
1037998153 8:23368312-23368334 CTCCCACCTCTGCAGCTGCCTGG - Exonic
1038019044 8:23537538-23537560 CTCCAAGCCCAGCAGCTTCCTGG + Intronic
1040286799 8:46104574-46104596 CTCCAACCCCTGAAGTGACCAGG - Intergenic
1040299634 8:46181161-46181183 CTCCAAACCCTGGAGCTTTACGG + Intergenic
1040861945 8:52008228-52008250 CTCCACACCCTCCAGCTACGAGG - Intergenic
1041972337 8:63758349-63758371 CTCAAAACCATACAGCTACACGG - Intergenic
1043626870 8:82273001-82273023 CACCAATCCCTGCCCCTACAAGG + Intergenic
1047119183 8:121881275-121881297 CCCCTACCCCTGGACCTACAAGG - Intergenic
1047441305 8:124880752-124880774 CTCCAAACCCTCCAGCCAAATGG - Intergenic
1047906029 8:129474151-129474173 CCCCCACACCTGCAGCTGCATGG - Intergenic
1048163024 8:132038319-132038341 CTCCAGCGCCTGCAGCAAAAGGG - Intronic
1048473448 8:134723174-134723196 CTCCAATCCCTGGAGTAACAGGG + Intergenic
1052329661 9:27254327-27254349 CTCAAAACCCTACAACTACATGG + Intergenic
1053009422 9:34624808-34624830 CTCCCACCGCTCCAGCTGCAGGG - Intronic
1053281284 9:36821047-36821069 CCCCAACCCCACCAGCTCCATGG - Intergenic
1055125095 9:72710141-72710163 CTCCAATCCATGCAAATACATGG - Intronic
1057037150 9:91819152-91819174 CTGCAGCCCCCGCAGCCACAGGG + Intronic
1057597975 9:96432563-96432585 CACCATCCCCCGCAACTACATGG + Intergenic
1059402798 9:114081184-114081206 CTCCCACCCCAGCAGCCAGAAGG - Intergenic
1060976027 9:127765594-127765616 CTCCACCCCCTGCAGCCTCAGGG + Intronic
1061224272 9:129271659-129271681 CCCCAACCCCTGCAGCTGAGTGG - Intergenic
1061230409 9:129312593-129312615 CTCCATCCCCTCCAGCAGCAGGG - Intergenic
1061405970 9:130393295-130393317 CTCCATACCCTGCACCTGCAAGG - Intronic
1061664383 9:132151913-132151935 CCCCAAACCCAGCAGCTACCTGG - Intergenic
1061924830 9:133800905-133800927 CTTCAACCCCTGCACCAGCAGGG + Intronic
1062048836 9:134436947-134436969 TCCCAACTCCTGCAGCTCCAGGG - Exonic
1062189714 9:135241819-135241841 CTCAAACCTGTGCAGCTTCATGG - Intergenic
1062216022 9:135390313-135390335 CTCCAGCCCCGGCAGCCGCATGG + Intergenic
1062430274 9:136523777-136523799 CACCAACCCCTGCCGCAACGGGG - Exonic
1062744156 9:138200968-138200990 CTCCGACCTCTGCAGCTACTCGG + Intergenic
1186253562 X:7695448-7695470 ATCCAACCACTGCAACTTCATGG + Intergenic
1186898884 X:14032331-14032353 TTCCATTCCCTGCAGCAACAAGG - Intergenic
1188429725 X:30092751-30092773 CTCCGACCTCTGCAGATACCTGG + Intergenic
1189721598 X:43925168-43925190 CTCAAAACCGTGCAACTACATGG - Intergenic
1191573337 X:62660804-62660826 CTCCAAACCCCTCAACTACATGG - Intergenic
1191850127 X:65580143-65580165 CTCAAACACCTGCAGCAACTTGG - Intergenic
1191902537 X:66054875-66054897 CTCCAGCCTCTACAGCTTCAAGG - Intergenic
1197010151 X:121551146-121551168 CTTCAACCCCAGCAGCAGCAGGG + Intergenic
1198222149 X:134612655-134612677 CTCTAAGCCCTGGAGCCACAGGG + Intronic